ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast13c10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_550375.1| Oryza sativa (japonica cultivar-group), mRNA 66 7e-08
2dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 66 7e-08
3dbj|AP002864.2| Oryza sativa (japonica cultivar-group) genomic D... 66 7e-08
4dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic D... 66 7e-08
5dbj|AK103637.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 7e-08
6dbj|AK101305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 7e-08
7dbj|AK059170.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 7e-08
8emb|X60432.1|ZMPRP Z.mays PRP gene 54 3e-04
9gb|AY094261.1| Zea mays cultivar C_9 proline rich protein, 3' UT... 54 3e-04
10gb|AY094260.1| Zea mays cultivar F_7 proline rich protein, 3' UT... 54 3e-04
11gb|AY094259.1| Zea mays cultivar D_9 proline rich protein, 3' UT... 54 3e-04
12gb|AY094258.1| Zea mays cultivar D_6 proline rich protein, 3' UT... 54 3e-04
13gb|AY094257.1| Zea mays cultivar F_1 proline rich protein, 3' UT... 54 3e-04
14gb|AY094256.1| Zea mays cultivar Mo17 proline rich protein, 3' U... 54 3e-04
15gb|AY094255.1| Zea mays cultivar D_7 proline rich protein, 3' UT... 54 3e-04
16gb|AY094254.1| Zea mays cultivar Wf9Ht proline rich protein, 3' ... 54 3e-04
17gb|AY094251.1| Zea mays cultivar B84 proline rich protein, 3' UT... 54 3e-04
18gb|AY094250.1| Zea mays cultivar H60 proline rich protein, 3' UT... 54 3e-04
19gb|AY094249.1| Zea mays cultivar DE811 proline rich protein, 3' ... 54 3e-04
20gb|AY094248.1| Zea mays cultivar 684 proline rich protein, 3' UT... 54 3e-04
21gb|AY094247.1| Zea mays cultivar D71-4HT proline rich protein, 3... 54 3e-04
22gb|AY094246.1| Zea mays cultivar H99 proline rich protein, 3' UT... 54 3e-04
23gb|AY094245.1| Zea mays cultivar IVANA proline rich protein, 3' ... 54 3e-04
24gb|AY094244.1| Zea mays cultivar CO109 proline rich protein, 3' ... 54 3e-04
25gb|AY094243.1| Zea mays cultivar I_1 proline rich protein, 3' UT... 54 3e-04
26gb|AY094242.1| Zea mays cultivar B73 proline rich protein, 3' UT... 54 3e-04
27gb|AY094241.1| Zea mays cultivar F_2 proline rich protein, 3' UT... 54 3e-04
28gb|AY094240.1| Zea mays cultivar G_1 proline rich protein, 3' UT... 54 3e-04
29gb|AY094239.1| Zea mays cultivar B_6 proline rich protein, 3' UT... 54 3e-04
30gb|AY094238.1| Zea mays cultivar H_4 proline rich protein, 3' UT... 54 3e-04
31gb|AY094237.1| Zea mays cultivar F_4 proline rich protein, 3' UT... 54 3e-04
32gb|AY094236.1| Zea mays cultivar F_3 proline rich protein, 3' UT... 54 3e-04
33gb|AY094235.1| Zea mays cultivar F_5 proline rich protein, 3' UT... 54 3e-04
34gb|AY094234.1| Zea mays cultivar H_5 proline rich protein, 3' UT... 54 3e-04
35gb|AY094233.1| Zea mays cultivar H_3 proline rich protein, 3' UT... 54 3e-04
36gb|AY094232.1| Zea mays cultivar J40 proline rich protein, 3' UT... 54 3e-04
37gb|AY094231.1| Zea mays cultivar 647 proline rich protein, 3' UT... 54 3e-04
38gb|AY094230.1| Zea mays cultivar B_1 proline rich protein, 3' UT... 54 3e-04
39gb|AY094229.1| Zea mays cultivar F_6 proline rich protein, 3' UT... 54 3e-04
40gb|AY094228.1| Zea mays cultivar C_5 proline rich protein, 3' UT... 54 3e-04
41gb|AY094227.1| Zea mays cultivar H_1 proline rich protein, 3' UT... 54 3e-04
42gb|AY105001.1| Zea mays PCO123892 mRNA sequence 54 3e-04
43gb|BT017960.1| Zea mays clone EL01N0523B04.c mRNA sequence 48 0.016
44emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chr... 48 0.016
45gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 44 0.25
46gb|AC132863.8| Mus musculus chromosome 15, clone RP24-388K7, com... 40 3.9
47gb|AC104514.2| Drosophila melanogaster clone BACR22L21, complete... 40 3.9
48gb|AC118540.15| Mus musculus strain 129/SvJ clone mgs1-169d12 ma... 40 3.9
49gb|AC127283.2| Mus musculus BAC clone RP23-323E20 from chromosom... 40 3.9
50gb|DQ397636.1| Cenarchaeum symbiosum clone C07D10, complete sequ... 40 3.9
51gb|DQ397625.1| Cenarchaeum symbiosum clone C20B06, complete sequ... 40 3.9
52gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 3.9
53dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.9
54dbj|AK073019.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 3.9
55gb|U70853.1| Caenorhabditis elegans cosmid M01H9, complete sequence 40 3.9
56gb|AY105889.1| Zea mays PCO106909 mRNA sequence 40 3.9
57gb|AE003801.4| Drosophila melanogaster chromosome 2R, section 49... 40 3.9
58gb|AY449459.1| Oikopleura dioica clone BACOIKO003 5xk14, complet... 40 3.9
59gb|AC131299.11| Mus musculus chromosome 15, clone RP23-335O2, co... 40 3.9
60emb|AL731593.2|OSJN00235 Oryza sativa genomic DNA, chromosome 4,... 40 3.9
61gb|AC005298.1|AC005298 Drosophila melanogaster DNA sequence (P1s... 40 3.9 
>ref|XM_550375.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 992

