>gb|BC020139.1| Mus musculus thymidylate synthase, mRNA (cDNA clone MGC:28246
           IMAGE:3994204), complete cds
          Length = 986

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 281 acggagcagtacgacagcagt 301
           |||||||||||||||||||||
Sbjct: 48  acggagcagtacgacagcagt 28

>ref|XM_746998.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g07350)
           partial mRNA
          Length = 1155

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 241 ccatgcatgcgtccgtcgtc 260
           ||||||||||||||||||||
Sbjct: 383 ccatgcatgcgtccgtcgtc 402

>emb|Z69637.1|CEF35G2 Caenorhabditis elegans Cosmid F35G2, complete sequence
          Length = 35379

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    tctctctcccattttttgtt 38
             ||||||||||||||||||||
Sbjct: 11490 tctctctcccattttttgtt 11509

>gb|AC027670.6| Homo sapiens chromosome 10 clone RP11-176H12, complete sequence
          Length = 191805

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    tttgttgtacacattattcc 52
             ||||||||||||||||||||
Sbjct: 51223 tttgttgtacacattattcc 51242

>emb|BX324157.4| Zebrafish DNA sequence from clone DKEY-15N1 in linkage group 3, complete
              sequence
          Length = 272769

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 31     tttttgttgtacacattatt 50
              ||||||||||||||||||||
Sbjct: 185546 tttttgttgtacacattatt 185565


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,069,373
Number of Sequences: 3902068
Number of extensions: 2069373
Number of successful extensions: 36415
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36410
Number of HSP's gapped (non-prelim): 5
length of query: 366
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 344
effective length of database: 17,147,199,772
effective search space: 5898636721568
effective search space used: 5898636721568
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)