ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast10c06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC153020.5| Mus musculus BAC clone RP23-88P1 from chromosome ... 46 0.072
2gb|AC154255.2| Mus musculus BAC clone RP24-202K20 from chromosom... 46 0.072
3emb|AL591127.12| Mouse DNA sequence from clone RP23-370H21 on ch... 46 0.072
4ref|XM_493827.1| Oryza sativa (japonica cultivar-group), predic... 44 0.28
5gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 44 0.28
6gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.28
7dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.28
8emb|BX936364.6| Zebrafish DNA sequence from clone CH211-247G11 i... 44 0.28
9gb|AC006534.10| Homo sapiens chromosome 17, clone RP11-557B23, c... 44 0.28
10dbj|AP000615.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.28
11ref|NM_119923.2| Arabidopsis thaliana protein binding / signal t... 42 1.1
12ref|XM_632585.1| Dictyostelium discoideum hypothetical protein (... 42 1.1
13ref|XM_628875.1| Dictyostelium discoideum myb transcription fact... 42 1.1
14gb|AC004502.1| Homo sapiens chromosome 5, P1 clone 1338G6 (LBNL ... 42 1.1
15gb|BC081026.1| Xenopus laevis cell division cycle 14 beta protei... 42 1.1
16gb|AY534752.1| Xenopus laevis cell division cycle 14 beta protei... 42 1.1
17gb|AC098886.4| Mus musculus BAC clone RP23-122M21 from 4, comple... 42 1.1
18emb|AL392003.11| Human DNA sequence from clone RP11-331H2 on chr... 42 1.1
19emb|AL161591.2|ATCHRIV87 Arabidopsis thaliana DNA chromosome 4, ... 42 1.1
20emb|BX321906.30| Zebrafish DNA sequence from clone DKEYP-45E9 in... 42 1.1
21gb|AC055710.10| Homo sapiens 3 BAC RP11-307E22 (Roswell Park Can... 42 1.1
22gb|AY081497.1| Arabidopsis thaliana putative protein (At4g37590)... 42 1.1
23gb|AY649372.1| Xenopus laevis protein phosphatase CDC14B mRNA, c... 42 1.1
24gb|AY054668.1| Arabidopsis thaliana putative protein (At4g37590;... 42 1.1
25gb|AC011409.4|AC011409 Homo sapiens chromosome 5 clone CTB-77B4,... 42 1.1
26emb|BX640592.10| Zebrafish DNA sequence from clone CH211-132E23 ... 42 1.1
27gb|AC006468.10| Homo sapiens chromosome 17, clone RP5-159F22, co... 42 1.1
28gb|AC008528.6|AC008528 Homo sapiens chromosome 5 clone CTC-473M1... 42 1.1
29emb|AL035605.1|ATF19F18 Arabidopsis thaliana DNA chromosome 4, B... 42 1.1
30emb|AL606907.9| Mouse DNA sequence from clone RP23-230F2 on chro... 42 1.1
31gb|AC166253.18| Mus musculus BAC RP23-231M6 (Roswell Park Cance... 40 4.4
32ref|NM_001035676.1| Arabidopsis thaliana nucleic acid binding AT... 40 4.4
33ref|NM_113295.2| Arabidopsis thaliana nucleic acid binding AT3G2... 40 4.4
34ref|NM_116188.1| Arabidopsis thaliana unknown protein AT3G63230 ... 40 4.4
35ref|NM_111820.2| Arabidopsis thaliana nucleic acid binding AT3G0... 40 4.4
36ref|XM_642714.1| Dictyostelium discoideum hypothetical protein (... 40 4.4
37ref|XM_636301.1| Dictyostelium discoideum hypothetical protein (... 40 4.4
38ref|NM_181369.2| Rattus norvegicus histidine rich calcium bindin... 40 4.4
39gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome 40 4.4
40gb|AC025722.2| Caenorhabditis elegans cosmid Y50D4C, complete se... 40 4.4
41gb|AC116871.6| Mus musculus chromosome 19, clone RP24-417P12, co... 40 4.4
42ref|XM_954578.1| Neurospora crassa OR74A hypothetical protein (N... 40 4.4
43ref|XM_328833.1| Neurospora crassa OR74A hypothetical protein (N... 40 4.4
44gb|AE006473.1| Streptococcus pyogenes M1 GAS, section 2 of 167 o... 40 4.4
45ref|XM_707157.1| Candida albicans SC5314 hypothetical protein (C... 40 4.4
46ref|XM_707127.1| Candida albicans SC5314 hypothetical protein (C... 40 4.4
47gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome 40 4.4
48gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome 40 4.4
49gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome 40 4.4
50gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome 40 4.4
51gb|BC049391.1| Xenopus laevis hypothetical protein KIAA0205, mRN... 40 4.4
52gb|BC045056.1| Xenopus laevis hypothetical protein KIAA0205, mRN... 40 4.4
53emb|CR384078.17| Zebrafish DNA sequence from clone DKEY-251E16 i... 40 4.4
54gb|AC112153.4| Mus musculus BAC clone RP24-93G11 from chromosome... 40 4.4
55gb|AC122536.4| Mus musculus BAC clone RP24-542K22 from chromosom... 40 4.4
56gb|AC132596.5| Mus musculus BAC clone RP24-173K19 from chromosom... 40 4.4
57gb|AC134603.4| Mus musculus BAC clone RP23-246L24 from chromosom... 40 4.4
58gb|AC015985.10|ATAC015985 Arabidopsis thaliana chromosome III BA... 40 4.4
59gb|AC122876.4| Mus musculus BAC clone RP23-113K14 from 3, comple... 40 4.4
60ref|XM_773609.1| Giardia lamblia ATCC 50803 chaperonin subunit d... 40 4.4
