>ref|XM_752037.1| Ustilago maydis 521 hypothetical protein (UM00983.1) partial mRNA
          Length = 6582

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 152  gggaccgaaatcgaagcgtgc 172
            |||||||||||||||||||||
Sbjct: 4416 gggaccgaaatcgaagcgtgc 4436

>gb|AF039038.3| Caenorhabditis elegans cosmid K06A5, complete sequence
          Length = 31427

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    gagattactggatacatat 43
             |||||||||||||||||||
Sbjct: 31251 gagattactggatacatat 31269

>gb|AC006625.1| Caenorhabditis elegans cosmid C55B7, complete sequence
          Length = 39373

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 25   gagattactggatacatat 43
            |||||||||||||||||||
Sbjct: 7324 gagattactggatacatat 7342

>gb|AC079438.30| Mus musculus strain C57BL/6J chromosome 6 clone rp23-176m22, complete
              sequence
          Length = 209643

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 170    tgctgcctgctcccctgtctcca 192
              ||||| |||||||||||||||||
Sbjct: 182003 tgctgtctgctcccctgtctcca 181981

>gb|AC124756.4| Mus musculus BAC clone RP23-115J2 from 6, complete sequence
          Length = 213833

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 170   tgctgcctgctcccctgtctcca 192
             ||||| |||||||||||||||||
Sbjct: 73713 tgctgtctgctcccctgtctcca 73691


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 962,770
Number of Sequences: 3902068
Number of extensions: 962770
Number of successful extensions: 62708
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62701
Number of HSP's gapped (non-prelim): 7
length of query: 193
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 171
effective length of database: 17,147,199,772
effective search space: 2932171161012
effective search space used: 2932171161012
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)