ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast07e10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC067717.19| Homo sapiens 3 BAC RP11-484E7 (Roswell Park Canc... 44 0.33
2gb|AC117834.6| Homo sapiens chromosome 8, clone CTD-3239E11, com... 44 0.33
3ref|XM_511936.1| PREDICTED: Pan troglodytes LOC455188 (LOC455188... 42 1.3
4gb|AE017336.2| Bacillus anthracis str. 'Ames Ancestor' plasmid p... 40 5.1
5gb|AC132406.4| Mus musculus BAC clone RP23-340E1 from chromosome... 40 5.1
6gb|AC121957.2| Mus musculus BAC clone RP24-232G13 from 18, compl... 40 5.1
7ref|XM_647375.1| Entamoeba histolytica HM-1:IMSS 70 kDa heat sho... 40 5.1
8ref|XM_647792.1| Entamoeba histolytica HM-1:IMSS 70 kDa heat sho... 40 5.1
9gb|AF065404.1| Bacillus anthracis virulence plasmid PX01, comple... 40 5.1
10gb|AC111069.9| Mus musculus chromosome 18, clone RP24-164O22, co... 40 5.1
11emb|CR318635.8| Zebrafish DNA sequence from clone CH211-253D2 in... 40 5.1
12gb|AE011190.1| Bacillus anthracis str. A2012 plasmid pXO1, compl... 40 5.1
13gb|AC021063.16| Mus Musculus Chromosome 18 RP23-179K16, complet... 40 5.1
14gb|AC022124.6| Homo sapiens chromosome 5 clone CTD-2075G19, comp... 40 5.1
15gb|AC145543.3| Homo sapiens chromosome UNKNOWN clone RP11-1278L2... 40 5.1
16gb|AC151714.3| Mus musculus BAC clone RP23-437A9 from chromosome... 40 5.1
17gb|AC008390.7|AC008390 Homo sapiens chromosome 5 clone CTC-235M3... 40 5.1

>gb|AC067717.19| Homo sapiens 3 BAC RP11-484E7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 226233

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 15    aaaggagataatatgaaatgtt 36
             ||||||||||||||||||||||
Sbjct: 36949 aaaggagataatatgaaatgtt 36970



to top

>gb|AC117834.6| Homo sapiens chromosome 8, clone CTD-3239E11, complete sequence
          Length = 189536

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 206    aaaacaagatgaattctggtgg 227
              ||||||||||||||||||||||
Sbjct: 120679 aaaacaagatgaattctggtgg 120658



to top

>ref|XM_511936.1| PREDICTED: Pan troglodytes LOC455188 (LOC455188), mRNA
          Length = 2355

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 92   gctgtggacactgagagacgc 112
            |||||||||||||||||||||
Sbjct: 1023 gctgtggacactgagagacgc 1043



to top

>gb|AE017336.2| Bacillus anthracis str. 'Ames Ancestor' plasmid pXO1, complete sequence
          Length = 181677

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 14    taaaggagataatatgaaatgtta 37
             |||||||||||| |||||||||||
Sbjct: 77647 taaaggagataaaatgaaatgtta 77670



to top

>gb|AC132406.4| Mus musculus BAC clone RP23-340E1 from chromosome 9, complete sequence
          Length = 222617

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 30    aaatgttaactacaaaaagt 49
             ||||||||||||||||||||
Sbjct: 54739 aaatgttaactacaaaaagt 54758



to top

>gb|AC121957.2| Mus musculus BAC clone RP24-232G13 from 18, complete sequence
          Length = 178929

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 166   tacaaatgccaagaatacattaag 189
             |||| |||||||||||||||||||
Sbjct: 33006 tacagatgccaagaatacattaag 33029



to top

>ref|XM_647375.1| Entamoeba histolytica HM-1:IMSS 70 kDa heat shock protein, putative
            (117.t00018) partial mRNA
          Length = 2019

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 152  ggaatggaacttgttacaaa 171
            ||||||||||||||||||||
Sbjct: 1777 ggaatggaacttgttacaaa 1796



to top

>ref|XM_647792.1| Entamoeba histolytica HM-1:IMSS 70 kDa heat shock protein, putative
            (101.t00015) partial mRNA
          Length = 1974

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 152  ggaatggaacttgttacaaa 171
            ||||||||||||||||||||
Sbjct: 1732 ggaatggaacttgttacaaa 1751



to top

>gb|AF065404.1| Bacillus anthracis virulence plasmid PX01, complete sequence
          Length = 181654

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 14    taaaggagataatatgaaatgtta 37
             |||||||||||| |||||||||||
Sbjct: 77596 taaaggagataaaatgaaatgtta 77619



to top

>gb|AC111069.9| Mus musculus chromosome 18, clone RP24-164O22, complete sequence
          Length = 183457

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 205    caaaacaagatgaattctggtggc 228
              ||||||||||||||| ||||||||
Sbjct: 168171 caaaacaagatgaatgctggtggc 168194



to top

>emb|CR318635.8| Zebrafish DNA sequence from clone CH211-253D2 in linkage group 23,
            complete sequence
          Length = 154312

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   actaaaggagataatatgaa 31
            ||||||||||||||||||||
Sbjct: 2439 actaaaggagataatatgaa 2420



to top

>gb|AE011190.1| Bacillus anthracis str. A2012 plasmid pXO1, complete sequence
          Length = 181677

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 14    taaaggagataatatgaaatgtta 37
             |||||||||||| |||||||||||
Sbjct: 77647 taaaggagataaaatgaaatgtta 77670



to top

>gb|AC021063.16| Mus Musculus Chromosome 18  RP23-179K16, complete sequence
          Length = 202807

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 205    caaaacaagatgaattctggtggc 228
              ||||||||||||||| ||||||||
Sbjct: 131103 caaaacaagatgaatgctggtggc 131080



to top

>gb|AC022124.6| Homo sapiens chromosome 5 clone CTD-2075G19, complete sequence
          Length = 120733

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   tggaacttgttacaaatgcc 175
             ||||||||||||||||||||
Sbjct: 36578 tggaacttgttacaaatgcc 36559



to top

>gb|AC145543.3| Homo sapiens chromosome UNKNOWN clone RP11-1278L23, complete sequence
          Length = 221027

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 37    aactacaaaaagtgtgtttg 56
             ||||||||||||||||||||
Sbjct: 49598 aactacaaaaagtgtgtttg 49617



to top

>gb|AC151714.3| Mus musculus BAC clone RP23-437A9 from chromosome 9, complete sequence
          Length = 217761

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 30     aaatgttaactacaaaaagt 49
              ||||||||||||||||||||
Sbjct: 160552 aaatgttaactacaaaaagt 160571



to top

>gb|AC008390.7|AC008390 Homo sapiens chromosome 5 clone CTC-235M3, complete sequence
          Length = 121931

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   tggaacttgttacaaatgcc 175
             ||||||||||||||||||||
Sbjct: 36580 tggaacttgttacaaatgcc 36561


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,529,237
Number of Sequences: 3902068
Number of extensions: 3529237
Number of successful extensions: 69471
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69394
Number of HSP's gapped (non-prelim): 77
length of query: 384
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 362
effective length of database: 17,147,199,772
effective search space: 6207286317464
effective search space used: 6207286317464
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top