61ref|XM_760365.1| Theileria parva strain Muguga hypothetical prot... 40 4.4
62gb|AC003091.1| Homo sapiens BAC clone CTA-326G4 from 7, complete... 40 4.4
63emb|CR700200.2|CNS0G384 Tetraodon nigroviridis full-length cDNA 40 4.4
64gb|AC119847.12| Mus musculus chromosome 3, clone RP23-46L5, comp... 40 4.4
65gb|BC100198.1| Xenopus laevis hypothetical protein KIAA0205, mRN... 40 4.4
66gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome 40 4.4
67gb|AY858788.1| Metrioptera roeseli microsatellite locus MR3-34 g... 40 4.4
68emb|AL137222.17| Human DNA sequence from clone RP1-209B5 on chro... 40 4.4
69gb|BT000646.1| Arabidopsis thaliana unknown protein (At3g09850/... 40 4.4
70gb|AC161928.4| Mus musculus chromosome 1, clone RP23-293P15, com... 40 4.4
71gb|AC138908.3| Homo sapiens chromosome 5 clone RP11-615D2, compl... 40 4.4
72emb|AL138648.2|ATF16M2 Arabidopsis thaliana DNA chromosome 3, BA... 40 4.4
73gb|AC147879.2| Xenopus tropicalis clone CH216-108K9, complete se... 40 4.4
74gb|BC065677.1| Danio rerio zgc:77147, mRNA (cDNA clone MGC:77147... 40 4.4
75emb|CR846083.9| Zebrafish DNA sequence from clone DKEYP-34A6 in ... 40 4.4
76emb|CR352325.4| Mouse DNA sequence from clone RP23-333J5 on chro... 40 4.4
77emb|BX294444.7| Zebrafish DNA sequence from clone CH211-281E15 i... 40 4.4
78emb|CR384100.8| Zebrafish DNA sequence from clone DKEYP-22H2 in ... 40 4.4
79ref|NM_205646.1| Danio rerio zgc:77147 (zgc:77147), mRNA 40 4.4
80gb|DQ056633.1| Arabidopsis thaliana senescence-associated protei... 40 4.4
81gb|AE014175.1| Mus musculus piebald deletion region section 3 of... 40 4.4
82gb|AE009953.1| Streptococcus pyogenes strain MGAS8232, section 1... 40 4.4
83dbj|AK141727.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 40 4.4
84gb|AC026775.6| Homo sapiens chromosome 5 clone CTC-244L19, compl... 40 4.4
85gb|AC008851.7| Homo sapiens chromosome 5 clone CTD-2173D20, comp... 40 4.4
86dbj|AK156431.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 4.4
87dbj|AK171934.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 4.4
88gb|AY057497.1| Arabidopsis thaliana AT3g09850/F8A24_10 mRNA, com... 40 4.4
89ref|XM_625997.1| Cryptosporidium parvum Iowa II hypothetical pro... 40 4.4
90emb|BX005330.13| Zebrafish DNA sequence from clone CH211-113D13,... 40 4.4
91dbj|AK051081.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 40 4.4
92ref|NM_070959.3| Caenorhabditis elegans UNCoordinated family mem... 40 4.4
93gb|AF535160.1| Caenorhabditis elegans UNC-34 (unc-34) mRNA, comp... 40 4.4
94gb|AC102488.11| Mus musculus chromosome 1, clone RP24-496O18, co... 40 4.4
95dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
96emb|BX510301.6| Zebrafish DNA sequence from clone CH211-215A10 i... 40 4.4
97gb|AC021203.5| Homo sapiens BAC clone RP11-143E9 from 4, complet... 40 4.4
98gb|AC092617.2| Homo sapiens BAC clone RP11-217D23 from 2, comple... 40 4.4
99gb|AF226723.1|AF226723 Giardia intestinalis chaperonin subunit d... 40 4.4
100gb|AC138948.2| Homo sapiens chromosome 5 clone RP11-800G17, comp... 40 4.4
101gb|AC138817.2| Homo sapiens chromosome 5 clone RP11-1099E10, com... 40 4.4
102gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome 40 4.4
103gb|AF506908.1| Solidago sempervirens clone 24F microsatellite se... 40 4.4
104gb|AY178388.1| Trifolium repens microsatellite agr1107 sequence 40 4.4
105gb|AY178331.1| Trifolium repens microsatellite agr1048 sequence 40 4.4
106dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome 40 4.4
107dbj|AP006533.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
108dbj|AP007223.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.4
109dbj|AP001297.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 4.4
110ref|XM_308306.2| Anopheles gambiae str. PEST ENSANGP00000010756 ... 40 4.4
111gb|AY277279.1| Rattus norvegicus histidine-rich calcium binding ... 40 4.4
112emb|BX248515.4| Zebrafish DNA sequence from clone DKEY-177P2 in ... 40 4.4
113emb|AL358913.4|CNS05TEE Human chromosome 14 DNA sequence BAC R-5... 40 4.4
114emb|AL592404.7| Mouse DNA sequence from clone RP23-425D20 on chr... 40 4.4
115gb|AC102815.31| Mus musculus chromosome 14, clone RP23-55A5, com... 40 4.4
116emb|BX294655.5| Mouse DNA sequence from clone RP23-324H24 on chr... 40 4.4
117emb|AL731828.22| Mouse DNA sequence from clone RP23-50L5 on chro... 40 4.4
118gb|AC158595.25| Mus musculus 10 BAC RP24-216B14 (Roswell Park Ca... 40 4.4
119dbj|AB032260.1| Brassica rapa Bra r 1 gene for pollen calcium-bi... 40 4.4 
>gb|AC153020.5| Mus musculus BAC clone RP23-88P1 from chromosome 13, complete
            sequence
          Length = 200635

