Clone Information

BLAST Search Result

Clone Name	rbast03h12
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	381	e-102
2	dbj\|AP003270.4\| Oryza sativa (japonica cultivar-group) genomic D...	381	e-102
3	dbj\|AK108078.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	381	e-102
4	ref\|NM_190750.1\| Oryza sativa (japonica cultivar-group), predic...	377	e-101
5	ref\|XM_475315.1\| Oryza sativa (japonica cultivar-group), predic...	369	5e-99
6	gb\|AC134930.2\| Oryza sativa (japonica cultivar-group) chromosome...	369	5e-99
7	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	369	5e-99
8	dbj\|AK120955.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	369	5e-99
9	gb\|M36658.1\|MZEH3A Corn histone H3 (H3C3) gene, complete cds	333	3e-88
10	gb\|BT018930.1\| Zea mays clone Contig60.F mRNA sequence	327	2e-86
11	gb\|AC134048.3\| Oryza sativa (japonica cultivar-group) chromosome...	327	2e-86
12	gb\|AC112209.4\| Oryza sativa (japonica cultivar-group) chromosome...	327	2e-86
13	emb\|X13680.1\|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2	327	2e-86
14	dbj\|AP008217.1\| Oryza sativa (japonica cultivar-group) genomic D...	327	2e-86
15	gb\|DP000010.1\| Oryza sativa (japonica cultivar-group) chromosome...	327	2e-86
16	gb\|U77296.1\|OSU77296 Oryza sativa histone 3 mRNA, complete cds	327	2e-86
17	emb\|X84377.1\|ZMHIS3DNA Z.mays histone H3 gene	327	2e-86
18	emb\|X00937.1\|TAHI02 Wheat histone H3 gene	319	4e-84
19	ref\|NM_185612.1\| Oryza sativa (japonica cultivar-group), predic...	311	1e-81
20	gb\|BT017805.1\| Zea mays clone EL01N0506E02.c mRNA sequence	311	1e-81
21	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	311	1e-81
22	dbj\|AP005828.2\| Oryza sativa (japonica cultivar-group) genomic D...	311	1e-81
23	dbj\|AB026295.2\| Oryza sativa (japonica cultivar-group) genomic D...	311	1e-81
24	gb\|BT018950.1\| Zea mays clone Contig110.F mRNA sequence	305	6e-80
25	emb\|X02218.1\|GGHIS1 Chicken duplicated genes for histone H2A, H4...	305	6e-80
26	ref\|XM_493701.1\| Oryza sativa (japonica cultivar-group), mRNA	303	2e-79
27	ref\|NM_185609.1\| Oryza sativa (japonica cultivar-group), predic...	303	2e-79
28	dbj\|AP000559.1\| Oryza sativa (japonica cultivar-group) genomic D...	303	2e-79
29	gb\|AF093633.1\|AF093633 Oryza sativa histone H3 mRNA, complete cds	303	2e-79
30	emb\|X13679.1\|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12	303	2e-79
31	gb\|M34928.1\|BLYHISH3PA Barley histone H3 mRNA, 3' end	303	2e-79
32	ref\|XM_545420.2\| PREDICTED: Canis familiaris similar to histone ...	301	9e-79
33	ref\|XM_472456.1\| Oryza sativa (japonica cultivar-group), predic...	299	4e-78
34	ref\|XM_854155.1\| PREDICTED: Canis familiaris similar to histone ...	299	4e-78
35	ref\|XM_537880.2\| PREDICTED: Canis familiaris similar to histone ...	299	4e-78
36	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	299	4e-78
37	emb\|AL606618.4\|OSJN00062 Oryza sativa genomic DNA, chromosome 4,...	299	4e-78
38	ref\|XM_416193.1\| PREDICTED: Gallus gallus similar to histone pro...	297	1e-77
39	ref\|XM_849194.1\| PREDICTED: Canis familiaris similar to histone ...	297	1e-77
40	ref\|XM_545399.1\| PREDICTED: Canis familiaris similar to histone ...	297	1e-77
41	ref\|XM_545397.2\| PREDICTED: Canis familiaris similar to histone ...	297	1e-77
42	ref\|XM_848782.1\| PREDICTED: Canis familiaris similar to histone ...	297	1e-77
43	ref\|XM_545429.1\| PREDICTED: Canis familiaris similar to histone ...	297	1e-77
44	ref\|XM_545385.1\| PREDICTED: Canis familiaris similar to histone ...	297	1e-77
45	ref\|NM_185607.1\| Oryza sativa (japonica cultivar-group), predic...	295	6e-77
46	emb\|X13678.1\|OSHIS311 Oryza sativa H3 histone gene H3R-11	295	6e-77
47	dbj\|AB205017.1\| Lolium multiflorum gene for replacement histone ...	293	2e-76
48	ref\|XM_848810.1\| PREDICTED: Canis familiaris similar to histone ...	291	9e-76
49	gb\|M35388.1\|MZEHISH3A Zea mays histone H3 gene, complete cds	289	4e-75
50	gb\|M13378.1\|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), com...	289	4e-75
51	ref\|NM_185613.1\| Oryza sativa (japonica cultivar-group), predic...	287	1e-74
52	ref\|XM_425464.1\| PREDICTED: Gallus gallus similar to histone pro...	287	1e-74
53	ref\|XM_416198.1\| PREDICTED: Gallus gallus similar to GLP_39_8822...	287	1e-74
