ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast06e03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_475238.1| Oryza sativa (japonica cultivar-group), predic... 88 2e-14
2gb|AC124836.2| Oryza sativa (japonica cultivar-group) chromosome... 88 2e-14
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 88 2e-14
4dbj|AK107746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 2e-14
5ref|XM_463543.1| Oryza sativa (japonica cultivar-group), predic... 72 1e-09
6gb|AY742218.1| Saccharum officinarum NAC23 mRNA, complete cds 72 1e-09
7dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 72 1e-09
8gb|AF254558.1|AF254558 Oryza sativa NAC6 (NAC6) gene, complete cds 72 1e-09
9dbj|AP003561.2| Oryza sativa (japonica cultivar-group) genomic D... 72 1e-09
10dbj|AK068392.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 1e-09
11dbj|AB028185.1| Oryza sativa mRNA for OsNAC6 protein, complete cds 72 1e-09
12gb|AY109519.1| Zea mays CL5798_1 mRNA sequence 54 3e-04
13emb|AL008629.9|HS197O17 Human DNA sequence from clone RP1-197O17... 46 0.071
14ref|XM_537282.2| PREDICTED: Canis familiaris estrogen-regulated ... 44 0.28
15emb|AL590489.11| Human DNA sequence from clone RP11-412O4 on chr... 44 0.28
16emb|AL353895.4| Human DNA sequence from clone RP11-503K16 on chr... 44 0.28
17gb|AC108853.7| Mus musculus chromosome 8, clone RP24-87L12, comp... 42 1.1
18gb|AC158214.4| Mus musculus chromosome 7, clone RP24-208N15, com... 42 1.1
19gb|AC164399.4| Mus musculus chromosome 8, clone RP23-338K3, comp... 42 1.1
20gb|AC101980.8| Mus musculus chromosome 7, clone RP24-339E15, com... 42 1.1
21emb|AL669859.5| Mouse DNA sequence from clone RP23-167D6 on chro... 42 1.1
22emb|CR859357.1| Pongo pygmaeus mRNA; cDNA DKFZp469N1320 (from cl... 42 1.1
23gb|AE012169.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 1.1
24gb|AC091060.10| Homo sapiens chromosome 18, clone RP11-723J4, co... 42 1.1
25gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 42 1.1
26gb|U41060.2|HSU41060 Homo sapiens estrogen regulated LIV-1 prote... 42 1.1
27gb|AC007279.4| Homo sapiens BAC clone RP11-309N8 from 2, complet... 42 1.1
28ref|NM_012319.2| Homo sapiens solute carrier family 39 (zinc tra... 42 1.1
29gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome 40 4.4
30gb|AC087421.2| Felis catus clone RP86-177C24, complete sequence 40 4.4
31gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 40 4.4
32gb|AY392418.1|AY392417S2 Streptomyces clavuligerus plasmid pSCL2... 40 4.4
33emb|AL392045.9| Human DNA sequence from clone RP13-408A12 on chr... 40 4.4
34emb|AL096816.12|HSDJ47M23 Human DNA sequence from clone RP1-47M2... 40 4.4
35dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 40 4.4
36gb|AC092110.9| Homo sapiens 12 BAC RP11-287J11 (Roswell Park Can... 40 4.4
37dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 40 4.4
38gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 4.4
39gb|AC078814.23| Homo sapiens 12 BAC RP11-848D3 (Roswell Park Can... 40 4.4
40emb|AL449963.2|HS399M15 Homo sapiens chromosome 9 BAC RP11-399M1... 40 4.4
41gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 40 4.4 
>ref|XM_475238.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 969

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 50/52 (96%)
 Strand = Plus / Minus

                                                               
Query: 270 tcagaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgccg 321
           |||||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 969 tcagaacggcttgccccagtacatgaggatgtcctggaggagcgggtcgccg 918
to top
>gb|AC124836.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0092E21, complete sequence
          Length = 132649

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 50/52 (96%)
 Strand = Plus / Minus

                                                                 
Query: 270   tcagaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgccg 321
             |||||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 79113 tcagaacggcttgccccagtacatgaggatgtcctggaggagcgggtcgccg 79062



