ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast04c08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC098584.2| Homo sapiens BAC clone RP11-10L11 from 4, complet... 46 0.092
2gb|AF271796.1| Glycine max biotin carboxyl carrier protein subun... 44 0.36
3gb|AC093309.2| Homo sapiens chromosome 5 clone RP11-97P23, compl... 44 0.36
4gb|AC137117.15| Mus musculus chromosome 15, clone RP23-242E20, c... 42 1.4
5gb|AY804576.1| Drosophila santomea strain STO.4 disembodied (dib... 42 1.4
6gb|AC118038.15| Mus musculus chromosome 15, clone RP23-87G17, co... 42 1.4
7emb|AL353805.20| Human DNA sequence from clone RP11-190I13 on ch... 42 1.4
8gb|AC096845.2| Takifugu rubripes clone 214J14, complete sequence 42 1.4
9emb|AL445623.2|HS315I14 Homo sapiens chromosome 9 BAC RP11-315I1... 42 1.4
10gb|AC148346.12| Medicago truncatula clone mth2-25m19, complete s... 42 1.4
11gb|AC149578.15| Medicago truncatula clone mth2-94f23, complete s... 42 1.4
12gb|AC093801.3| Homo sapiens BAC clone RP11-313E19 from 4, comple... 42 1.4
13gb|AY586684.1| Lepista nuda 28S ribosomal RNA gene, partial sequ... 40 5.7
14gb|AY647208.1| Clitocybe subvelosa isolate AFTOL-ID 721 25S larg... 40 5.7
15gb|DQ470814.1| Neohygrophorus angelesianus isolate AFTOL-ID 1719... 40 5.7
16gb|U70844.1| Caenorhabditis elegans cosmid ZK154, complete sequence 40 5.7
17emb|Z92780.1|CEC45G3 Caenorhabditis elegans Cosmid C45G3, comple... 40 5.7
18gb|AC126030.3| Mus musculus BAC clone RP23-452N11 from chromosom... 40 5.7
19gb|BC044008.1| Xenopus laevis similar to macrophage stimulating ... 40 5.7
20gb|AF261441.1| Neohygrophorus angelesianus strain DAOM208569 25S... 40 5.7
21emb|AL158053.14| Human DNA sequence from clone RP11-156J23 on ch... 40 5.7
22emb|AL139409.9| Human DNA sequence from clone RP11-120D12 on chr... 40 5.7
23emb|Y08734.1|XLHGFLP X.laevis mRNA for hepatocyte growth factor-... 40 5.7
24emb|AL929087.4| Zebrafish DNA sequence from clone CH211-226M16 i... 40 5.7
25gb|AF527374.1| Tricholoma caligatum DAVFP 26217 internal transcr... 40 5.7
26gb|AF527373.1| Tricholoma caligatum DAVFP 26219 18S ribosomal RN... 40 5.7
27gb|AF527372.1| Tricholoma caligatum DAVFP 26218 internal transcr... 40 5.7
28gb|AY207223.1| Lepista nuda 28S large subunit ribosomal RNA gene... 40 5.7
29dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
30gb|AC011810.8|AC011810 Arabidopsis thaliana chromosome I BAC T6J... 40 5.7
31gb|AC027134.4|AC027134 Arabidopsis thaliana chromosome I BAC F13... 40 5.7
32dbj|AP004683.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
33dbj|AP005924.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
34gb|DQ341897.1| Uncultured basidiomycete clone 126a_01 KBS-LTER l... 40 5.7
35gb|AF139963.1|AF139963 Lepista nuda 5.8S ribosomal RNA gene, par... 40 5.7
36emb|CT571247.13| Mouse DNA sequence from clone RP24-116C19 on ch... 40 5.7
37gb|DQ071713.1| Lepista nuda 28S large subunit ribosomal RNA gene... 40 5.7
38gb|AY462040.1| Tricholoma sulphureum voucher TUB011629 28S ribos... 40 5.7
39gb|AY462031.1| Tricholoma bufonium voucher P62 AQUI 28S ribosoma... 40 5.7
40gb|AY462028.1| Uncultured ectomycorrhiza (Tricholoma) 28S riboso... 40 5.7
41dbj|AB231882.1| Scolionema suvaense gene for zinc finger protein... 40 5.7
42gb|U76463.1|TVU76463 Tricholoma venenatum 25S ribosomal RNA gene... 40 5.7
43gb|U76461.1|TVU76461 Tricholoma vernaticum 25S ribosomal RNA gen... 40 5.7
44gb|U76462.1|TPU76462 Tricholoma pardinum 25S ribosomal RNA gene,... 40 5.7
45gb|AC171733.1| Lycopersicon esculentum chromosome 11 clone C11HB... 40 5.7
46emb|AL627125.8| Mouse DNA sequence from clone RP23-466N19 on chr... 40 5.7 
>gb|AC098584.2| Homo sapiens BAC clone RP11-10L11 from 4, complete sequence
          Length = 159206