 Score = 46.1 bits (23), Expect = 0.072
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 176  atgatgatgatgatgaatctaga 198
            |||||||||||||||||||||||
Sbjct: 5240 atgatgatgatgatgaatctaga 5262
to top
>gb|AC154255.2| Mus musculus BAC clone RP24-202K20 from chromosome 13, complete sequence
          Length = 159755

 Score = 46.1 bits (23), Expect = 0.072
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 176    atgatgatgatgatgaatctaga 198
              |||||||||||||||||||||||
Sbjct: 141984 atgatgatgatgatgaatctaga 142006
to top
>emb|AL591127.12| Mouse DNA sequence from clone RP23-370H21 on chromosome 2, complete
              sequence
          Length = 125816

 Score = 46.1 bits (23), Expect = 0.072
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 184    gatgatgaatctagagtcttggg 206
              |||||||||||||||||||||||
Sbjct: 116114 gatgatgaatctagagtcttggg 116136
to top
>ref|XM_493827.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 170 ccaagcatgatgatgatgatga 191
           ||||||||||||||||||||||
Sbjct: 161 ccaagcatgatgatgatgatga 182
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 170     ccaagcatgatgatgatgatga 191
               ||||||||||||||||||||||
Sbjct: 1738537 ccaagcatgatgatgatgatga 1738516
to top
>gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1004C08,
             complete sequence
          Length = 133090

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 170   ccaagcatgatgatgatgatga 191
             ||||||||||||||||||||||
Sbjct: 95825 ccaagcatgatgatgatgatga 95846
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 170     ccaagcatgatgatgatgatga 191
               ||||||||||||||||||||||
Sbjct: 1738535 ccaagcatgatgatgatgatga 1738514
to top
>emb|BX936364.6| Zebrafish DNA sequence from clone CH211-247G11 in linkage group 18,
             complete sequence
          Length = 146733

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 166   tattccaagcatgatgatgatgatga 191
             ||||||||| ||||||||||||||||
Sbjct: 61354 tattccaaggatgatgatgatgatga 61379
to top
>gb|AC006534.10| Homo sapiens chromosome 17, clone RP11-557B23, complete sequence
          Length = 216789

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 286    tccttccactcggctgccttgc 307
              ||||||||||||||||||||||
Sbjct: 119685 tccttccactcggctgccttgc 119706
to top
>dbj|AP000615.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              clone:P0043E01
          Length = 154128

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 170    ccaagcatgatgatgatgatga 191
              ||||||||||||||||||||||
Sbjct: 151000 ccaagcatgatgatgatgatga 150979
to top
>ref|NM_119923.2| Arabidopsis thaliana protein binding / signal transducer AT4G37590
           mRNA, complete cds
          Length = 2485

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 175 catgatgatgatgatgaatct 195
           |||||||||||||||||||||
Sbjct: 733 catgatgatgatgatgaatct 713
to top
>ref|XM_632585.1| Dictyostelium discoideum hypothetical protein (DDB0187005), partial
            mRNA
          Length = 2724

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 176  atgatgatgatgatgaatcta 196
            |||||||||||||||||||||
Sbjct: 1838 atgatgatgatgatgaatcta 1858
to top
>ref|XM_628875.1| Dictyostelium discoideum myb transcription factor (DDB0219992),
            partial mRNA
          Length = 3693

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 176  atgatgatgatgatgaatcta 196
            |||||||||||||||||||||
Sbjct: 2572 atgatgatgatgatgaatcta 2552
to top
>gb|AC004502.1| Homo sapiens chromosome 5, P1 clone 1338G6 (LBNL H35), complete
             sequence
          Length = 79716

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 156   attccattcatattccaagca 176
             |||||||||||||||||||||
Sbjct: 43427 attccattcatattccaagca 43447
to top
>gb|BC081026.1| Xenopus laevis cell division cycle 14 beta protein, mRNA (cDNA clone
            MGC:81657 IMAGE:6864425), complete cds
          Length = 2556

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 176  atgatgatgatgatgaatcta 196
            |||||||||||||||||||||
Sbjct: 1423 atgatgatgatgatgaatcta 1443
to top
>gb|AY534752.1| Xenopus laevis cell division cycle 14 beta protein (CDC14beta) mRNA,
            complete cds
          Length = 3266

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 176  atgatgatgatgatgaatcta 196
            |||||||||||||||||||||
Sbjct: 1827 atgatgatgatgatgaatcta 1847
to top
>gb|AC098886.4| Mus musculus BAC clone RP23-122M21 from 4, complete sequence
          Length = 219825

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 171    caagcatgatgatgatgatga 191
              |||||||||||||||||||||
Sbjct: 101010 caagcatgatgatgatgatga 100990
to top
>emb|AL392003.11| Human DNA sequence from clone RP11-331H2 on chromosome 1 Containt the
             3' end of the HSD17B7 gene for hydroxysteroid (17-beta)
             dehydrogenase 7, a novel protein (MGC48998) and a
             cytochrome c oxidase subunit VIIb (COX7B) pseudogene,
             complete sequence
          Length = 191872