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 175   cgatagattccggcggctcgcccgagtcaccccg 208
             |||| |||||| |||||||||||||| |||||||
Sbjct: 79204 cgatcgattccagcggctcgcccgagccaccccg 79171
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 50/52 (96%)
 Strand = Plus / Minus

                                                                    
Query: 270      tcagaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgccg 321
                |||||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 20535634 tcagaacggcttgccccagtacatgaggatgtcctggaggagcgggtcgccg 20535583



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                  
Query: 175      cgatagattccggcggctcgcccgagtcaccccg 208
                |||| |||||| |||||||||||||| |||||||
Sbjct: 20535725 cgatcgattccagcggctcgcccgagccaccccg 20535692
to top
>dbj|AK107746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-H04, full
           insert sequence
          Length = 841

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 50/52 (96%)
 Strand = Plus / Minus

                                                               
Query: 270 tcagaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgccg 321
           |||||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 561 tcagaacggcttgccccagtacatgaggatgtcctggaggagcgggtcgccg 510



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 175 cgatagattccggcggctcgcccgagtcaccccg 208
           |||| |||||| |||||||||||||| |||||||
Sbjct: 652 cgatcgattccagcggctcgcccgagccaccccg 619
to top
>ref|XM_463543.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 912

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 272 agaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgc 319
           |||| |||||||||||||||||||||||||| |||||||| |||||||
Sbjct: 910 agaatggcttgccccagtacatgaggatgtcctggaggagggggtcgc 863
to top
>gb|AY742218.1| Saccharum officinarum NAC23 mRNA, complete cds
          Length = 891

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                               
Query: 272 agaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgccggc 323
           |||| |||||||||||||||||||||||||| || || ||||||||||||||
Sbjct: 889 agaacggcttgccccagtacatgaggatgtcctgcagcagcgggtcgccggc 838
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                                
Query: 272      agaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgc 319
                |||| |||||||||||||||||||||||||| |||||||| |||||||
Sbjct: 38392762 agaatggcttgccccagtacatgaggatgtcctggaggagggggtcgc 38392809
to top
>gb|AF254558.1|AF254558 Oryza sativa NAC6 (NAC6) gene, complete cds
          Length = 4817

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 272  agaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgc 319
            |||| |||||||||||||||||||||||||| |||||||| |||||||
Sbjct: 4020 agaatggcttgccccagtacatgaggatgtcctggaggagggggtcgc 3973
to top
>dbj|AP003561.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1065E10
          Length = 183580

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                              
Query: 272    agaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgc 319
              |||| |||||||||||||||||||||||||| |||||||| |||||||
Sbjct: 153587 agaatggcttgccccagtacatgaggatgtcctggaggagggggtcgc 153634
to top
>dbj|AK068392.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013149P14, full
            insert sequence
          Length = 1529

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 272  agaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgc 319
            |||| |||||||||||||||||||||||||| |||||||| |||||||
Sbjct: 1021 agaatggcttgccccagtacatgaggatgtcctggaggagggggtcgc 974
to top
>dbj|AB028185.1| Oryza sativa mRNA for OsNAC6 protein, complete cds
          Length = 1423

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                            
Query: 272  agaaaggcttgccccagtacatgaggatgtcttggaggagcgggtcgc 319
            |||| |||||||||||||||||||||||||| |||||||| |||||||
Sbjct: 1021 agaatggcttgccccagtacatgaggatgtcctggaggagggggtcgc 974
to top
>gb|AY109519.1| Zea mays CL5798_1 mRNA sequence
          Length = 1022

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 272 agaaaggcttgccccagtacatgaggatgtc 302
           |||| ||||||||||||||||||||||||||
Sbjct: 527 agaacggcttgccccagtacatgaggatgtc 557
to top
>emb|AL008629.9|HS197O17 Human DNA sequence from clone RP1-197O17 on chromosome Xq25-26.3
             Contains a pseudogene similar to part of SMT3 suppressor
             of mif two 3 (yeast), the 5' end of gene LOC286467 and a
             myofibrillogenesis regulator 1 (MR-1) (FKSG19) pseudogene,
             complete sequence
          Length = 161812