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 213    ttgcattcacaatatttctgatc 235
              |||||||||||||||||||||||
Sbjct: 108696 ttgcattcacaatatttctgatc 108718
to top
>gb|AF271796.1| Glycine max biotin carboxyl carrier protein subunit (accB-2) gene,
            complete cds; nuclear gene for chloroplast product
          Length = 10502

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 65   aatagtcaataatcaacaaaag 86
            ||||||||||||||||||||||
Sbjct: 1139 aatagtcaataatcaacaaaag 1160
to top
>gb|AC093309.2| Homo sapiens chromosome 5 clone RP11-97P23, complete sequence
          Length = 169422

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 266   aacctcacaagcatgatggtag 287
             ||||||||||||||||||||||
Sbjct: 12321 aacctcacaagcatgatggtag 12342
to top
>gb|AC137117.15| Mus musculus chromosome 15, clone RP23-242E20, complete sequence
          Length = 202147

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 365   aaagatagacagattgatcaa 385
             |||||||||||||||||||||
Sbjct: 40613 aaagatagacagattgatcaa 40593
to top
>gb|AY804576.1| Drosophila santomea strain STO.4 disembodied (dib) gene, partial cds
          Length = 1733

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 121  caccgcagtgccctgaatccc 141
            |||||||||||||||||||||
Sbjct: 1471 caccgcagtgccctgaatccc 1491
to top
>gb|AC118038.15| Mus musculus chromosome 15, clone RP23-87G17, complete sequence
          Length = 209907

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 365  aaagatagacagattgatcaa 385
            |||||||||||||||||||||
Sbjct: 1287 aaagatagacagattgatcaa 1307
to top
>emb|AL353805.20| Human DNA sequence from clone RP11-190I13 on chromosome 9 Contains the
             5' end of a novel gene (FLJ20287), a novel gene similar to
             RIKEN cDNA 5730528L13 gene (MGC17337), the 5' end of the
             TMEFF1 gene for transmembrane protein with EGF-like and
             two follistatin-like domains 1 (H7365, C9ORF2) and four
             CpG islands, complete sequence
          Length = 158606

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 332   tataaccacaaccattgatat 352
             |||||||||||||||||||||
Sbjct: 65290 tataaccacaaccattgatat 65270
to top
>gb|AC096845.2| Takifugu rubripes clone 214J14, complete sequence
          Length = 134105

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 116   cagctcaccgcagtgccctga 136
             |||||||||||||||||||||
Sbjct: 71478 cagctcaccgcagtgccctga 71458
to top
>emb|AL445623.2|HS315I14 Homo sapiens chromosome 9 BAC RP11-315I14, complete sequence
          Length = 198637

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 288   ggcaagtttcaagcacattgc 308
             |||||||||||||||||||||
Sbjct: 94133 ggcaagtttcaagcacattgc 94153
to top
>gb|AC148346.12| Medicago truncatula clone mth2-25m19, complete sequence
          Length = 122590

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 388   attcaattttttcccttcaaa 408
             |||||||||||||||||||||
Sbjct: 13137 attcaattttttcccttcaaa 13157
to top
>gb|AC149578.15| Medicago truncatula clone mth2-94f23, complete sequence
          Length = 119657

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 388  attcaattttttcccttcaaa 408
            |||||||||||||||||||||
Sbjct: 1117 attcaattttttcccttcaaa 1097
to top
>gb|AC093801.3| Homo sapiens BAC clone RP11-313E19 from 4, complete sequence
          Length = 126929

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    acatcataactactgtataaa 30
             |||||||||||||||||||||
Sbjct: 94142 acatcataactactgtataaa 94122
to top
>gb|AY586684.1| Lepista nuda 28S ribosomal RNA gene, partial sequence
          Length = 1331

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 523 atccaccagtcaaaattgat 504
to top
>gb|AY647208.1| Clitocybe subvelosa isolate AFTOL-ID 721 25S large subunit
           ribosomal RNA gene, partial sequence
          Length = 1402

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 489 atccaccagtcaaaattgat 470
to top
>gb|DQ470814.1| Neohygrophorus angelesianus isolate AFTOL-ID 1719 25S large subunit
           ribosomal RNA gene, partial sequence
          Length = 1475

