>gb|AE014312.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 9
             of 11 of the complete sequence
          Length = 250029

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 189   gctctcactcatcacctttaa 209
             |||||||||||||||||||||
Sbjct: 66588 gctctcactcatcacctttaa 66608

>emb|AL138954.16| Human DNA sequence from clone RP11-100K21 on chromosome 13q33.1-33.3,
             complete sequence
          Length = 144152

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 189   gctctcactcatcacctttaa 209
             |||||||||||||||||||||
Sbjct: 27570 gctctcactcatcacctttaa 27590

>gb|AC134471.3| Mus musculus BAC clone RP23-121J12 from chromosome 17, complete
             sequence
          Length = 176628

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 32    atggtaaaatggatgagaaa 51
             ||||||||||||||||||||
Sbjct: 51195 atggtaaaatggatgagaaa 51176

>gb|AC007364.3| Homo sapiens BAC clone RP11-329H24 from 2, complete sequence
          Length = 200908

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 101    ggcaacacttttacaggcag 120
              ||||||||||||||||||||
Sbjct: 126487 ggcaacacttttacaggcag 126468


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,964,366
Number of Sequences: 3902068
Number of extensions: 2964366
Number of successful extensions: 153377
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 153365
Number of HSP's gapped (non-prelim): 12
length of query: 226
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 204
effective length of database: 17,147,199,772
effective search space: 3498028753488
effective search space used: 3498028753488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)