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 238 ggggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcagc 286
           |||||||| |||||||   ||||||||||||||||||||||||||||||
Sbjct: 757 ggggcacttgaagccgggaggcgggtgcttgccgcaggtgatgagcagc 709
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                                
Query: 238     ggggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcagc 286
               |||||||| |||||||   ||||||||||||||||||||||||||||||
Sbjct: 3455048 ggggcacttgaagccgggaggcgggtgcttgccgcaggtgatgagcagc 3455096
to top
>dbj|AP002864.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0033B09
          Length = 143545

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                              
Query: 238   ggggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcagc 286
             |||||||| |||||||   ||||||||||||||||||||||||||||||
Sbjct: 71752 ggggcacttgaagccgggaggcgggtgcttgccgcaggtgatgagcagc 71800
to top
>dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone
              P0680A03
          Length = 156054

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                               
Query: 238    ggggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcagc 286
              |||||||| |||||||   ||||||||||||||||||||||||||||||
Sbjct: 146602 ggggcacttgaagccgggaggcgggtgcttgccgcaggtgatgagcagc 146650
to top
>dbj|AK103637.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033134F12, full
           insert sequence
          Length = 1013

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 238 ggggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcagc 286
           |||||||| |||||||   ||||||||||||||||||||||||||||||
Sbjct: 757 ggggcacttgaagccgggaggcgggtgcttgccgcaggtgatgagcagc 709
to top
>dbj|AK101305.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033033M04, full
           insert sequence
          Length = 992

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 238 ggggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcagc 286
           |||||||| |||||||   ||||||||||||||||||||||||||||||
Sbjct: 757 ggggcacttgaagccgggaggcgggtgcttgccgcaggtgatgagcagc 709
to top
>dbj|AK059170.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-E12, full
            insert sequence
          Length = 1384

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                             
Query: 238  ggggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcagc 286
            |||||||| |||||||   ||||||||||||||||||||||||||||||
Sbjct: 1174 ggggcacttgaagccgggaggcgggtgcttgccgcaggtgatgagcagc 1126
to top
>emb|X60432.1|ZMPRP Z.mays PRP gene
          Length = 1402

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 239  gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
            ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 1010 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 964
to top
>gb|AY094261.1| Zea mays cultivar C_9 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094260.1| Zea mays cultivar F_7 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094259.1| Zea mays cultivar D_9 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094258.1| Zea mays cultivar D_6 proline rich protein, 3' UTR and partial cds
          Length = 314

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 238 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 284
to top
>gb|AY094257.1| Zea mays cultivar F_1 proline rich protein, 3' UTR and partial cds
          Length = 314