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 39    tatacaccatgaccaagtacagt 61
             |||||||||||||||||||||||
Sbjct: 71544 tatacaccatgaccaagtacagt 71522
to top
>ref|XM_537282.2| PREDICTED: Canis familiaris estrogen-regulated LIV-1 protein
           (LIV-1), mRNA
          Length = 2299

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 32  aaatccatatacaccatgacca 53
           ||||||||||||||||||||||
Sbjct: 269 aaatccatatacaccatgacca 290
to top
>emb|AL590489.11| Human DNA sequence from clone RP11-412O4 on chromosome 6q16.2-21 Contains
              part of the C6orf210 gene for chromosome 6 open reading
              frame 210, complete sequence
          Length = 130146

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 40     atacaccatgaccaagtacagt 61
              ||||||||||||||||||||||
Sbjct: 119174 atacaccatgaccaagtacagt 119195
to top
>emb|AL353895.4| Human DNA sequence from clone RP11-503K16 on chromosome 9 Contains the
             3' end of the ADAMTSL1 gene for ADAMTS-like (ADAMTSR1,
             MGC40139) and a ras-related protein family pseudogene,
             complete sequence
          Length = 163163

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 40    atacaccatgaccaagtacagt 61
             ||||||||||||||||||||||
Sbjct: 39644 atacaccatgaccaagtacagt 39623
to top
>gb|AC108853.7| Mus musculus chromosome 8, clone RP24-87L12, complete sequence
          Length = 171410

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 39    tatacaccatgaccaagtaca 59
             |||||||||||||||||||||
Sbjct: 29537 tatacaccatgaccaagtaca 29557
to top
>gb|AC158214.4| Mus musculus chromosome 7, clone RP24-208N15, complete sequence
          Length = 175320

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 282   gccccagtacatgaggatgtc 302
             |||||||||||||||||||||
Sbjct: 34529 gccccagtacatgaggatgtc 34509
to top
>gb|AC164399.4| Mus musculus chromosome 8, clone RP23-338K3, complete sequence
          Length = 213363

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 39    tatacaccatgaccaagtaca 59
             |||||||||||||||||||||
Sbjct: 39594 tatacaccatgaccaagtaca 39574
to top
>gb|AC101980.8| Mus musculus chromosome 7, clone RP24-339E15, complete sequence
          Length = 219739

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 282   gccccagtacatgaggatgtc 302
             |||||||||||||||||||||
Sbjct: 37526 gccccagtacatgaggatgtc 37546
to top
>emb|AL669859.5| Mouse DNA sequence from clone RP23-167D6 on chromosome 11, complete
              sequence
          Length = 155196

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 286    cagtacatgaggatgtcttgg 306
              |||||||||||||||||||||
Sbjct: 141014 cagtacatgaggatgtcttgg 141034
to top
>emb|CR859357.1| Pongo pygmaeus mRNA; cDNA DKFZp469N1320 (from clone DKFZp469N1320)
          Length = 2968

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 33  aatccatatacaccatgacca 53
           |||||||||||||||||||||
Sbjct: 557 aatccatatacaccatgacca 577
to top
>gb|AE012169.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 77 of
             460 of the complete genome
          Length = 13011

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 310   agcgggtcgccggccggcagc 330
             |||||||||||||||||||||
Sbjct: 12324 agcgggtcgccggccggcagc 12344
to top
>gb|AC091060.10| Homo sapiens chromosome 18, clone RP11-723J4, complete sequence
          Length = 221941

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 33     aatccatatacaccatgacca 53
              |||||||||||||||||||||
Sbjct: 187100 aatccatatacaccatgacca 187080
to top
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 310     agcgggtcgccggccggcagc 330
               |||||||||||||||||||||
Sbjct: 4184274 agcgggtcgccggccggcagc 4184254
to top
>gb|U41060.2|HSU41060 Homo sapiens estrogen regulated LIV-1 protein (LIV-1) mRNA,
           complete cds
          Length = 2744

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 33  aatccatatacaccatgacca 53
           |||||||||||||||||||||
Sbjct: 404 aatccatatacaccatgacca 424
to top
>gb|AC007279.4| Homo sapiens BAC clone RP11-309N8 from 2, complete sequence
          Length = 138270

