>ref|XM_532369.2| PREDICTED: Canis familiaris similar to CG32045-PC, isoform C
            (LOC475139), mRNA
          Length = 9312

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 8    gaagcagctactgaaaatgcagttt 32
            |||||||| ||||||||||||||||
Sbjct: 8803 gaagcagcaactgaaaatgcagttt 8779

>emb|AL450471.9| Human DNA sequence from clone RP11-74B21 on chromosome X Contains a
             cytochrome b (mitochondrial) pseudogene, complete sequence
          Length = 50191

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 21    aaaatgcagtttcagtccaat 41
             |||||||||||||||||||||
Sbjct: 12295 aaaatgcagtttcagtccaat 12315

>ref|XM_689624.1| PREDICTED: Danio rerio similar to AT rich interactive domain 2 (ARID,
            RFX-like) (LOC566352), mRNA
          Length = 4353

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 195  ggtcatggagaacaactccat 215
            |||||||||||||||||||||
Sbjct: 2889 ggtcatggagaacaactccat 2909

>emb|AL929171.9| Zebrafish DNA sequence from clone CH211-132P20 in linkage group 4,
             complete sequence
          Length = 176577

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 195   ggtcatggagaacaactccat 215
             |||||||||||||||||||||
Sbjct: 15078 ggtcatggagaacaactccat 15098

>gb|BC051348.1| Homo sapiens protocadherin beta 13, mRNA (cDNA clone MGC:59713
           IMAGE:6483735), complete cds
          Length = 2771

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 237 ttcttgctggattcagcttc 256
           ||||||||||||||||||||
Sbjct: 156 ttcttgctggattcagcttc 137

>ref|NG_000017.2| Homo sapiens protocadherin beta cluster (PCDHB@) on chromosome 5
          Length = 257923

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 237    ttcttgctggattcagcttc 256
              ||||||||||||||||||||
Sbjct: 182246 ttcttgctggattcagcttc 182227

>ref|NM_018933.2| Homo sapiens protocadherin beta 13 (PCDHB13), mRNA
          Length = 3485

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 237 ttcttgctggattcagcttc 256
           ||||||||||||||||||||
Sbjct: 185 ttcttgctggattcagcttc 166

>gb|AY358427.1| Homo sapiens clone DNA48314 PCDHB13 (UNQ332) mRNA, complete cds
          Length = 2738

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 237 ttcttgctggattcagcttc 256
           ||||||||||||||||||||
Sbjct: 168 ttcttgctggattcagcttc 149

>gb|BC033068.1| Homo sapiens protocadherin beta 13, mRNA (cDNA clone MGC:45607
           IMAGE:5446016), complete cds
          Length = 2771

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 237 ttcttgctggattcagcttc 256
           ||||||||||||||||||||
Sbjct: 156 ttcttgctggattcagcttc 137

>emb|AL158052.10| Human DNA sequence from clone RP11-570J20 on chromosome 9q33.1-34.12
             Contains three novel genes, the 3' end of the LHX2 gene
             for LIM homeobox protein 2 and four CpG islands, complete
             sequence
          Length = 221887

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 143   tttgcaagcactacattatt 162
             ||||||||||||||||||||
Sbjct: 23120 tttgcaagcactacattatt 23101

>ref|XM_781709.1| PREDICTED: Strongylocentrotus purpuratus similar to Down syndrome
            cell adhesion molecule (LOC581722), mRNA
          Length = 4032

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 262  ttgacgtagtcatcttcatc 281
            ||||||||||||||||||||
Sbjct: 3911 ttgacgtagtcatcttcatc 3892

>gb|DQ397875.1| Cenarchaeum symbiosum clone C07F02, complete sequence
          Length = 41724

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    agtttgcatcatactatgag 81
             ||||||||||||||||||||
Sbjct: 22781 agtttgcatcatactatgag 22762

>dbj|AK021915.1| Homo sapiens cDNA FLJ11853 fis, clone HEMBA1006758, highly similar
           to Homo sapiens protocadherin beta 13 (PCDH-beta13) mRNA
          Length = 2922

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 237 ttcttgctggattcagcttc 256
           ||||||||||||||||||||
Sbjct: 186 ttcttgctggattcagcttc 167

>gb|AC123710.12| Mus musculus chromosome 5, clone RP23-378C15, complete sequence
          Length = 175744

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   tcatggagaacaactccatg 216
             ||||||||||||||||||||
Sbjct: 25385 tcatggagaacaactccatg 25366

>gb|AC097452.2| Homo sapiens BAC clone RP11-1J7 from 4, complete sequence
          Length = 118322

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 273   atcttcatccttgctcaagt 292
             ||||||||||||||||||||
Sbjct: 32258 atcttcatccttgctcaagt 32277

>ref|NM_001003121.1| Canis familiaris gonadotropin-releasing hormone receptor (GNRHR),
           mRNA
          Length = 984

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 79  gagtccagcacacagtacacgaag 102
           ||||||||||||||||| ||||||
Sbjct: 841 gagtccagcacacagtaaacgaag 818

>gb|AC125499.3| Equus caballus clone CH241-369C8, complete sequence
          Length = 207304

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 148   aagcactacattattatctt 167
             ||||||||||||||||||||
Sbjct: 87046 aagcactacattattatctt 87027

>gb|AF206513.1|AF206513 Canis familiaris GnRH receptor mRNA, complete cds
          Length = 984

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 79  gagtccagcacacagtacacgaag 102
           ||||||||||||||||| ||||||
Sbjct: 841 gagtccagcacacagtaaacgaag 818

>gb|AC006450.13|AC006450 Homo sapiens chromosome 9, clone RP11-85O21, complete sequence
          Length = 177555

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 143   tttgcaagcactacattatt 162
             ||||||||||||||||||||
Sbjct: 28151 tttgcaagcactacattatt 28170

>gb|BC071934.1| Homo sapiens protocadherin beta 13, mRNA (cDNA clone MGC:88620
           IMAGE:6383780), complete cds
          Length = 2771

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 237 ttcttgctggattcagcttc 256
           ||||||||||||||||||||
Sbjct: 156 ttcttgctggattcagcttc 137

>gb|AC005752.1|AC005752 Homo sapiens chromosome 5, BAC clone 182a8 (LBNL H161), complete
             sequence
          Length = 101072

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 237   ttcttgctggattcagcttc 256
             ||||||||||||||||||||
Sbjct: 75678 ttcttgctggattcagcttc 75697

>gb|DP000020.1| Equus caballus target 1 genomic scaffold
          Length = 1907055

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 148    aagcactacattattatctt 167
              ||||||||||||||||||||
Sbjct: 377529 aagcactacattattatctt 377510


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,867,745
Number of Sequences: 3902068
Number of extensions: 2867745
Number of successful extensions: 56842
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56805
Number of HSP's gapped (non-prelim): 37
length of query: 296
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 274
effective length of database: 17,147,199,772
effective search space: 4698332737528
effective search space used: 4698332737528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)