54	ref\|XM_416190.1\| PREDICTED: Gallus gallus similar to GLP_39_8822...	287	1e-74
55	emb\|X14732.1\|CMHIST34 Duck H3 and H4 histone genes	287	1e-74
56	emb\|CR390239.1\| Gallus gallus finished cDNA, clone ChEST932d15	287	1e-74
57	emb\|X62291.1\|GGHISH3IV G.gallus gene for histone H3-IV	287	1e-74
58	gb\|U37579.1\|GGU37579 Gallus gallus histone H3-VIII gene, complet...	287	1e-74
59	gb\|U37577.1\|GGU37577 Gallus gallus histone H3-VI gene, complete cds	287	1e-74
60	gb\|M61154.1\|CHKH3AA Chicken histone H3 gene, complete cds	287	1e-74
61	ref\|XM_545428.1\| PREDICTED: Canis familiaris similar to histone ...	285	6e-74
62	ref\|XM_870218.1\| PREDICTED: Bos taurus similar to histone 1, H2a...	281	9e-73
63	ref\|XM_599846.2\| PREDICTED: Bos taurus similar to histone 1, H2a...	281	9e-73
64	ref\|XM_416186.1\| PREDICTED: Gallus gallus similar to GLP_39_8822...	280	3e-72
65	emb\|X62292.1\|GGHISH3V G.gallus gene for histone H3-V	280	3e-72
66	gb\|U37578.1\|GGU37578 Gallus gallus histone H3-VII gene, complete...	280	3e-72
67	gb\|U25664.1\|OSU25664 Oryza sativa histone H3 gene, complete cds	280	3e-72
68	gb\|M61155.1\|CHKH3AB Chicken histone H3 gene, complete cds	280	3e-72
69	gb\|M15664.1\|RICHIS3 Rice histone 3 gene, complete cds	280	3e-72
70	ref\|XM_871261.1\| PREDICTED: Bos taurus similar to histone 1, H2a...	274	2e-70
71	ref\|XM_591827.2\| PREDICTED: Bos taurus similar to histone 1, H2a...	274	2e-70
72	emb\|X79714.1\|LTMRHIS3 L.temulentum mRNA for histone H3	272	8e-70
73	gb\|U38423.1\|TAU38423 Triticum aestivum histone H3 gene, partial ...	268	1e-68
74	ref\|XM_601510.2\| PREDICTED: Bos taurus similar to histone 1, H2a...	266	5e-68
75	ref\|NM_178206.2\| Mus musculus histone 1, H3h (Hist1h3h), mRNA	266	5e-68
76	ref\|XM_540290.1\| PREDICTED: Canis familiaris similar to H3 histo...	266	5e-68
77	ref\|XM_540285.1\| PREDICTED: Canis familiaris similar to H3 histo...	266	5e-68
78	ref\|XM_845651.1\| PREDICTED: Canis familiaris similar to CG31613-...	266	5e-68
79	emb\|AL589651.8\| Mouse DNA sequence from clone RP23-138F20 on chr...	266	5e-68
80	gb\|AY158944.1\| Mus musculus histone protein Hist1h3h gene, compl...	266	5e-68
81	gb\|M32462.1\|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds	266	5e-68
82	ref\|XM_590015.2\| PREDICTED: Bos taurus similar to histone 1, H2a...	258	1e-65
83	ref\|NM_145073.2\| Mus musculus histone 1, H3g (Hist1h3g), mRNA	258	1e-65
84	gb\|AC034285.6\| Mus musculus chromosome 13, clone RP23-220G21, co...	258	1e-65
85	emb\|AL592149.8\| Mouse DNA sequence from clone RP23-283N14 on chr...	258	1e-65
86	gb\|AY158946.1\| Mus musculus histone protein Hist1h3g gene, compl...	258	1e-65
87	ref\|XM_848995.1\| PREDICTED: Canis familiaris similar to histone ...	256	5e-65
88	gb\|BT018179.1\| Zea mays clone EL01N0557G06.c mRNA sequence	254	2e-64
89	gb\|M13379.1\|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), com...	254	2e-64
90	gb\|U38422.1\|TAU38422 Triticum aestivum histone H3 gene, partial ...	252	8e-64
91	ref\|NM_175653.1\| Mus musculus histone1, H3c (Hist1h3c), mRNA	250	3e-63
92	ref\|XM_871299.1\| PREDICTED: Bos taurus similar to histone 1, H2a...	250	3e-63
93	ref\|XM_865002.1\| PREDICTED: Bos taurus similar to histone 1, H2a...	250	3e-63
94	ref\|XM_870476.1\| PREDICTED: Bos taurus similar to histone 1, H2a...	250	3e-63
95	gb\|AY125231.1\| Melanoplus sp. OR18 histone 3 gene, partial cds	250	3e-63
96	emb\|X80328.1\|MMH2B143 M.musculus genes H2b-143, H3-143	250	3e-63
97	emb\|AL590388.4\| Mouse DNA sequence from clone RP23-480B19 on chr...	250	3e-63
98	gb\|AY158950.1\| Mus musculus histone protein Hist1h3c gene, compl...	250	3e-63
99	ref\|NM_178216.1\| Mus musculus histone 2, H3c1 (Hist2h3c1), trans...	248	1e-62
100	gb\|BC080809.1\| Mus musculus cDNA clone IMAGE:6466339	248	1e-62
101	ref\|XM_886396.1\| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h...	248	1e-62
102	emb\|X80330.1\|CLH2A232 C.longicaudatus genes for histones H2a.2 a...	248	1e-62
103	dbj\|AK134918.1\| Mus musculus adult male olfactory brain cDNA, RI...	248	1e-62
104	gb\|U62675.1\|MMU62675 Mus musculus histone H3.2-616 (H3-616), and...	248	1e-62
105	gb\|U62674.1\|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ...	248	1e-62
106	ref\|NG_002616.1\| Homo sapiens histone 2, H3b (HIST2H3B) pseudoge...	248	1e-62