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 238 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 284
to top
>gb|AY094256.1| Zea mays cultivar Mo17 proline rich protein, 3' UTR and partial cds
          Length = 314

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 238 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 284
to top
>gb|AY094255.1| Zea mays cultivar D_7 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094254.1| Zea mays cultivar Wf9Ht proline rich protein, 3' UTR and partial
           cds
          Length = 297

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 221 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 267
to top
>gb|AY094251.1| Zea mays cultivar B84 proline rich protein, 3' UTR and partial cds
          Length = 314

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 238 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 284
to top
>gb|AY094250.1| Zea mays cultivar H60 proline rich protein, 3' UTR and partial cds
          Length = 303

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 227 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 273
to top
>gb|AY094249.1| Zea mays cultivar DE811 proline rich protein, 3' UTR and partial
           cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094248.1| Zea mays cultivar 684 proline rich protein, 3' UTR and partial cds
          Length = 313

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 237 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 283
to top
>gb|AY094247.1| Zea mays cultivar D71-4HT proline rich protein, 3' UTR and partial
           cds
          Length = 307

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 231 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 277
to top
>gb|AY094246.1| Zea mays cultivar H99 proline rich protein, 3' UTR and partial cds
          Length = 307

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 231 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 277
to top
>gb|AY094245.1| Zea mays cultivar IVANA proline rich protein, 3' UTR and partial
           cds
          Length = 314

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 238 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 284
to top
>gb|AY094244.1| Zea mays cultivar CO109 proline rich protein, 3' UTR and partial
           cds
          Length = 303

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 227 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 273
to top
>gb|AY094243.1| Zea mays cultivar I_1 proline rich protein, 3' UTR and partial cds
          Length = 305

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 229 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 275
to top
>gb|AY094242.1| Zea mays cultivar B73 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094241.1| Zea mays cultivar F_2 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094240.1| Zea mays cultivar G_1 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094239.1| Zea mays cultivar B_6 proline rich protein, 3' UTR and partial cds
          Length = 314

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 238 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 284
to top
>gb|AY094238.1| Zea mays cultivar H_4 proline rich protein, 3' UTR and partial cds
          Length = 314

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 238 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 284
to top
>gb|AY094237.1| Zea mays cultivar F_4 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094236.1| Zea mays cultivar F_3 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094235.1| Zea mays cultivar F_5 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094234.1| Zea mays cultivar H_5 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094233.1| Zea mays cultivar H_3 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094232.1| Zea mays cultivar J40 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094231.1| Zea mays cultivar 647 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094230.1| Zea mays cultivar B_1 proline rich protein, 3' UTR and partial cds
          Length = 314

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 238 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 284
to top
>gb|AY094229.1| Zea mays cultivar F_6 proline rich protein, 3' UTR and partial cds
          Length = 314

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 238 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 284
to top
>gb|AY094228.1| Zea mays cultivar C_5 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY094227.1| Zea mays cultivar H_1 proline rich protein, 3' UTR and partial cds
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 239 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 285
to top
>gb|AY105001.1| Zea mays PCO123892 mRNA sequence
          Length = 1144

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 239 gggcactggaagccgttgggcgggtgcttgccgcaggtgatgagcag 285
           ||||||||||||||    |||| ||||||||||||||||||||||||
Sbjct: 671 gggcactggaagcccgacggcgcgtgcttgccgcaggtgatgagcag 625
to top
>gb|BT017960.1| Zea mays clone EL01N0523B04.c mRNA sequence
          Length = 1282

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 262 gtgcttgccgcaggtgatgagcag 285
           ||||||||||||||||||||||||
Sbjct: 861 gtgcttgccgcaggtgatgagcag 838
to top
>emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chromosome 7, complete
              sequence
          Length = 215366

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 202    catgcaggctaggctaggctaggc 225
              ||||||||||||||||||||||||
Sbjct: 139579 catgcaggctaggctaggctaggc 139602
to top
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 258     gcgggtgcttgccgcaggtgat 279
               ||||||||||||||||||||||
Sbjct: 2594989 gcgggtgcttgccgcaggtgat 2595010
to top
>gb|AC132863.8| Mus musculus chromosome 15, clone RP24-388K7, complete sequence
          Length = 210979

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 207    aggctaggctaggctaggcg 226
              ||||||||||||||||||||
Sbjct: 136589 aggctaggctaggctaggcg 136570
to top
>gb|AC104514.2| Drosophila melanogaster clone BACR22L21, complete sequence
          Length = 170718