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 176   atgatgatgatgatgaatctagagt 200
             |||||||||||||||||||| ||||
Sbjct: 14343 atgatgatgatgatgaatcttgagt 14319
to top
>emb|AL161591.2|ATCHRIV87 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 87
          Length = 196339

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 175    catgatgatgatgatgaatct 195
              |||||||||||||||||||||
Sbjct: 158602 catgatgatgatgatgaatct 158622
to top
>emb|BX321906.30| Zebrafish DNA sequence from clone DKEYP-45E9 in linkage group 10,
              complete sequence
          Length = 164266

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 172    aagcatgatgatgatgatgaa 192
              |||||||||||||||||||||
Sbjct: 154305 aagcatgatgatgatgatgaa 154325
to top
>gb|AC055710.10| Homo sapiens 3 BAC RP11-307E22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 169964

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 171   caagcatgatgatgatgatga 191
             |||||||||||||||||||||
Sbjct: 22700 caagcatgatgatgatgatga 22680
to top
>gb|AY081497.1| Arabidopsis thaliana putative protein (At4g37590) mRNA, complete
           cds
          Length = 1797

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 175 catgatgatgatgatgaatct 195
           |||||||||||||||||||||
Sbjct: 229 catgatgatgatgatgaatct 209
to top
>gb|AY649372.1| Xenopus laevis protein phosphatase CDC14B mRNA, complete cds
          Length = 1395

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 176  atgatgatgatgatgaatcta 196
            |||||||||||||||||||||
Sbjct: 1151 atgatgatgatgatgaatcta 1171
to top
>gb|AY054668.1| Arabidopsis thaliana putative protein (At4g37590; F19F18.80) mRNA,
           complete cds
          Length = 2328

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 175 catgatgatgatgatgaatct 195
           |||||||||||||||||||||
Sbjct: 732 catgatgatgatgatgaatct 712
to top
>gb|AC011409.4|AC011409 Homo sapiens chromosome 5 clone CTB-77B4, complete sequence
          Length = 61210

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 156  attccattcatattccaagca 176
            |||||||||||||||||||||
Sbjct: 9244 attccattcatattccaagca 9264
to top
>emb|BX640592.10| Zebrafish DNA sequence from clone CH211-132E23 in linkage group 4,
             complete sequence
          Length = 186123

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 172   aagcatgatgatgatgatgaa 192
             |||||||||||||||||||||
Sbjct: 55673 aagcatgatgatgatgatgaa 55653
to top
>gb|AC006468.10| Homo sapiens chromosome 17, clone RP5-159F22, complete sequence
          Length = 91672

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 171   caagcatgatgatgatgatga 191
             |||||||||||||||||||||
Sbjct: 26113 caagcatgatgatgatgatga 26093
to top
>gb|AC008528.6|AC008528 Homo sapiens chromosome 5 clone CTC-473M13, complete sequence
          Length = 125764

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 156   attccattcatattccaagca 176
             |||||||||||||||||||||
Sbjct: 48252 attccattcatattccaagca 48232
to top
>emb|AL035605.1|ATF19F18 Arabidopsis thaliana DNA chromosome 4, BAC clone  F19F18 (ESSA project)
          Length = 91740

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 175   catgatgatgatgatgaatct 195
             |||||||||||||||||||||
Sbjct: 35180 catgatgatgatgatgaatct 35200
to top
>emb|AL606907.9| Mouse DNA sequence from clone RP23-230F2 on chromosome 4, complete
             sequence
          Length = 208265

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 171   caagcatgatgatgatgatga 191
             |||||||||||||||||||||
Sbjct: 89452 caagcatgatgatgatgatga 89432
to top
>gb|AC166253.18| Mus musculus  BAC RP23-231M6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207999

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 172    aagcatgatgatgatgatga 191
              ||||||||||||||||||||
Sbjct: 201808 aagcatgatgatgatgatga 201827
to top
>ref|NM_001035676.1| Arabidopsis thaliana nucleic acid binding AT3G23900 transcript
           variant AT3G23900.2 mRNA, complete cds
          Length = 3024

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 408 atgatgatgatgatgaatct 427
to top
>ref|NM_113295.2| Arabidopsis thaliana nucleic acid binding AT3G23900 transcript
           variant AT3G23900.1 mRNA, complete cds
          Length = 3417

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 408 atgatgatgatgatgaatct 427
to top
>ref|NM_116188.1| Arabidopsis thaliana unknown protein AT3G63230 mRNA, complete cds
          Length = 342

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 172 aagcatgatgatgatgatga 191
           ||||||||||||||||||||
Sbjct: 332 aagcatgatgatgatgatga 313
to top
>ref|NM_111820.2| Arabidopsis thaliana nucleic acid binding AT3G09850 mRNA, complete
           cds
          Length = 2641

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 912 atgatgatgatgatgaatct 931
to top
>ref|XM_642714.1| Dictyostelium discoideum hypothetical protein (DDB0206267), partial
           mRNA
          Length = 3942

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 247 atgatgatgatgatgaatct 228
to top
>ref|XM_636301.1| Dictyostelium discoideum hypothetical protein (DDB0206534), partial
           mRNA
          Length = 693

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 253 atgatgatgatgatgaatct 234
to top
>ref|NM_181369.2| Rattus norvegicus histidine rich calcium binding protein (Hrc), mRNA
          Length = 2367