107	gb\|BC094041.1\| Mus musculus histone 2, H3c1, mRNA (cDNA clone MG...	248	1e-62
108	gb\|AF531306.1\| Homo sapiens histone H3 (HIST2H3B) pseudogene, co...	248	1e-62
109	ref\|XM_227461.2\| PREDICTED: Rattus norvegicus similar to histone...	248	1e-62
110	gb\|AY158955.1\| Mus musculus histone protein Hist2h3b gene, compl...	248	1e-62
111	gb\|AY158954.1\| Mus musculus histone protein Hist2h3c1 gene, comp...	248	1e-62
112	gb\|AY158941.1\| Mus musculus histone protein Hist2h2bb gene, comp...	248	1e-62
113	gb\|AC093350.15\| Mus musculus chromosome 3, clone RP23-16G3, comp...	248	1e-62
114	gb\|AC125099.3\| Mus musculus BAC clone RP24-201C14 from 3, comple...	248	1e-62
115	ref\|NM_178215.1\| Mus musculus histone 2, H3b (Hist2h3b), mRNA	248	1e-62
116	emb\|Y08528.1\|OSHISTON3 Oryza sativa mRNA for histone 3	248	1e-62
117	gb\|M32461.1\|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds	248	1e-62
118	ref\|XM_603864.2\| PREDICTED: Bos taurus similar to histone 1, H2a...	244	2e-61
119	gb\|BT016934.1\| Zea mays clone E04912703G10.c mRNA sequence	242	7e-61
120	emb\|X80327.1\|MPMP323 M.pahari genes mpH323 and mph2a23	242	7e-61
121	emb\|X80325.1\|MPMPH315 M.pahari mpH315 gene	242	7e-61
122	gb\|BC015270.1\| Mus musculus histone 2, H3c2, mRNA (cDNA clone MG...	240	3e-60
123	ref\|NM_054045.2\| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA	240	3e-60
124	gb\|DQ393956.1\| Cydia pomonella clone Cp4.140 microsatellite sequ...	240	3e-60
125	gb\|DQ393939.1\| Cydia pomonella clone Cp4.P microsatellite sequence	240	3e-60
126	gb\|DQ393935.1\| Cydia pomonella clone Cp4.118 microsatellite sequ...	240	3e-60
127	gb\|DQ393934.1\| Cydia pomonella clone Cp4.100 microsatellite sequ...	240	3e-60
128	ref\|XM_227460.3\| PREDICTED: Rattus norvegicus histone 2, H3c2 (p...	240	3e-60
129	gb\|AC151366.3\| Aotus nancymaae clone CH258-105B22, complete sequ...	236	5e-59
130	ref\|XM_868935.1\| PREDICTED: Bos taurus similar to histone 1, H2a...	236	5e-59
131	gb\|BT017332.1\| Zea mays clone EL01N0320H03.c mRNA sequence	234	2e-58
132	emb\|CR716243.2\|CNS0GFLO Tetraodon nigroviridis full-length cDNA	234	2e-58
133	gb\|AY125229.1\| Argia vivida histone 3 gene, partial cds	234	2e-58
134	ref\|NM_019469.1\| Mus musculus histone 2, H3c1 (Hist2h3c1), trans...	232	7e-58
135	emb\|X16148.1\|MMHIS2A3 Mouse H2a and H3 histone genes	232	7e-58
136	gb\|DQ393931.1\| Cydia pomonella clone Cp4.61 microsatellite sequence	232	7e-58
137	gb\|M14396.1\|CIIHISH3A Duck H3.4 variant histone gene	230	3e-57
138	gb\|L19706.1\| Rattus norvegicus H3 histone gene, complete cds	226	4e-56
139	ref\|XM_871486.1\| PREDICTED: Bos taurus similar to H3 histone, fa...	226	4e-56
140	ref\|XM_871460.1\| PREDICTED: Bos taurus similar to H3 histone, fa...	226	4e-56
141	ref\|XM_868913.1\| PREDICTED: Bos taurus similar to histone 1, H2a...	226	4e-56
142	ref\|XM_866756.1\| PREDICTED: Bos taurus similar to H3 histone, fa...	226	4e-56
143	ref\|XM_866686.1\| PREDICTED: Bos taurus similar to H3 histone, fa...	226	4e-56
144	ref\|NM_001013056.1\| Rattus norvegicus histone 1, H2ai (predicted...	226	4e-56
145	gb\|U16725.1\|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	226	4e-56
146	gb\|AY749753.1\| Diphlebia coerulescens histone H3 (H3) gene, part...	226	4e-56
147	ref\|XM_524859.1\| PREDICTED: Pan troglodytes LOC469476 (LOC469476...	224	2e-55
148	emb\|AL591493.14\| Human DNA sequence from clone RP11-196G18 on ch...	224	2e-55
149	ref\|XM_497711.2\| PREDICTED: Homo sapiens similar to H3 histone, ...	224	2e-55
150	gb\|U38420.1\|HVU38420 Hordeum vulgare histone H3 gene, partial cd...	220	3e-54
151	ref\|XM_527604.1\| PREDICTED: Pan troglodytes similar to histone 1...	218	1e-53
152	gb\|AY125232.1\| Pterophylla camellifolia histone 3 gene, partial cds	218	1e-53
153	gb\|U16825.1\|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I...	218	1e-53
154	gb\|AY749737.1\| Platybaetis probus histone H3 (H3) gene, partial cds	218	1e-53
155	gb\|AY749708.1\| Baetis tricaudatus histone H3 (H3) gene, partial cds	218	1e-53
156	gb\|AY749705.1\| Choroterpes sp. EP024 histone H3 (H3) gene, parti...	218	1e-53
157	ref\|NM_021059.2\| Homo sapiens histone 2, H3c (HIST2H3C), mRNA	210	3e-51
158	gb\|AY648851.1\| Homo sapiens histone H3/o gene, complete cds	210	3e-51
159	gb\|BC067492.1\| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC...	210	3e-51
