>gb|BT009310.1| Triticum aestivum clone wlm1.pk0022.d1:fis, full insert mRNA sequence
          Length = 1470

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                 
Query: 237  taggtcagcgcgaagtctacgcaccgtttcttccacaccgcgtgcgccggagt 289
            ||||||||||||||||||| |||||| |||||||| |||||||||||||||||
Sbjct: 1263 taggtcagcgcgaagtctatgcaccgcttcttccagaccgcgtgcgccggagt 1211

>gb|AC168061.3| Mus musculus BAC clone RP23-199J14 from chromosome 16, complete sequence
          Length = 212340

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 5      ataatgtttgatgatcagat 24
              ||||||||||||||||||||
Sbjct: 181654 ataatgtttgatgatcagat 181673

>gb|AC116527.18| Mus musculus chromosome 16, clone RP24-354B8, complete sequence
          Length = 165306

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      ataatgtttgatgatcagat 24
              ||||||||||||||||||||
Sbjct: 102289 ataatgtttgatgatcagat 102270

>gb|AC160958.2| Mus musculus BAC clone RP24-224I13 from chromosome 13, complete sequence
          Length = 178784

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 118    ccagttcatcttttgagccc 137
              ||||||||||||||||||||
Sbjct: 142848 ccagttcatcttttgagccc 142829

>emb|CR543861.1| Acinetobacter sp. ADP1 complete genome
          Length = 3598621

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 4       cataatgtttgatgatcaga 23
               ||||||||||||||||||||
Sbjct: 2826991 cataatgtttgatgatcaga 2827010

>dbj|AK049663.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
            enriched library, clone:C530018L09 product:nuclear
            receptor-binding SET-domain protein 1, full insert
            sequence
          Length = 2014

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 118  ccagttcatcttttgagccc 137
            ||||||||||||||||||||
Sbjct: 1757 ccagttcatcttttgagccc 1776

>dbj|AK053386.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130013E01 product:nuclear
            receptor-binding SET-domain protein 1, full insert
            sequence
          Length = 1770

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 118  ccagttcatcttttgagccc 137
            ||||||||||||||||||||
Sbjct: 1002 ccagttcatcttttgagccc 1021


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,917,042
Number of Sequences: 3902068
Number of extensions: 1917042
Number of successful extensions: 61058
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61040
Number of HSP's gapped (non-prelim): 18
length of query: 314
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 292
effective length of database: 17,147,199,772
effective search space: 5006982333424
effective search space used: 5006982333424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)