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 172  aagcatgatgatgatgatga 191
            ||||||||||||||||||||
Sbjct: 1899 aagcatgatgatgatgatga 1918
to top
>gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome
          Length = 1838554

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 13227 catgatgatgatgatgaatc 13246
to top
>gb|AC025722.2| Caenorhabditis elegans cosmid Y50D4C, complete sequence
          Length = 72325

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   atgatgatgatgatgaatct 195
             ||||||||||||||||||||
Sbjct: 62906 atgatgatgatgatgaatct 62887
to top
>gb|AC116871.6| Mus musculus chromosome 19, clone RP24-417P12, complete sequence
          Length = 161959

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   atgatgatgatgatgaatct 195
             ||||||||||||||||||||
Sbjct: 21450 atgatgatgatgatgaatct 21469
to top
>ref|XM_954578.1| Neurospora crassa OR74A hypothetical protein (NCU08128.1) partial
           mRNA
          Length = 1689

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 4   atgatgatgatgatgaatct 23
to top
>ref|XM_328833.1| Neurospora crassa OR74A hypothetical protein (NCU08128.1) partial
           mRNA
          Length = 1689

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 4   atgatgatgatgatgaatct 23
to top
>gb|AE006473.1| Streptococcus pyogenes M1 GAS, section 2 of 167 of the complete
           genome
          Length = 10594

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 175 catgatgatgatgatgaatc 194
           ||||||||||||||||||||
Sbjct: 767 catgatgatgatgatgaatc 786
to top
>ref|XM_707157.1| Candida albicans SC5314 hypothetical protein (CaO19.6862), mRNA
          Length = 2310

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 176  atgatgatgatgatgaatct 195
            ||||||||||||||||||||
Sbjct: 2237 atgatgatgatgatgaatct 2256
to top
>ref|XM_707127.1| Candida albicans SC5314 hypothetical protein (CaO19.14152), mRNA
          Length = 2310

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 176  atgatgatgatgatgaatct 195
            ||||||||||||||||||||
Sbjct: 2237 atgatgatgatgatgaatct 2256
to top
>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome
          Length = 1937111

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 13227 catgatgatgatgatgaatc 13246
to top
>gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome
          Length = 1860355

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 13228 catgatgatgatgatgaatc 13247
to top
>gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome
          Length = 1928252

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 13226 catgatgatgatgatgaatc 13245
to top
>gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome
          Length = 1836467

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 13227 catgatgatgatgatgaatc 13246
to top
>gb|BC049391.1| Xenopus laevis hypothetical protein KIAA0205, mRNA (cDNA clone
            IMAGE:4888185), partial cds
          Length = 1986

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 179  atgatgatgatgaatctaga 198
            ||||||||||||||||||||
Sbjct: 1910 atgatgatgatgaatctaga 1891
to top
>gb|BC045056.1| Xenopus laevis hypothetical protein KIAA0205, mRNA (cDNA clone
            IMAGE:4888995), partial cds
          Length = 1986

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 179  atgatgatgatgaatctaga 198
            ||||||||||||||||||||
Sbjct: 1910 atgatgatgatgaatctaga 1891
to top
>emb|CR384078.17| Zebrafish DNA sequence from clone DKEY-251E16 in linkage group 6,
              complete sequence
          Length = 181633

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    atgatgatgatgatgaatct 195
              ||||||||||||||||||||
Sbjct: 142207 atgatgatgatgatgaatct 142188
to top
>gb|AC112153.4| Mus musculus BAC clone RP24-93G11 from chromosome 19, complete
            sequence
          Length = 180944

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  atgatgatgatgatgaatct 195
            ||||||||||||||||||||
Sbjct: 4317 atgatgatgatgatgaatct 4298
to top
>gb|AC122536.4| Mus musculus BAC clone RP24-542K22 from chromosome 17, complete
             sequence
          Length = 150022

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    tatttcatgcatgttatgaa 77
             ||||||||||||||||||||
Sbjct: 26519 tatttcatgcatgttatgaa 26500
to top
>gb|AC132596.5| Mus musculus BAC clone RP24-173K19 from chromosome 12, complete sequence
          Length = 183629

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 172    aagcatgatgatgatgatga 191
              ||||||||||||||||||||
Sbjct: 121484 aagcatgatgatgatgatga 121465
to top
>gb|AC134603.4| Mus musculus BAC clone RP23-246L24 from chromosome 7, complete sequence
          Length = 229312

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     atgcatgcatgtttgtttat 22
             ||||||||||||||||||||
Sbjct: 77830 atgcatgcatgtttgtttat 77849
to top
>gb|AC015985.10|ATAC015985 Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence,
             complete sequence
          Length = 72902

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   atgatgatgatgatgaatct 195
             ||||||||||||||||||||
Sbjct: 41782 atgatgatgatgatgaatct 41801
to top
>gb|AC122876.4| Mus musculus BAC clone RP23-113K14 from 3, complete sequence
          Length = 190123

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    gttttcttattcctaaaaca 123
              ||||||||||||||||||||
Sbjct: 154189 gttttcttattcctaaaaca 154208
to top
>ref|XM_773609.1| Giardia lamblia ATCC 50803 chaperonin subunit delta
           (GLP_39_34037_32484) partial mRNA
          Length = 1554