160	ref\|XM_580747.2\| PREDICTED: Bos taurus similar to CG31613-PA (LO...	210	3e-51
161	ref\|NG_001335.1\| Homo sapiens genomic large histone family clust...	210	3e-51
162	gb\|AF531279.1\| Homo sapiens histone H3 (HIST1H3F) gene, complete...	210	3e-51
163	gb\|BC063540.1\| Homo sapiens cDNA clone IMAGE:4523373, **** WARNI...	210	3e-51
164	gb\|BC015544.1\| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMA...	210	3e-51
165	emb\|AL031777.5\|HS34B20 Human DNA sequence from clone RP1-34B20 o...	210	3e-51
166	gb\|BC096131.1\| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC...	210	3e-51
167	ref\|NM_021018.2\| Homo sapiens histone 1, H3f (HIST1H3F), mRNA	210	3e-51
168	ref\|XM_928391.1\| PREDICTED: Homo sapiens similar to CG31613-PA (...	210	3e-51
169	emb\|CR542011.1\| Homo sapiens full open reading frame cDNA clone ...	210	3e-51
170	emb\|CR541983.1\| Homo sapiens full open reading frame cDNA clone ...	210	3e-51
171	ref\|NG_002617.1\| Homo sapiens histone 2, H3a (HIST2H3A) pseudoge...	210	3e-51
172	ref\|NM_001005464.1\| Homo sapiens histone H3/o (H3/o), mRNA	210	3e-51
173	gb\|BC074969.2\| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE...	210	3e-51
174	gb\|AF531307.1\| Homo sapiens histone H3 (HIST2H3C) gene, complete...	210	3e-51
175	gb\|AF531305.1\| Homo sapiens histone H3 (HIST2H3A) pseudogene, co...	210	3e-51
176	gb\|BC069818.1\| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC...	210	3e-51
177	emb\|CR760429.2\| Xenopus tropicalis finished cDNA, clone TNeu057j11	210	3e-51
178	emb\|AL662809.14\| Mouse DNA sequence from clone RP23-441I8 on chr...	210	3e-51
179	gb\|U16724.1\|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	210	3e-51
180	gb\|AY749755.1\| Griseargiolestes albescens histone H3 (H3) gene, ...	210	3e-51
181	gb\|AY749744.1\| Dipteromimus sp. EP150 histone H3 (H3) gene, part...	210	3e-51
182	gb\|AY749743.1\| Ichthybotus hudsoni histone H3 (H3) gene, partial...	210	3e-51
183	emb\|Z80786.1\|HSH3I H.sapiens H3/i gene	210	3e-51
184	ref\|XM_356549.3\| PREDICTED: Mus musculus similar to histone 1, H...	208	1e-50
185	gb\|AF517884.1\| Griffithsia japonica isolate Gj475 histone H3.3 p...	208	1e-50
186	gb\|AY521721.1\| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) ge...	208	1e-50
187	gb\|AY749703.1\| Callibaetis sp. EP020 histone H3 (H3) gene, parti...	206	4e-50
188	gb\|BC062305.1\| Homo sapiens cDNA clone IMAGE:3162462	204	2e-49
189	gb\|BC007518.2\| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	204	2e-49
190	ref\|NG_000009.2\| Homo sapiens small histone family cluster (HFS@...	204	2e-49
191	ref\|NM_003536.2\| Homo sapiens histone 1, H3h (HIST1H3H), mRNA	204	2e-49
192	gb\|AF531281.1\| Homo sapiens histone H3 (HIST1H3H) gene, complete...	204	2e-49
193	emb\|AL009179.1\|HS97D16 Human DNA sequence from clone RP1-97D16 o...	204	2e-49
194	gb\|BC096130.1\| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	204	2e-49
195	gb\|BC096128.1\| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	204	2e-49
196	gb\|BC096129.1\| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC...	204	2e-49
197	emb\|Z83735.1\|HSZ83735 H.sapiens hH3/k gene	204	2e-49
198	ref\|XM_782287.1\| PREDICTED: Strongylocentrotus purpuratus simila...	202	6e-49
199	emb\|CR541858.1\| Homo sapiens full open reading frame cDNA clone ...	202	6e-49
200	gb\|AY923964.1\| Phenacolepas osculans isolate PHE1 histone H3 (H3...	202	6e-49
201	gb\|AY338626.1\| Coloburiscus humeralis histone 3 gene, partial cds	202	6e-49
202	gb\|AY749709.1\| Mystaxiops venatoris histone H3 (H3) gene, partia...	202	6e-49
203	gb\|AY749701.1\| Paraleptophlebia vaciva histone H3 (H3) gene, par...	202	6e-49
204	ref\|XM_905850.2\| PREDICTED: Mus musculus similar to histone 1, H...	200	3e-48
205	gb\|AY521731.1\| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene,...	200	3e-48
206	ref\|XM_560604.1\| Anopheles gambiae str. PEST ENSANGP00000025641 ...	200	3e-48
207	ref\|XM_318362.1\| Anopheles gambiae str. PEST ENSANGP00000016005 ...	200	3e-48
208	ref\|XM_307081.1\| Anopheles gambiae str. PEST ENSANGP00000001387 ...	200	3e-48
209	ref\|XM_305996.1\| Anopheles gambiae str. PEST ENSANGP00000012784 ...	200	3e-48
210	gb\|AY338621.1\| Metretopus borealis histone 3 gene, partial cds	200	3e-48