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 527 atccaccagtcaaaattgat 508
to top
>gb|U70844.1| Caenorhabditis elegans cosmid ZK154, complete sequence
          Length = 26547

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 385  agcattcaattttttccctt 404
            ||||||||||||||||||||
Sbjct: 9039 agcattcaattttttccctt 9020
to top
>emb|Z92780.1|CEC45G3 Caenorhabditis elegans Cosmid C45G3, complete sequence
          Length = 36134

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 393  attttttcccttcaaagaaa 412
            ||||||||||||||||||||
Sbjct: 6893 attttttcccttcaaagaaa 6874
to top
>gb|AC126030.3| Mus musculus BAC clone RP23-452N11 from chromosome 16, complete
             sequence
          Length = 187505

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    aactgtaatagtaacagtta 113
             ||||||||||||||||||||
Sbjct: 33512 aactgtaatagtaacagtta 33493
to top
>gb|BC044008.1| Xenopus laevis similar to macrophage stimulating 1 (hepatocyte
           growth factor-like), mRNA (cDNA clone MGC:54016
           IMAGE:5571526), complete cds
          Length = 2845

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 115 acagctcaccgcagtgccctgaat 138
           |||||||||||||||||| |||||
Sbjct: 175 acagctcaccgcagtgccttgaat 198
to top
>gb|AF261441.1| Neohygrophorus angelesianus strain DAOM208569 25S large subunit
           ribosomal RNA gene, partial sequence
          Length = 1143

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 463 atccaccagtcaaaattgat 444
to top
>emb|AL158053.14| Human DNA sequence from clone RP11-156J23 on chromosome Xq21.2-21.33
              Contains a discs, large homolog 7 (Drosophila) (DLG7)
              pseudogene, complete sequence
          Length = 177722

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 389    ttcaattttttcccttcaaa 408
              ||||||||||||||||||||
Sbjct: 148480 ttcaattttttcccttcaaa 148499
to top
>emb|AL139409.9| Human DNA sequence from clone RP11-120D12 on chromosome 1q21.2-22
             Contains the 5' end of the gene for Fc receptor-like
             protein 1 (FCRH1), the CD5L gene for CD5 antigen-like
             (scavenger receptor cysteine rich family) and a
             mitochondrial ribosomal protein S21 (MRPS21) pseudogene,
             complete sequence
          Length = 63633

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 374   cagattgatcaagcattcaatttt 397
             ||||||||||||||| ||||||||
Sbjct: 36368 cagattgatcaagcaatcaatttt 36391
to top
>emb|Y08734.1|XLHGFLP X.laevis mRNA for hepatocyte growth factor-like protein
          Length = 2764

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 115 acagctcaccgcagtgccctgaat 138
           |||||||||||||||||| |||||
Sbjct: 129 acagctcaccgcagtgccttgaat 152
to top
>emb|AL929087.4| Zebrafish DNA sequence from clone CH211-226M16 in linkage group 23
              Contains three novel genes and a CpG island, complete
              sequence
          Length = 205160

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 387    cattcaattttttcccttca 406
              ||||||||||||||||||||
Sbjct: 183245 cattcaattttttcccttca 183226
to top
>gb|AF527374.1| Tricholoma caligatum DAVFP 26217 internal transcribed spacer 1,
            partial sequence; 5.8S ribosomal RNA gene and internal
            transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 1217

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 233  atccaccagtcaaaattgat 252
            ||||||||||||||||||||
Sbjct: 1055 atccaccagtcaaaattgat 1036
to top
>gb|AF527373.1| Tricholoma caligatum DAVFP 26219 18S ribosomal RNA gene, partial
            sequence; internal transcribed spacer 1, 5.8S ribosomal
            RNA gene and internal transcribed spacer 2, complete
            sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 1338

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 233  atccaccagtcaaaattgat 252
            ||||||||||||||||||||
Sbjct: 1178 atccaccagtcaaaattgat 1159
to top
>gb|AF527372.1| Tricholoma caligatum DAVFP 26218 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 28S
           ribosomal RNA gene, partial sequence
          Length = 1108

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 945 atccaccagtcaaaattgat 926
to top
>gb|AY207223.1| Lepista nuda 28S large subunit ribosomal RNA gene, partial sequence
          Length = 1065

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 453 atccaccagtcaaaattgat 434
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 65      aatagtcaataatcaacaaaagaa 88
               |||||||||||||||| |||||||
Sbjct: 9390474 aatagtcaataatcaagaaaagaa 9390497
to top
>gb|AC011810.8|AC011810 Arabidopsis thaliana chromosome I BAC T6J4 genomic sequence, complete
             sequence
          Length = 103157