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 230 tgacgaggctgtgaaggttg 249
           ||||||||||||||||||||
Sbjct: 372 tgacgaggctgtgaaggttg 391
to top
>ref|XM_760365.1| Theileria parva strain Muguga hypothetical protein (TP02_0890)
           partial mRNA
          Length = 792

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 177 tgatgatgatgatgaatctagagt 200
           |||||||||| |||||||||||||
Sbjct: 63  tgatgatgattatgaatctagagt 86
to top
>gb|AC003091.1| Homo sapiens BAC clone CTA-326G4 from 7, complete sequence
          Length = 137817

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 159  ccattcatattccaagcatg 178
            ||||||||||||||||||||
Sbjct: 3312 ccattcatattccaagcatg 3293
to top
>emb|CR700200.2|CNS0G384 Tetraodon nigroviridis full-length cDNA
          Length = 1136

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 168  ttccaagcatgatgatgatgatga 191
            ||||| ||||||||||||||||||
Sbjct: 1070 ttccaggcatgatgatgatgatga 1047
to top
>gb|AC119847.12| Mus musculus chromosome 3, clone RP23-46L5, complete sequence
          Length = 227081

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   gttttcttattcctaaaaca 123
             ||||||||||||||||||||
Sbjct: 29197 gttttcttattcctaaaaca 29216
to top
>gb|BC100198.1| Xenopus laevis hypothetical protein KIAA0205, mRNA (cDNA clone
            MGC:114822 IMAGE:4959974), complete cds
          Length = 2020

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 179  atgatgatgatgaatctaga 198
            ||||||||||||||||||||
Sbjct: 1920 atgatgatgatgaatctaga 1901
to top
>gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome
          Length = 1897573

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 13227 catgatgatgatgatgaatc 13246
to top
>gb|AY858788.1| Metrioptera roeseli microsatellite locus MR3-34 genomic sequence
          Length = 243

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 134 atgatgatgatgatgaatct 115
to top
>emb|AL137222.17| Human DNA sequence from clone RP1-209B5 on chromosome 6 Contains the 5'
             end of the AKAP7 gene for A kinase (PRKA) anchor protein
             7, a zinc finger pseudogene and a CpG island, complete
             sequence
          Length = 110724

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     atgcatgcatgtttgtttat 22
             ||||||||||||||||||||
Sbjct: 21264 atgcatgcatgtttgtttat 21245
to top
>gb|BT000646.1| Arabidopsis thaliana unknown protein  (At3g09850/F8A24_10) mRNA,
           complete cds
          Length = 2346

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 803 atgatgatgatgatgaatct 822
to top
>gb|AC161928.4| Mus musculus chromosome 1, clone RP23-293P15, complete sequence
          Length = 202671

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 18609 catgatgatgatgatgaatc 18628
to top
>gb|AC138908.3| Homo sapiens chromosome 5 clone RP11-615D2, complete sequence
          Length = 201419

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 172   aagcatgatgatgatgatga 191
             ||||||||||||||||||||
Sbjct: 42308 aagcatgatgatgatgatga 42327
to top
>emb|AL138648.2|ATF16M2 Arabidopsis thaliana DNA chromosome 3, BAC clone F16M2
          Length = 75106

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   aagcatgatgatgatgatga 191
             ||||||||||||||||||||
Sbjct: 27795 aagcatgatgatgatgatga 27776
to top
>gb|AC147879.2| Xenopus tropicalis clone CH216-108K9, complete sequence
          Length = 183182

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 173   agcatgatgatgatgatgaa 192
             ||||||||||||||||||||
Sbjct: 77822 agcatgatgatgatgatgaa 77803
to top
>gb|BC065677.1| Danio rerio zgc:77147, mRNA (cDNA clone MGC:77147 IMAGE:6961243),
            complete cds
          Length = 1610

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 176  atgatgatgatgatgaatctagag 199
            |||||||||||||||||| |||||
Sbjct: 1482 atgatgatgatgatgaatgtagag 1505
to top
>emb|CR846083.9| Zebrafish DNA sequence from clone DKEYP-34A6 in linkage group 14,
             complete sequence
          Length = 163337

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     tgcatgcatgtttgtttatt 23
             ||||||||||||||||||||
Sbjct: 12695 tgcatgcatgtttgtttatt 12676
to top
>emb|CR352325.4| Mouse DNA sequence from clone RP23-333J5 on chromosome 4 Contains the
             5' end of the Mpdz gene for multiple PDZ domain protein,
             complete sequence
          Length = 113675

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 172   aagcatgatgatgatgatga 191
             ||||||||||||||||||||
Sbjct: 60757 aagcatgatgatgatgatga 60776
to top
>emb|BX294444.7| Zebrafish DNA sequence from clone CH211-281E15 in linkage group 14,
             complete sequence
          Length = 169694

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     tgcatgcatgtttgtttatt 23
             ||||||||||||||||||||
Sbjct: 14708 tgcatgcatgtttgtttatt 14689
to top
>emb|CR384100.8| Zebrafish DNA sequence from clone DKEYP-22H2 in linkage group 13,
             complete sequence
          Length = 172918

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 165   atattccaagcatgatgatg 184
             ||||||||||||||||||||
Sbjct: 32322 atattccaagcatgatgatg 32341
to top
>ref|NM_205646.1| Danio rerio zgc:77147 (zgc:77147), mRNA
          Length = 1610

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 176  atgatgatgatgatgaatctagag 199
            |||||||||||||||||| |||||
Sbjct: 1482 atgatgatgatgatgaatgtagag 1505
to top
>gb|DQ056633.1| Arabidopsis thaliana senescence-associated protein-related
           (At3g63230) mRNA, complete cds
          Length = 375