211	gb\|AY338619.1\| Baetis sp. Eph11 histone 3 gene, partial cds	200	3e-48
212	gb\|AF140033.1\|AF140033 Phreatamoeba balamuthi histone H3 mRNA, c...	198	1e-47
213	ref\|XM_610495.1\| PREDICTED: Bos taurus similar to CG31613-PA (LO...	194	2e-46
214	emb\|X03018.1\|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	194	2e-46
215	gb\|AY521728.1\| Aphanicerca capensis voucher BYU_ACPL028 histone ...	194	2e-46
216	ref\|XM_314445.2\| Anopheles gambiae str. PEST ENSANGP00000016056 ...	194	2e-46
217	gb\|AY749738.1\| Jubabaetis sp. EP139 histone H3 (H3) gene, partia...	194	2e-46
218	gb\|AY749723.1\| Siphlaenigma janae histone H3 (H3) gene, partial cds	194	2e-46
219	gb\|AY749713.1\| Penaphlebia sp. EP076 histone H3 (H3) gene, parti...	194	2e-46
220	gb\|M21287.1\|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	194	2e-46
221	emb\|Z46261.1\|HSHISH3A H.sapiens DNA for histone H3a	194	2e-46
222	ref\|XM_518299.1\| PREDICTED: Pan troglodytes similar to Histone H...	192	6e-46
223	emb\|AL109948.9\|HSJ998N21 Human DNA sequence from clone RP5-998N2...	192	6e-46
224	ref\|NM_001025303.1\| Homo sapiens similar to histone H2B histone ...	192	6e-46
225	ref\|XM_307606.1\| Anopheles gambiae str. PEST ENSANGP00000016172 ...	192	6e-46
226	gb\|AY555567.1\| Heterojapyx sp. GG-2001 histone H3 gene, partial cds	192	6e-46
227	gb\|AY749740.1\| Isonychia sp. EP142 histone H3 (H3) gene, partial...	192	6e-46
228	gb\|BC069079.1\| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:...	188	1e-44
229	emb\|AL139288.15\| Human DNA sequence from clone RP5-915N17 on chr...	188	1e-44
230	emb\|X06963.1\|VCHIS34 Volvox carteri H3-I and H4-I genes for hist...	188	1e-44
231	emb\|Z49861.1\|HS2132H3 H.sapiens gene for histone H3	188	1e-44
232	ref\|NM_003493.2\| Homo sapiens histone 3, H3 (HIST3H3), mRNA	188	1e-44
233	gb\|DQ284391.1\| Scaphiophryne marmorata histone H3a gene, partial...	188	1e-44
234	gb\|AF531308.1\| Homo sapiens histone H3 (HIST3H3) gene, complete cds	188	1e-44
235	gb\|AY923963.1\| Nerita polita isolate NR2 histone H3 (H3) gene, p...	188	1e-44
236	gb\|AY662898.1\| Paretroplus cf. kieneri 'Amboaboa' histone H3a ge...	188	1e-44
237	gb\|BC101837.1\| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:...	188	1e-44
238	gb\|BC101839.1\| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:...	188	1e-44
239	gb\|AY181030.1\| Toxoplasma gondii histone H3 mRNA, complete cds	186	4e-44
240	emb\|X95625.1\|NPHISTOH3 N.pseudonarcissus mRNA for histone H3	186	4e-44
241	dbj\|AB195975.1\| Lilium longiflorum YAH3 mRNA for histone H3, com...	186	4e-44
242	gb\|AY338642.1\| Malenka californica histone 3 gene, partial cds	186	4e-44
243	gb\|AY749729.1\| Edmundsius agilis histone H3 (H3) gene, partial cds	186	4e-44
244	gb\|AY749702.1\| Thraulodes sp. EP014 histone H3 (H3) gene, partia...	186	4e-44
245	gb\|AY669068.1\| Chaetomium globosum histone H3 mRNA, complete cds	184	2e-43
246	ref\|XM_950910.1\| Neurospora crassa OR74A HISTONE H3 (NCU01635.1)...	184	2e-43
247	ref\|XM_328073.1\| Neurospora crassa OR74A HISTONE H3 (NCU01635.1)...	184	2e-43
248	gb\|AY662905.1\| Paretroplus sp. 'Kamoro' histone H3a gene, partia...	184	2e-43
249	gb\|AY338638.1\| Hetaerina americana histone 3 gene, partial cds	184	2e-43
250	gb\|AY338636.1\| Calopteryx aequabilis histone 3 gene, partial cds	184	2e-43
251	gb\|AY749746.1\| Proboscidoplocia sp. EP162 histone H3 (H3) gene, ...	184	2e-43
252	gb\|DQ284249.1\| Iguana iguana histone H3a gene, partial cds	182	6e-43
253	gb\|AY749714.1\| Meridialaris diguillina histone H3 (H3) gene, par...	182	6e-43
254	gb\|DQ028083.1\| Lota lota histone H3 gene, partial cds	180	2e-42
255	ref\|XM_518888.1\| PREDICTED: Pan troglodytes similar to histone 1...	180	2e-42
256	gb\|BC052981.1\| Homo sapiens histone 1, H3e, mRNA (cDNA clone MGC...	180	2e-42
257	ref\|NM_003532.2\| Homo sapiens histone 1, H3e (HIST1H3E), mRNA	180	2e-42
258	gb\|AF531278.1\| Homo sapiens histone H3 (HIST1H3E) gene, complete...	180	2e-42
259	gb\|AY125233.1\| Isoperla davisi histone 3 gene, partial cds	180	2e-42
260	gb\|DQ284420.1\| Pleurodeles waltl histone H3a gene, partial cds	180	2e-42
261	gb\|DQ284377.1\| Rana guentheri histone H3a gene, partial cds	180	2e-42
262	gb\|DQ284287.1\| Rana guentheri histone H3a gene, partial cds	180	2e-42