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   aaaaagagtcaaacatgaaa 187
             ||||||||||||||||||||
Sbjct: 77943 aaaaagagtcaaacatgaaa 77962
to top
>gb|AC027134.4|AC027134 Arabidopsis thaliana chromosome I BAC F13B4 genomic sequence, complete
             sequence
          Length = 102183

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   aaaaagagtcaaacatgaaa 187
             ||||||||||||||||||||
Sbjct: 30636 aaaaagagtcaaacatgaaa 30655
to top
>dbj|AP004683.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
            clone:P0006C08
          Length = 151987

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 65   aatagtcaataatcaacaaaagaa 88
            |||||||||||||||| |||||||
Sbjct: 4035 aatagtcaataatcaagaaaagaa 4058
to top
>dbj|AP005924.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0011J03
          Length = 176461

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 65     aatagtcaataatcaacaaaagaa 88
              |||||||||||||||| |||||||
Sbjct: 150728 aatagtcaataatcaagaaaagaa 150751
to top
>gb|DQ341897.1| Uncultured basidiomycete clone 126a_01 KBS-LTER large subunit
           ribosomal RNA gene, partial sequence
          Length = 634

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 518 atccaccagtcaaaattgat 499
to top
>gb|AF139963.1|AF139963 Lepista nuda 5.8S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 2, complete sequence; and 25S
           ribosomal RNA gene, partial sequence
          Length = 1329

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 858 atccaccagtcaaaattgat 839
to top
>emb|CT571247.13| Mouse DNA sequence from clone RP24-116C19 on chromosome 17, complete
             sequence
          Length = 137161

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   ctcacaagcatgatggtagg 288
             ||||||||||||||||||||
Sbjct: 60092 ctcacaagcatgatggtagg 60111
to top
>gb|DQ071713.1| Lepista nuda 28S large subunit ribosomal RNA gene, partial sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 453 atccaccagtcaaaattgat 434
to top
>gb|AY462040.1| Tricholoma sulphureum voucher TUB011629 28S ribosomal RNA gene,
           partial sequence
          Length = 789

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 480 atccaccagtcaaaattgat 461
to top
>gb|AY462031.1| Tricholoma bufonium voucher P62 AQUI 28S ribosomal RNA gene,
           partial sequence
          Length = 789

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 480 atccaccagtcaaaattgat 461
to top
>gb|AY462028.1| Uncultured ectomycorrhiza (Tricholoma) 28S ribosomal RNA gene,
           partial sequence
          Length = 624

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 491 atccaccagtcaaaattgat 472
to top
>dbj|AB231882.1| Scolionema suvaense gene for zinc finger protein Ssu-Zic, complete cds
          Length = 46150

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 93    aaactgtaatagtaacagtt 112
             ||||||||||||||||||||
Sbjct: 43383 aaactgtaatagtaacagtt 43364
to top
>gb|U76463.1|TVU76463 Tricholoma venenatum 25S ribosomal RNA gene, partial sequence
          Length = 1430

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 493 atccaccagtcaaaattgat 474
to top
>gb|U76461.1|TVU76461 Tricholoma vernaticum 25S ribosomal RNA gene, partial sequence
          Length = 1394

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 489 atccaccagtcaaaattgat 470
to top
>gb|U76462.1|TPU76462 Tricholoma pardinum 25S ribosomal RNA gene, partial sequence
          Length = 1438

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 233 atccaccagtcaaaattgat 252
           ||||||||||||||||||||
Sbjct: 491 atccaccagtcaaaattgat 472
to top
>gb|AC171733.1| Lycopersicon esculentum chromosome 11 clone C11HBa0034I10, complete
             sequence
          Length = 95704

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 343   ccattgatatgaacattccttcaa 366
             |||||||||||||||| |||||||
Sbjct: 26053 ccattgatatgaacataccttcaa 26076
to top
>emb|AL627125.8| Mouse DNA sequence from clone RP23-466N19 on chromosome 4, complete
              sequence
          Length = 179068

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 316    aattttgccagagatttata 335
              ||||||||||||||||||||
Sbjct: 153374 aattttgccagagatttata 153355


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,477,273
Number of Sequences: 3902068
Number of extensions: 4477273
Number of successful extensions: 85490
Number of sequences better than 10.0: 46
Number of HSP's better than 10.0 without gapping: 46
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85396
Number of HSP's gapped (non-prelim): 94
length of query: 424
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 402
effective length of database: 17,147,199,772
effective search space: 6893174308344
effective search space used: 6893174308344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top