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 172 aagcatgatgatgatgatga 191
           ||||||||||||||||||||
Sbjct: 365 aagcatgatgatgatgatga 346
to top
>gb|AE014175.1| Mus musculus piebald deletion region section 3 of 11 of the complete
             sequence
          Length = 404829

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     tgcatgcatgtttgtttatt 23
             ||||||||||||||||||||
Sbjct: 40616 tgcatgcatgtttgtttatt 40597
to top
>gb|AE009953.1| Streptococcus pyogenes strain MGAS8232, section 1 of 173 of the
             complete genome
          Length = 14943

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 13224 catgatgatgatgatgaatc 13243
to top
>dbj|AK141727.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:D030045K10
            product:unclassifiable, full insert sequence
          Length = 4380

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 173  agcatgatgatgatgatgaatctagagt 200
            ||||||||||| ||| ||||||||||||
Sbjct: 3678 agcatgatgataatgctgaatctagagt 3705
to top
>gb|AC026775.6| Homo sapiens chromosome 5 clone CTC-244L19, complete sequence
          Length = 196826

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   aagcatgatgatgatgatga 191
             ||||||||||||||||||||
Sbjct: 40567 aagcatgatgatgatgatga 40548
to top
>gb|AC008851.7| Homo sapiens chromosome 5 clone CTD-2173D20, complete sequence
          Length = 130416

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 172   aagcatgatgatgatgatga 191
             ||||||||||||||||||||
Sbjct: 22949 aagcatgatgatgatgatga 22968
to top
>dbj|AK156431.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830021H13 product:fragile X mental
            retardation 2 homolog, full insert sequence
          Length = 3534

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 173  agcatgatgatgatgatgaatctagagt 200
            ||||||||||| ||| ||||||||||||
Sbjct: 2832 agcatgatgataatgctgaatctagagt 2859
to top
>dbj|AK171934.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830020G20 product:unclassifiable, full
            insert sequence
          Length = 3535

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 173  agcatgatgatgatgatgaatctagagt 200
            ||||||||||| ||| ||||||||||||
Sbjct: 2833 agcatgatgataatgctgaatctagagt 2860
to top
>gb|AY057497.1| Arabidopsis thaliana AT3g09850/F8A24_10 mRNA, complete cds
          Length = 2640

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 911 atgatgatgatgatgaatct 930
to top
>ref|XM_625997.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd5_350),
           partial mRNA
          Length = 711

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 178 gatgatgatgatgaatctagagtc 201
           ||||||||||||||||||| ||||
Sbjct: 26  gatgatgatgatgaatctatagtc 3
to top
>emb|BX005330.13| Zebrafish DNA sequence from clone CH211-113D13, complete sequence
          Length = 181197

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 165   atattccaagcatgatgatg 184
             ||||||||||||||||||||
Sbjct: 78823 atattccaagcatgatgatg 78842
to top
>dbj|AK051081.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:D030066H24 product:fragile X
            mental retardation 2 homolog, full insert sequence
          Length = 3074

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 173  agcatgatgatgatgatgaatctagagt 200
            ||||||||||| ||| ||||||||||||
Sbjct: 2372 agcatgatgataatgctgaatctagagt 2399
to top
>ref|NM_070959.3| Caenorhabditis elegans UNCoordinated family member (unc-34) (unc-34)
            mRNA, complete cds
          Length = 1579

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  atgatgatgatgatgaatct 195
            ||||||||||||||||||||
Sbjct: 1373 atgatgatgatgatgaatct 1354
to top
>gb|AF535160.1| Caenorhabditis elegans UNC-34 (unc-34) mRNA, complete cds
          Length = 1602

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  atgatgatgatgatgaatct 195
            ||||||||||||||||||||
Sbjct: 1396 atgatgatgatgatgaatct 1377
to top
>gb|AC102488.11| Mus musculus chromosome 1, clone RP24-496O18, complete sequence
          Length = 127076

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 15204 catgatgatgatgatgaatc 15185
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 176     atgatgatgatgatgaatct 195
               ||||||||||||||||||||
Sbjct: 2860157 atgatgatgatgatgaatct 2860138
to top
>emb|BX510301.6| Zebrafish DNA sequence from clone CH211-215A10 in linkage group 19,
             complete sequence
          Length = 209585

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 172   aagcatgatgatgatgatga 191
             ||||||||||||||||||||
Sbjct: 69310 aagcatgatgatgatgatga 69329
to top
>gb|AC021203.5| Homo sapiens BAC clone RP11-143E9 from 4, complete sequence
          Length = 142218

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      atgcatgcatgtttgtttat 22
              ||||||||||||||||||||
Sbjct: 112286 atgcatgcatgtttgtttat 112267
to top
>gb|AC092617.2| Homo sapiens BAC clone RP11-217D23 from 2, complete sequence
          Length = 140096

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 134   gctagaggaggtgggctggaacat 157
             |||||||||||||||| |||||||
Sbjct: 90592 gctagaggaggtgggcaggaacat 90615
to top
>gb|AF226723.1|AF226723 Giardia intestinalis chaperonin subunit delta CCTdelta (Cctd) gene,
           partial cds
          Length = 931

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 230 tgacgaggctgtgaaggttg 249
           ||||||||||||||||||||
Sbjct: 103 tgacgaggctgtgaaggttg 122
to top
>gb|AC138948.2| Homo sapiens chromosome 5 clone RP11-800G17, complete sequence
          Length = 172404

