>gb|AC098587.5| Homo sapiens BAC clone RP11-231C18 from 4, complete sequence
          Length = 132164

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     tgatggctttacaaaaggga 33
              ||||||||||||||||||||
Sbjct: 127889 tgatggctttacaaaaggga 127870

>gb|AC117573.9| Mus musculus chromosome 3, clone RP23-30D1, complete sequence
          Length = 239439

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 111    ggggaattatctgaatatga 130
              ||||||||||||||||||||
Sbjct: 182228 ggggaattatctgaatatga 182209

>gb|AE008884.1| Salmonella typhimurium LT2, section 188 of 220 of the complete genome
          Length = 21692

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 4     cgaaatggattgatggcttt 23
             ||||||||||||||||||||
Sbjct: 18949 cgaaatggattgatggcttt 18968

>emb|AL627278.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
              complete chromosome; segment 14/20
          Length = 258050

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 4      cgaaatggattgatggcttt 23
              ||||||||||||||||||||
Sbjct: 248474 cgaaatggattgatggcttt 248455

>gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete sequence
          Length = 117437

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 188   atcaaatgcattcttcctat 207
             ||||||||||||||||||||
Sbjct: 42735 atcaaatgcattcttcctat 42716

>gb|AC093158.2| Homo sapiens chromosome 1 clone RP11-439H8, complete sequence
          Length = 179582

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     tgatggctttacaaaaggga 33
              ||||||||||||||||||||
Sbjct: 131299 tgatggctttacaaaaggga 131318

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 4       cgaaatggattgatggcttt 23
               ||||||||||||||||||||
Sbjct: 3943238 cgaaatggattgatggcttt 3943257

>gb|AF233324.1|STYSTMD1 Salmonella typhimurium fragment STMD1
          Length = 96086

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 4     cgaaatggattgatggcttt 23
             ||||||||||||||||||||
Sbjct: 60978 cgaaatggattgatggcttt 60997

>gb|AC154663.2| Mus musculus BAC clone RP24-283H12 from 16, complete sequence
          Length = 177341

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     gattgatggctttacaaaag 30
              ||||||||||||||||||||
Sbjct: 107171 gattgatggctttacaaaag 107152

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 4       cgaaatggattgatggcttt 23
               ||||||||||||||||||||
Sbjct: 3440132 cgaaatggattgatggcttt 3440113

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
               complete genome
          Length = 4755700

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 4       cgaaatggattgatggcttt 23
               ||||||||||||||||||||
Sbjct: 4099261 cgaaatggattgatggcttt 4099280


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,925,807
Number of Sequences: 3902068
Number of extensions: 1925807
Number of successful extensions: 35117
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35077
Number of HSP's gapped (non-prelim): 40
length of query: 247
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 225
effective length of database: 17,147,199,772
effective search space: 3858119948700
effective search space used: 3858119948700
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)