263	gb\|DQ284223.1\| Rana aurora histone H3a gene, partial cds	180	2e-42
264	gb\|DQ284219.1\| Rana clamitans histone H3a gene, partial cds	180	2e-42
265	gb\|DQ284180.1\| Staurois tuberilinguis histone H3a gene, partial cds	180	2e-42
266	gb\|DQ284177.1\| Rana japonica histone H3a gene, partial cds	180	2e-42
267	gb\|DQ284168.1\| Pseudoamolops sauteri histone H3a gene, partial cds	180	2e-42
268	gb\|DQ284081.1\| Leptobrachium chapaense histone H3a gene, partial...	180	2e-42
269	emb\|CR542014.1\| Homo sapiens full open reading frame cDNA clone ...	180	2e-42
270	emb\|CR542013.1\| Homo sapiens full open reading frame cDNA clone ...	180	2e-42
271	dbj\|AP008218.1\| Oryza sativa (japonica cultivar-group) genomic D...	180	2e-42
272	gb\|AY894086.1\| Synthetic construct Homo sapiens clone FLH131254....	180	2e-42
273	gb\|AY662912.1\| Paratilapia sp. 'Ifasy' histone H3a gene, partial...	180	2e-42
274	gb\|AY662897.1\| Paretroplus cf. kieneri 'Ravelobe' histone H3a ge...	180	2e-42
275	gb\|AY662895.1\| Paretroplus kieneri 'Kinkony' histone H3a gene, p...	180	2e-42
276	gb\|AY662892.1\| Etroplus maculatus histone H3a gene, partial cds	180	2e-42
277	gb\|AY539218.1\| Hoplichthys citrinus histone H3 gene, partial cds	180	2e-42
278	gb\|DP000011.1\| Oryza sativa (japonica cultivar-group) chromosome...	180	2e-42
279	emb\|AL844879.5\|CNS08CB2 Oryza sativa chromosome 12, . BAC OSJNBa...	180	2e-42
280	gb\|M60746.1\|HUMHISAA Human histone H3.1 (H1F3) gene, complete cds	180	2e-42
281	gb\|AY788897.1\| Mnais nawai histone 3 gene, partial cds	178	9e-42
282	gb\|AY125263.1\| Bacillus rossius histone 3 gene, partial cds	178	9e-42
283	gb\|AY125219.1\| Echinosoma sp. DM11 histone 3 gene, partial cds	178	9e-42
284	emb\|X00593.1\|LPH3H4 Lytechinus pictus H3 and H4 gene	178	9e-42
285	ref\|NM_001016636.3\| Xenopus tropicalis histone 2, H3c (hist1h3g)...	178	9e-42
286	gb\|AF370817.1\|AF370817 Locusta migratoria histone H3 gene, parti...	178	9e-42
287	ref\|XM_320336.2\| Anopheles gambiae str. PEST ENSANGP00000014197 ...	178	9e-42
288	emb\|CR855729.2\| Xenopus tropicalis finished cDNA, clone TGas081o10	178	9e-42
289	gb\|AY338635.1\| Chaquihua sp. EP080 histone 3 gene, partial cds	178	9e-42
290	gb\|AY749722.1\| Adenophlebia peringueyella histone H3 (H3) gene, ...	178	9e-42
291	gb\|BC090320.1\| Rattus norvegicus tripartite motif protein 17, mR...	176	4e-41
292	gb\|AY521713.1\| Tyrannophasma gladiator voucher BYU_ACMP002 histo...	176	4e-41
293	gb\|DQ284405.1\| Arthroleptis tanneri histone H3a gene, partial cds	176	4e-41
294	gb\|DQ284352.1\| Rana chapaensis histone H3a gene, partial cds	176	4e-41
295	gb\|DQ284224.1\| Rana muscosa histone H3a gene, partial cds	176	4e-41
296	dbj\|AB185026.1\| Conocephalum conicum H3 gene for histone 3, comp...	176	4e-41
297	dbj\|AB185023.1\| Conocephalum conicum H3 gene for histone 3, comp...	176	4e-41
298	gb\|AY662911.1\| Paratilapia sp. 'East' histone H3a gene, partial cds	176	4e-41
299	gb\|AY662908.1\| Paratilapia cf. bleekeri JSS-2004 histone H3a gen...	176	4e-41
300	gb\|AY662904.1\| Paretroplus tsimoly histone H3a gene, partial cds	176	4e-41
301	gb\|AY662902.1\| Paretroplus nourissati histone H3a gene, partial cds	176	4e-41
302	gb\|AY662901.1\| Paretroplus menarambo histone H3a gene, partial cds	176	4e-41
303	gb\|AY539178.1\| Menidia menidia histone H3 gene, partial cds	176	4e-41
304	gb\|J00869.1\|CHKH3A Chicken histone H3 gene (intronless)	176	4e-41
305	dbj\|AB185035.1\| Conocephalum supradecompositum H3 gene for histo...	174	1e-40
306	gb\|AY752255.1\| Davidiella tassiana strain ATCC 66670 histone H3 ...	172	6e-40
307	gb\|AY655588.1\| Menidia menidia histone H3a gene, partial cds	172	6e-40
308	emb\|X53330.1\|PDHISTCL P.dumerilii histone gene cluster for core ...	172	6e-40
309	emb\|AL670001.1\|NCB14H13 Neurospora crassa DNA linkage group II B...	172	6e-40
310	emb\|AL670543.1\|NCB7K22 Neurospora crassa DNA linkage group II BA...	172	6e-40
311	gb\|DQ284424.1\| Tachycnemis seychellensis histone H3a gene, parti...	172	6e-40
312	gb\|DQ284422.1\| Heterixalus sp. UMMZ 219330 histone H3a gene, par...	172	6e-40
313	gb\|DQ284421.1\| Pachytriton brevipes histone H3a gene, partial cds	172	6e-40
314	gb\|DQ284413.1\| Kassina senegalensis histone H3a gene, partial cds	172	6e-40
315	gb\|DQ284397.1\| Breviceps mossambicus histone H3a gene, partial cds	172	6e-40
