>gb|AC150419.2| Branchiostoma floridae clone CH302-73J11, complete sequence
          Length = 185777

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 41    ttacatcaaagttcaaacctt 61
             |||||||||||||||||||||
Sbjct: 74464 ttacatcaaagttcaaacctt 74444

>gb|AC139746.15| Medicago truncatula clone mth2-17b20, complete sequence
          Length = 118157

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 46  tcaaagttcaaaccttagga 65
           ||||||||||||||||||||
Sbjct: 237 tcaaagttcaaaccttagga 256

>gb|AC148177.13| Medicago truncatula clone mth2-4c9, complete sequence
          Length = 117329

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 46    tcaaagttcaaaccttagga 65
             ||||||||||||||||||||
Sbjct: 58004 tcaaagttcaaaccttagga 58023

>emb|CT573041.4| Platypus DNA sequence from clone CLM1-404E12, complete sequence
          Length = 53489

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    tccctccccactttttccaa 91
             ||||||||||||||||||||
Sbjct: 36205 tccctccccactttttccaa 36186

>ref|XM_426050.1| PREDICTED: Gallus gallus similar to predicted CDS,
           endonuclease/exonuclease/phosphatase family and
           RNA-directed DNA polymerase (XR69) (LOC428494), mRNA
          Length = 444

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 4   acaggacaggtcccagtac 22
           |||||||||||||||||||
Sbjct: 316 acaggacaggtcccagtac 298

>gb|AC114403.15| Mus musculus chromosome 1, clone RP23-197H1, complete sequence
          Length = 221305

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 5      caggacaggtcccagtacc 23
              |||||||||||||||||||
Sbjct: 148259 caggacaggtcccagtacc 148277

>emb|AL662806.20| Mouse DNA sequence from clone RP23-273O7 on chromosome 11 Contains the 5'
              end of the Cyfip2 gene for cytoplasmic FMR1 interacting
              protein 2, the Itk gene for IL2-inducible T-cell kinase,
              two novel genes and a CpG island, complete sequence
          Length = 161754

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 67     catggtccctccccacttt 85
              |||||||||||||||||||
Sbjct: 118271 catggtccctccccacttt 118253

>gb|AC008388.7| Homo sapiens chromosome 5 clone CTC-231O11, complete sequence
          Length = 122012

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     agcacaggacaggtcccag 19
             |||||||||||||||||||
Sbjct: 56026 agcacaggacaggtcccag 56044

>gb|AF400586.1|AF400586 Acinetobacter johnsonii mismatch repair protein (mutS) gene,
           partial cds
          Length = 2772

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 43  acatcaaagttcaaacctt 61
           |||||||||||||||||||
Sbjct: 267 acatcaaagttcaaacctt 285

>emb|AL163872.2|CNS05TBN Human chromosome 14 DNA sequence BAC R-76E12 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 168486

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 171   gttttatttggacacagca 189
             |||||||||||||||||||
Sbjct: 31426 gttttatttggacacagca 31408

>gb|CP000021.1| Vibrio fischeri ES114 chromosome II, complete sequence
          Length = 1332022

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 160    catcgcacacggttttatttggacaca 186
              ||||||||||| ||||||||| |||||
Sbjct: 128878 catcgcacacgattttatttgcacaca 128852

>emb|AL355098.3|CNS05TCH Human chromosome 14 DNA sequence BAC R-241E13 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 153094

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 171   gttttatttggacacagca 189
             |||||||||||||||||||
Sbjct: 96310 gttttatttggacacagca 96292


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,112,008
Number of Sequences: 3902068
Number of extensions: 1112008
Number of successful extensions: 81534
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81507
Number of HSP's gapped (non-prelim): 27
length of query: 191
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 169
effective length of database: 17,147,199,772
effective search space: 2897876761468
effective search space used: 2897876761468
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)