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 172   aagcatgatgatgatgatga 191
             ||||||||||||||||||||
Sbjct: 35088 aagcatgatgatgatgatga 35107
to top
>gb|AC138817.2| Homo sapiens chromosome 5 clone RP11-1099E10, complete sequence
          Length = 185785

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 172   aagcatgatgatgatgatga 191
             ||||||||||||||||||||
Sbjct: 17636 aagcatgatgatgatgatga 17655
to top
>gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome
          Length = 1900521

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 13257 catgatgatgatgatgaatc 13276
to top
>gb|AF506908.1| Solidago sempervirens clone 24F microsatellite sequence
          Length = 226

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 140 atgatgatgatgatgaatct 121
to top
>gb|AY178388.1| Trifolium repens microsatellite agr1107 sequence
          Length = 468

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 142 atgatgatgatgatgaatct 123
to top
>gb|AY178331.1| Trifolium repens microsatellite agr1048 sequence
          Length = 468

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 176 atgatgatgatgatgaatct 195
           ||||||||||||||||||||
Sbjct: 142 atgatgatgatgatgaatct 123
to top
>dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome
          Length = 1894275

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   catgatgatgatgatgaatc 194
             ||||||||||||||||||||
Sbjct: 13257 catgatgatgatgatgaatc 13276
to top
>dbj|AP006533.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0085L11
          Length = 148142

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    atgatgatgatgatgaatct 195
              ||||||||||||||||||||
Sbjct: 103638 atgatgatgatgatgaatct 103619
to top
>dbj|AP007223.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0046E09
          Length = 146776

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   atgatgatgatgatgaatct 195
             ||||||||||||||||||||
Sbjct: 20303 atgatgatgatgatgaatct 20284
to top
>dbj|AP001297.1| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F14O13
          Length = 106203

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   atgatgatgatgatgaatct 195
             ||||||||||||||||||||
Sbjct: 38482 atgatgatgatgatgaatct 38463
to top
>ref|XM_308306.2| Anopheles gambiae str. PEST ENSANGP00000010756 (ENSANGG00000008267),
            partial mRNA
          Length = 2625

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 173  agcatgatgatgatgatgaa 192
            ||||||||||||||||||||
Sbjct: 2224 agcatgatgatgatgatgaa 2243
to top
>gb|AY277279.1| Rattus norvegicus histidine-rich calcium binding protein (Hrc) mRNA,
            complete cds
          Length = 2367

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 172  aagcatgatgatgatgatga 191
            ||||||||||||||||||||
Sbjct: 1899 aagcatgatgatgatgatga 1918
to top
>emb|BX248515.4| Zebrafish DNA sequence from clone DKEY-177P2 in linkage group 20,
              complete sequence
          Length = 212105

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    atgatgatgatgatgaatct 195
              ||||||||||||||||||||
Sbjct: 154036 atgatgatgatgatgaatct 154055
to top
>emb|AL358913.4|CNS05TEE Human chromosome 14 DNA sequence BAC R-557C9 of library RPCI-11 from
            chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 179862

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 108  tcttattcctaaaacatggc 127
            ||||||||||||||||||||
Sbjct: 7805 tcttattcctaaaacatggc 7824
to top
>emb|AL592404.7| Mouse DNA sequence from clone RP23-425D20 on chromosome 4, complete
             sequence
          Length = 110309

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 172   aagcatgatgatgatgatga 191
             ||||||||||||||||||||
Sbjct: 57391 aagcatgatgatgatgatga 57410
to top
>gb|AC102815.31| Mus musculus chromosome 14, clone RP23-55A5, complete sequence
          Length = 151802

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 4      tgcatgcatgtttgtttatt 23
              ||||||||||||||||||||
Sbjct: 100305 tgcatgcatgtttgtttatt 100286
to top
>emb|BX294655.5| Mouse DNA sequence from clone RP23-324H24 on chromosome X, complete
             sequence
          Length = 57957

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 173   agcatgatgatgatgatgaatctagagt 200
             ||||||||||| ||| ||||||||||||
Sbjct: 46304 agcatgatgataatgctgaatctagagt 46331
to top
>emb|AL731828.22| Mouse DNA sequence from clone RP23-50L5 on chromosome X, complete
              sequence
          Length = 228327

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 173    agcatgatgatgatgatgaa 192
              ||||||||||||||||||||
Sbjct: 205961 agcatgatgatgatgatgaa 205980
to top
>gb|AC158595.25| Mus musculus 10 BAC RP24-216B14 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 231740

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 172    aagcatgatgatgatgatga 191
              ||||||||||||||||||||
Sbjct: 177045 aagcatgatgatgatgatga 177026
to top
>dbj|AB032260.1| Brassica rapa Bra r 1 gene for pollen calcium-binding protein,
           complete cds
          Length = 3168

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 172 aagcatgatgatgatgatga 191
           ||||||||||||||||||||
Sbjct: 967 aagcatgatgatgatgatga 948


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,789,060
Number of Sequences: 3902068
Number of extensions: 3789060
Number of successful extensions: 228170
Number of sequences better than 10.0: 119
Number of HSP's better than 10.0 without gapping: 119
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 227551
Number of HSP's gapped (non-prelim): 618
length of query: 335
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 313
effective length of database: 17,147,199,772
effective search space: 5367073528636
effective search space used: 5367073528636
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top