316	gb\|DQ284381.1\| Hyperolius tuberilinguis histone H3a gene, partia...	172	6e-40
317	gb\|DQ284375.1\| Hyperolius puncticulatus histone H3a gene, partia...	172	6e-40
318	gb\|DQ284359.1\| Rana maosonensis histone H3a gene, partial cds	172	6e-40
319	gb\|DQ284356.1\| Fejervarya limnocharis histone H3a gene, partial cds	172	6e-40
320	gb\|DQ284351.1\| Leptodactylodon bicolor histone H3a gene, partial...	172	6e-40
321	gb\|DQ284348.1\| Cardioglossa leucomystax histone H3a gene, partia...	172	6e-40
322	gb\|DQ284343.1\| Phlyctimantis leonardi histone H3a gene, partial cds	172	6e-40
323	gb\|DQ284340.1\| Astylosternus schioetzi histone H3a gene, partial...	172	6e-40
324	gb\|DQ284336.1\| Opisthothylax immaculatus histone H3a gene, parti...	172	6e-40
325	gb\|DQ284335.1\| Trichobatrachus robustus histone H3a gene, partia...	172	6e-40
326	gb\|DQ284309.1\| Rana maculata histone H3a gene, partial cds	172	6e-40
327	gb\|DQ284267.1\| Rana grahami histone H3a gene, partial cds	172	6e-40
328	gb\|DQ284256.1\| Leptopelis argenteus histone H3a gene, partial cds	172	6e-40
329	gb\|DQ284255.1\| Hyperolius alticola histone H3a gene, partial cds	172	6e-40
330	gb\|DQ284245.1\| Rana johnsi histone H3a gene, partial cds	172	6e-40
331	gb\|DQ284242.1\| Batrachylodes vertebralis histone H3a gene, parti...	172	6e-40
332	gb\|DQ284213.1\| Cardioglossa gratiosa histone H3a gene, partial cds	172	6e-40
333	gb\|DQ284211.1\| Opisthothylax immaculatus histone H3a gene, parti...	172	6e-40
334	gb\|DQ284209.1\| Alexteroon obstetricans histone H3a gene, partial...	172	6e-40
335	gb\|DQ284208.1\| Cryptothylax greshoffii histone H3a gene, partial...	172	6e-40
336	gb\|DQ284199.1\| Leptopelis sp. AMNH A168408 histone H3a gene, par...	172	6e-40
337	gb\|DQ284185.1\| Chaperina fusca histone H3a gene, partial cds	172	6e-40
338	gb\|DQ284163.1\| Rana adenopleura histone H3a gene, partial cds	172	6e-40
339	gb\|DQ284132.1\| Cardioglossa leucomystax histone H3a gene, partia...	172	6e-40
340	gb\|DQ284094.1\| Synapturanus mirandaribeiroi histone H3a gene, pa...	172	6e-40
341	gb\|AY062173.1\| Neurospora crassa histone H3 (hh3) and histone H4...	172	6e-40
342	gb\|AY218163.1\| Echinorhynchus gadi histone H3 gene, partial cds	172	6e-40
343	gb\|AY662910.1\| Paratilapia polleni 'Ravelobe' histone H3a gene, ...	172	6e-40
344	gb\|AY662903.1\| Paretroplus polyactis 'South' histone H3a gene, p...	172	6e-40
345	gb\|AY662890.1\| Etroplus canarensis histone H3a gene, partial cds	172	6e-40
346	gb\|AY539266.1\| Haemulon plumieri histone H3 gene, partial cds	172	6e-40
347	gb\|AY539253.1\| Careproctus melanurus histone H3 gene, partial cds	172	6e-40
348	gb\|AY377764.1\| Helicoradomenia sp. AO-2003 histone H3 gene, part...	170	2e-39
349	gb\|DQ284374.1\| Bufo maculatus histone H3a gene, partial cds	170	2e-39
350	gb\|DQ284260.1\| Bufo andrewsi histone H3a gene, partial cds	170	2e-39
351	gb\|DQ284201.1\| Bufo regularis histone H3a gene, partial cds	170	2e-39
352	ref\|XM_694120.1\| PREDICTED: Danio rerio similar to CG31613-PA (L...	170	2e-39
353	ref\|XM_694088.1\| PREDICTED: Danio rerio similar to CG31613-PA (L...	170	2e-39
354	gb\|DQ028120.1\| Leiognathus sp. L9 histone H3 gene, partial cds	168	9e-39
355	gb\|DQ284393.1\| Stumpffia cf. psologlossa AMNH A167359 histone H3...	168	9e-39
356	gb\|DQ284390.1\| Plethodontohyla sp. AMNH A167315 histone H3a gene...	168	9e-39
357	gb\|DQ284325.1\| Thorius sp. JAC 21291 histone H3a gene, partial cds	168	9e-39
358	gb\|DQ284268.1\| Leptopelis vermiculatus histone H3a gene, partial...	168	9e-39
359	gb\|DQ284171.1\| Epicrionops sp. RAN 26114 histone H3a gene, parti...	168	9e-39
360	gb\|DQ284170.1\| Rana temporaria histone H3a gene, partial cds	168	9e-39
361	ref\|XM_694149.1\| PREDICTED: Danio rerio similar to CG31613-PA (L...	168	9e-39
362	gb\|AF404631.1\| Lewia infectoria isolate CR31 histone gene, parti...	168	9e-39
363	gb\|AY662925.1\| Apistogramma sp. JSS-2004 histone H3a gene, parti...	168	9e-39
364	gb\|AY662899.1\| Paretroplus maculatus histone H3a gene, partial cds	168	9e-39
365	gb\|AY662881.1\| Polycentropsis abbreviata histone H3a gene, parti...	168	9e-39
366	gb\|AY539267.1\| Kuhlia rupestris histone H3 gene, partial cds	168	9e-39
367	gb\|AY539247.1\| Xeneretmus latifrons histone H3 gene, partial cds	168	9e-39
