>gb|U02690.1|TAU02690 Triticum aestivum imidazoleglycerolphosphate dehydratase mRNA,
            partial cds
          Length = 1414

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 177  agcagatacattgtgccaatggtagcaacataaacaaaccctgac 221
            |||||||||| | |||||||||||| || ||||||||||||||||
Sbjct: 1235 agcagatacagtatgccaatggtagtaagataaacaaaccctgac 1191



 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 98/118 (83%), Gaps = 5/118 (4%)
 Strand = Plus / Minus

                                                                        
Query: 7    ttgagtggccaaaccattatcacaggcacaacgccaggtgaaccgatgccaaatccatat 66
            |||| ||||||||||||||| |||||| |||| ||  |  |||| ||||  |||||||||
Sbjct: 1383 ttgaatggccaaaccattattacaggcgcaacaccgcgcaaaccaatgctgaatccatat 1324

                                                                      
Query: 67   ttcagaggtataaataa-tttcagaatgtcaagtcgtttgcagccttt-catcttcag 122
             ||||||||   ||||| ||||||||||||||| ||| |||||| ||| |||||||||
Sbjct: 1323 atcagaggt---aataactttcagaatgtcaagccgtctgcagcttttacatcttcag 1269

>gb|AC161060.6| Mus musculus BAC clone RP23-69N10 from chromosome 6, complete sequence
          Length = 222363

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 76    ataaataatttcagaatgtcaag 98
             |||||||||||||||||||||||
Sbjct: 48345 ataaataatttcagaatgtcaag 48323

>gb|AC125102.4| Mus musculus BAC clone RP24-208N22 from 6, complete sequence
          Length = 163235

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 76   ataaataatttcagaatgtcaag 98
            |||||||||||||||||||||||
Sbjct: 6104 ataaataatttcagaatgtcaag 6126

>gb|AE014310.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 7
             of 11 of the complete sequence
          Length = 250029

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 249   cttcttgtttgcaagcccagc 269
             |||||||||||||||||||||
Sbjct: 11233 cttcttgtttgcaagcccagc 11213

>emb|AL591686.10| Human DNA sequence from clone RP11-561I11 on chromosome 1 Contains the 3'
              end of a novel gene (FLJ40773) and two novel genes,
              complete sequence
          Length = 175463

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 72     aggtataaataatttcagaat 92
              |||||||||||||||||||||
Sbjct: 114295 aggtataaataatttcagaat 114275

>emb|AL355552.8| Human DNA sequence from clone RP11-217F17 on chromosome 13 Contains a
             ribosomal protein L7 (RPL7) pseudogene, complete sequence
          Length = 90157

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 249   cttcttgtttgcaagcccagc 269
             |||||||||||||||||||||
Sbjct: 13921 cttcttgtttgcaagcccagc 13901

>emb|CR318635.8| Zebrafish DNA sequence from clone CH211-253D2 in linkage group 23,
            complete sequence
          Length = 154312

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 69   cagaggtataaataatttcag 89
            |||||||||||||||||||||
Sbjct: 8883 cagaggtataaataatttcag 8903

>dbj|AP000806.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-713C6, complete
             sequence
          Length = 120480

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 76    ataaataatttcagaatgtca 96
             |||||||||||||||||||||
Sbjct: 41818 ataaataatttcagaatgtca 41838

>gb|AC122789.8| Mus musculus chromosome 5, clone RP24-258A20, complete sequence
          Length = 182866

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 200    agcaacataaacaaaccctg 219
              ||||||||||||||||||||
Sbjct: 123970 agcaacataaacaaaccctg 123989

>emb|AL353610.7| Human DNA sequence from clone RP11-8J21 on chromosome 2 Contains ESTs,
             STSs and GSSs, complete sequence
          Length = 61513

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   tgcagcctttcatcttcagg 123
             ||||||||||||||||||||
Sbjct: 31437 tgcagcctttcatcttcagg 31418


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,355,832
Number of Sequences: 3902068
Number of extensions: 2355832
Number of successful extensions: 39676
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39656
Number of HSP's gapped (non-prelim): 19
length of query: 289
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 267
effective length of database: 17,147,199,772
effective search space: 4578302339124
effective search space used: 4578302339124
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)