>emb|CR854911.13| Zebrafish DNA sequence from clone DKEY-46O18 in linkage group 9,
             complete sequence
          Length = 233574

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 150   tagaccacccgctccagtcca 170
             |||||||||||||||||||||
Sbjct: 56640 tagaccacccgctccagtcca 56660

>emb|BX548053.7| Zebrafish DNA sequence from clone DKEY-189G17 in linkage group 9,
            complete sequence
          Length = 210830

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 150  tagaccacccgctccagtcca 170
            |||||||||||||||||||||
Sbjct: 7210 tagaccacccgctccagtcca 7190

>emb|CR388201.6| Zebrafish DNA sequence from clone DKEYP-66G8 in linkage group 19,
             complete sequence
          Length = 67447

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 150   tagaccacccgctccagtcca 170
             |||||||||||||||||||||
Sbjct: 51561 tagaccacccgctccagtcca 51581

>gb|AY544045.1| Salmo salar clone Rsa463 microsatellite sequence
          Length = 406

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  agttaacacccacattactc 107
           ||||||||||||||||||||
Sbjct: 298 agttaacacccacattactc 279

>emb|CT025598.9| Mouse DNA sequence from clone RP23-218L3 on chromosome 13, complete
              sequence
          Length = 228266

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     aaataagcaatctctcttag 89
              ||||||||||||||||||||
Sbjct: 201139 aaataagcaatctctcttag 201120

>emb|AL645501.8| Human DNA sequence from clone RP11-141J3 on chromosome 1, complete
             sequence
          Length = 43075

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    gggagcagcaaacagaaaat 73
             ||||||||||||||||||||
Sbjct: 12456 gggagcagcaaacagaaaat 12475

>emb|AL591304.1| Human DNA sequence from clone RP11-21G12 on chromosome 6, complete
             sequence
          Length = 35013

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 189   gaccaataacaaattaagca 208
             ||||||||||||||||||||
Sbjct: 22767 gaccaataacaaattaagca 22748

>gb|AC116641.3| Homo sapiens BAC clone RP11-589D21 from 4, complete sequence
          Length = 15827

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 64   aacagaaaataagcaatctc 83
            ||||||||||||||||||||
Sbjct: 4749 aacagaaaataagcaatctc 4730

>gb|AC087896.15|AC087896 Homo sapiens 12q BAC RP11-777K21 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 183562

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 189    gaccaataacaaattaagca 208
              ||||||||||||||||||||
Sbjct: 148878 gaccaataacaaattaagca 148897

>gb|AC175538.1| Mus musculus BAC clone RP24-476A4 from chromosome 13, complete sequence
          Length = 191199

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    aaataagcaatctctcttag 89
             ||||||||||||||||||||
Sbjct: 81143 aaataagcaatctctcttag 81124


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,826,761
Number of Sequences: 3902068
Number of extensions: 1826761
Number of successful extensions: 31894
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31881
Number of HSP's gapped (non-prelim): 13
length of query: 283
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 261
effective length of database: 17,147,199,772
effective search space: 4475419140492
effective search space used: 4475419140492
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)