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   caggctaggctaggctaggc 225
             ||||||||||||||||||||
Sbjct: 59390 caggctaggctaggctaggc 59409
to top
>gb|AC118540.15| Mus musculus strain 129/SvJ clone mgs1-169d12 map 3, complete sequence
          Length = 191014

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   caggctaggctaggctaggc 225
             ||||||||||||||||||||
Sbjct: 72803 caggctaggctaggctaggc 72822
to top
>gb|AC127283.2| Mus musculus BAC clone RP23-323E20 from chromosome 3, complete sequence
          Length = 210014

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    caggctaggctaggctaggc 225
              ||||||||||||||||||||
Sbjct: 101172 caggctaggctaggctaggc 101191
to top
>gb|DQ397636.1| Cenarchaeum symbiosum clone C07D10, complete sequence
          Length = 36261

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   ttgggcgggtgcttgccgca 273
             ||||||||||||||||||||
Sbjct: 27616 ttgggcgggtgcttgccgca 27597
to top
>gb|DQ397625.1| Cenarchaeum symbiosum clone C20B06, complete sequence
          Length = 45713

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   ttgggcgggtgcttgccgca 273
             ||||||||||||||||||||
Sbjct: 24144 ttgggcgggtgcttgccgca 24125
to top
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 240     ggcactggaagccgttgggcgggt 263
               |||||||||| |||||||||||||
Sbjct: 1223748 ggcactggaatccgttgggcgggt 1223771
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 206      caggctaggctaggctaggc 225
                ||||||||||||||||||||
Sbjct: 22247461 caggctaggctaggctaggc 22247480
to top
>dbj|AK073019.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023150A21, full
           insert sequence
          Length = 2797

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 206 caggctaggctaggctaggc 225
           ||||||||||||||||||||
Sbjct: 508 caggctaggctaggctaggc 489
to top
>gb|U70853.1| Caenorhabditis elegans cosmid M01H9, complete sequence
          Length = 30522

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 207  aggctaggctaggctaggcg 226
            ||||||||||||||||||||
Sbjct: 7054 aggctaggctaggctaggcg 7073
to top
>gb|AY105889.1| Zea mays PCO106909 mRNA sequence
          Length = 1420

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 265 cttgccgcaggtgatgagcagccggagcgcca 296
           |||||||||||||| ||| ||| |||||||||
Sbjct: 929 cttgccgcaggtgaggaggagctggagcgcca 898
to top
>gb|AE003801.4| Drosophila melanogaster chromosome 2R, section 49 of 73 of the complete
              sequence
          Length = 254899

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    caggctaggctaggctaggc 225
              ||||||||||||||||||||
Sbjct: 136512 caggctaggctaggctaggc 136531
to top
>gb|AY449459.1| Oikopleura dioica clone BACOIKO003 5xk14, complete sequence
          Length = 158922

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   aggctaggctaggctaggcg 226
             ||||||||||||||||||||
Sbjct: 93297 aggctaggctaggctaggcg 93316
to top
>gb|AC131299.11| Mus musculus chromosome 15, clone RP23-335O2, complete sequence
          Length = 215708

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   aggctaggctaggctaggcg 226
             ||||||||||||||||||||
Sbjct: 12874 aggctaggctaggctaggcg 12855
to top
>emb|AL731593.2|OSJN00235 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0027P08,
              complete sequence
          Length = 118959

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    caggctaggctaggctaggc 225
              ||||||||||||||||||||
Sbjct: 117322 caggctaggctaggctaggc 117341
to top
>gb|AC005298.1|AC005298 Drosophila melanogaster DNA sequence (P1s DS04841 (D188) and DS08189
             (D218)), complete sequence
          Length = 95272

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   caggctaggctaggctaggc 225
             ||||||||||||||||||||
Sbjct: 35614 caggctaggctaggctaggc 35633


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,530,033
Number of Sequences: 3902068
Number of extensions: 1530033
Number of successful extensions: 26186
Number of sequences better than 10.0: 61
Number of HSP's better than 10.0 without gapping: 61
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25984
Number of HSP's gapped (non-prelim): 152
length of query: 299
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 277
effective length of database: 17,147,199,772
effective search space: 4749774336844
effective search space used: 4749774336844
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top