>ref|XM_627368.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd8_4840),
            partial mRNA
          Length = 7230

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 193  gaagttgaagttgtagctgttgat 216
            ||||||||||||||||||||||||
Sbjct: 6802 gaagttgaagttgtagctgttgat 6779

>ref|XM_660787.1| Cryptosporidium hominis TU502 Myb-like DNA-binding domain
            (Chro.80556) partial mRNA
          Length = 5922

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 193  gaagttgaagttgtagctgttgatg 217
            |||| ||||||||||||||||||||
Sbjct: 5524 gaagctgaagttgtagctgttgatg 5500

>emb|CR962120.1|PTB065B04 Pan troglodytes chromosome X BAC PTB-065B04, complete sequence
          Length = 35005

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 118   attgatgataattaagataaa 138
             |||||||||||||||||||||
Sbjct: 24109 attgatgataattaagataaa 24129

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 121    gatgataattaagataaagcg 141
              |||||||||||||||||||||
Sbjct: 319934 gatgataattaagataaagcg 319914

>gb|AC023702.4| Drosophila melanogaster X BAC RP98-24L2 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 159970

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 187    agtgtcgaagttgaagttgtagctg 211
              ||||||||||||||||||| |||||
Sbjct: 118453 agtgtcgaagttgaagttgaagctg 118429

>gb|AC105150.2| Homo sapiens chromosome 8, clone RP11-328K2, complete sequence
          Length = 201000

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 67     aagatactacgttgtttcctctcca 91
              |||||||||| ||||||||||||||
Sbjct: 145781 aagatactaccttgtttcctctcca 145757

>gb|AC130390.4| Drosophila melanogaster X BAC RP98-21O19 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 184175

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 187   agtgtcgaagttgaagttgtagctg 211
             ||||||||||||||||||| |||||
Sbjct: 59958 agtgtcgaagttgaagttgaagctg 59934

>gb|AC116614.6| Homo sapiens BAC clone CTD-2029L3 from 2, complete sequence
          Length = 129814

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 225    aaagtccatccctcatgagtg 245
              |||||||||||||||||||||
Sbjct: 109953 aaagtccatccctcatgagtg 109933

>gb|AE003448.4| Drosophila melanogaster chromosome X, section 32 of 74 of the complete
             sequence
          Length = 318665

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 187   agtgtcgaagttgaagttgtagctg 211
             ||||||||||||||||||| |||||
Sbjct: 86847 agtgtcgaagttgaagttgaagctg 86823

>emb|AL137277.1|HSM801940 Homo sapiens mRNA; cDNA DKFZp434M1114 (from clone DKFZp434M1114)
          Length = 3884

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 225  aaagtccatccctcatgagtg 245
            |||||||||||||||||||||
Sbjct: 3386 aaagtccatccctcatgagtg 3406

>emb|AL021046.4|SPAC3G9 S.pombe chromosome I cosmid c3G9
          Length = 38096

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 70    atactacgttgtttcctctccatc 93
             |||||||||||||| |||||||||
Sbjct: 13853 atactacgttgtttactctccatc 13876

>ref|XM_309208.2| Anopheles gambiae str. PEST ENSANGP00000005397 (ENSANGG00000004156),
            partial mRNA
          Length = 7809

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 201  agttgtagctgttgatgccg 220
            ||||||||||||||||||||
Sbjct: 2962 agttgtagctgttgatgccg 2943


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,879,739
Number of Sequences: 3902068
Number of extensions: 1879739
Number of successful extensions: 33408
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33383
Number of HSP's gapped (non-prelim): 25
length of query: 270
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 248
effective length of database: 17,147,199,772
effective search space: 4252505543456
effective search space used: 4252505543456
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)