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 39    tatacaccatgaccaagtaca 59
             |||||||||||||||||||||
Sbjct: 45320 tatacaccatgaccaagtaca 45300
to top
>ref|NM_012319.2| Homo sapiens solute carrier family 39 (zinc transporter), member 6
           (SLC39A6), mRNA
          Length = 2744

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 33  aatccatatacaccatgacca 53
           |||||||||||||||||||||
Sbjct: 404 aatccatatacaccatgacca 424
to top
>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome
          Length = 3481691

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 293    tgaggatgtcttggaggagc 312
              ||||||||||||||||||||
Sbjct: 361614 tgaggatgtcttggaggagc 361633
to top
>gb|AC087421.2| Felis catus clone RP86-177C24, complete sequence
          Length = 141881

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    gggctcccgcgtctcatcgc 110
             ||||||||||||||||||||
Sbjct: 79487 gggctcccgcgtctcatcgc 79468
to top
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 158     ctacgagtatctgctgtcga 177
               ||||||||||||||||||||
Sbjct: 3461499 ctacgagtatctgctgtcga 3461480
to top
>gb|AY392418.1|AY392417S2 Streptomyces clavuligerus plasmid pSCL2 clone contig7.207-II, partial
             sequence
          Length = 15013

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 312   cgggtcgccggccggcagcc 331
             ||||||||||||||||||||
Sbjct: 12650 cgggtcgccggccggcagcc 12631
to top
>emb|AL392045.9| Human DNA sequence from clone RP13-408A12 on chromosome 10, complete
             sequence
          Length = 161933

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    atatacaccatgaccaagta 57
             ||||||||||||||||||||
Sbjct: 25878 atatacaccatgaccaagta 25859
to top
>emb|AL096816.12|HSDJ47M23 Human DNA sequence from clone RP1-47M23 on chromosome 6q16.2-21
            Contains the 3' end of a novel gene (FLJ00197, novel SAM
            domain (Sterile alpha motif) containing protein gene),
            the 3' end of another novel gene and a CpG island,
            complete sequence
          Length = 129320

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 38   atatacaccatgaccaagta 57
            ||||||||||||||||||||
Sbjct: 2378 atatacaccatgaccaagta 2359
to top
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 310     agcgggtcgccggccggcag 329
               ||||||||||||||||||||
Sbjct: 4091625 agcgggtcgccggccggcag 4091606
to top
>gb|AC092110.9| Homo sapiens 12 BAC RP11-287J11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 181207

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 38     atatacaccatgaccaagta 57
              ||||||||||||||||||||
Sbjct: 125053 atatacaccatgaccaagta 125072
to top
>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026
          Length = 2324132

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 107     tcgccgccgtccgtgactcc 126
               ||||||||||||||||||||
Sbjct: 2031041 tcgccgccgtccgtgactcc 2031060
to top
>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII,
              complete sequence
          Length = 1476513

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 231    gcccaaaccacacgtacagc 250
              ||||||||||||||||||||
Sbjct: 403677 gcccaaaccacacgtacagc 403658
to top
>gb|AC078814.23| Homo sapiens 12 BAC RP11-848D3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 191463

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 38    atatacaccatgaccaagta 57
             ||||||||||||||||||||
Sbjct: 99189 atatacaccatgaccaagta 99208
to top
>emb|AL449963.2|HS399M15 Homo sapiens chromosome 9 BAC RP11-399M15, complete sequence
          Length = 213216

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 40     atacaccatgaccaagtaca 59
              ||||||||||||||||||||
Sbjct: 160383 atacaccatgaccaagtaca 160364
to top
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 310     agcgggtcgccggccggcag 329
               ||||||||||||||||||||
Sbjct: 4096224 agcgggtcgccggccggcag 4096205


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,209,803
Number of Sequences: 3902068
Number of extensions: 2209803
Number of successful extensions: 59875
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59662
Number of HSP's gapped (non-prelim): 213
length of query: 332
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 310
effective length of database: 17,147,199,772
effective search space: 5315631929320
effective search space used: 5315631929320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top