368	gb\|AY338637.1\| Libellula saturata histone 3 gene, partial cds	168	9e-39
369	gb\|AF520775.1\| Hypocrea jecorina histone H3 gene, complete cds	167	4e-38
370	gb\|DQ284406.1\| Callulina kisiwamsitu histone H3a gene, partial cds	167	4e-38
371	gb\|DQ284054.1\| Boophis albilabris histone H3a gene, partial cds	167	4e-38
372	gb\|AY725673.1\| Cylindrocladium multiphialidicum strain CBS 11267...	165	1e-37
373	gb\|AY752254.1\| Cladosporium cladosporioides strain ATCC 66669 hi...	165	1e-37
374	gb\|AY655596.1\| Atherinomorus sp. Karianga histone H3a gene, part...	165	1e-37
375	gb\|AY655585.1\| Atherinella panamensis histone H3a gene, partial cds	165	1e-37
376	gb\|AY655583.1\| Teramulus waterloti histone H3a gene, partial cds	165	1e-37
377	gb\|DQ028156.1\| Secutor sp. L26 histone H3 gene, partial cds	165	1e-37
378	gb\|DQ028153.1\| Leiognathus lineolatus histone H3 gene, partial cds	165	1e-37
379	gb\|DQ028152.1\| Leiognathus leuciscus histone H3 gene, partial cds	165	1e-37
380	gb\|DQ028151.1\| Leiognathus leuciscus histone H3 gene, partial cds	165	1e-37
381	gb\|DQ028150.1\| Leiognathus leuciscus histone H3 gene, partial cds	165	1e-37
382	gb\|DQ028148.1\| Photoplagios sp. Madagascar histone H3 gene, part...	165	1e-37
383	gb\|DQ028139.1\| Leiognathus nuchalis histone H3 gene, partial cds	165	1e-37
384	gb\|DQ028134.1\| Leiognathus decorus histone H3 gene, partial cds	165	1e-37
385	gb\|DQ028131.1\| Leiognathus sp. Philippines histone H3 gene, part...	165	1e-37
386	gb\|DQ028126.1\| Leiognathus fasciatus isolate L36 histone H3 gene...	165	1e-37
387	gb\|DQ028124.1\| Leiognathus equulus histone H3 gene, partial cds	165	1e-37
388	gb\|DQ028114.1\| Leiognathus sp. Fiji histone H3 gene, partial cds	165	1e-37
389	gb\|DQ284411.1\| Dyscophus guineti histone H3a gene, partial cds	165	1e-37
390	gb\|DQ284382.1\| Afrixalus fornasini histone H3a gene, partial cds	165	1e-37
391	gb\|DQ284354.1\| Amnirana albilabris histone H3a gene, partial cds	165	1e-37
392	gb\|DQ284349.1\| Nyctibates corrugatus histone H3a gene, partial cds	165	1e-37
393	gb\|DQ284263.1\| Afrixalus pygmaeus histone H3a gene, partial cds	165	1e-37
394	gb\|DQ284237.1\| Sphenophryne sp. 989 histone H3a gene, partial cds	165	1e-37
395	gb\|DQ284187.1\| Meristogenys orphnocnemis histone H3a gene, parti...	165	1e-37
396	gb\|DQ284178.1\| Rana nigromaculata histone H3a gene, partial cds	165	1e-37
397	gb\|AY662931.1\| Dicrossus sp. JSS-2004 histone H3a gene, partial cds	165	1e-37
398	gb\|AY662926.1\| Astronotus ocellatus histone H3a gene, partial cds	165	1e-37
399	gb\|AY662894.1\| Paretroplus damii histone H3a gene, partial cds	165	1e-37
400	gb\|AY662893.1\| Paretroplus dambabe histone H3a gene, partial cds	165	1e-37
401	gb\|AY662883.1\| Cetoscarus bicolor histone H3a gene, partial cds	165	1e-37
402	gb\|AY539268.1\| Cirrhitus rivulatus histone H3 gene, partial cds	165	1e-37
403	gb\|AY539263.1\| Etheostoma blennioides histone H3 gene, partial cds	165	1e-37
404	gb\|AY749710.1\| Centroptilum luteolum histone H3 (H3) gene, parti...	165	1e-37
405	gb\|AY655576.1\| Marosatherina ladigesi histone H3a gene, partial cds	163	6e-37
406	gb\|DQ028119.1\| Leiognathus sp. L2 histone H3 gene, partial cds	163	6e-37
407	gb\|BC033095.1\| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC...	163	6e-37
408	gb\|BC031333.1\| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC...	163	6e-37
409	ref\|NM_003530.3\| Homo sapiens histone 1, H3d (HIST1H3D), mRNA	163	6e-37
410	gb\|AF531277.1\| Homo sapiens histone H3 (HIST1H3D) gene, complete...	163	6e-37
411	gb\|DQ284373.1\| Rana sylvatica histone H3a gene, partial cds	163	6e-37
412	gb\|DQ284368.1\| Ctenophryne geayi histone H3a gene, partial cds	163	6e-37
413	dbj\|AK097020.1\| Homo sapiens cDNA FLJ39701 fis, clone SMINT2011656	163	6e-37
414	gb\|AF361949.1\| Eimeria tenella histone 3 (H3) mRNA, complete cds	163	6e-37
415	gb\|DQ275318.1\| Graphoderus fascicollis voucher BYU KBMGrfa65 his...	163	6e-37
416	emb\|X16496.1\|MMHIST31 Murine H3.1 gene for histone H3.1	163	6e-37
417	gb\|AY749721.1\| Coloburiscoides sp. EP094 histone H3 (H3) gene, p...	163	6e-37
418	gb\|AY749707.1\| Leptophlebiidae sp. EP030 histone H3 (H3) gene, p...	163	6e-37
419	gb\|AY749699.1\| Epeorus longimanus histone H3 (H3) gene, partial cds	163	6e-37
420	gb\|DQ028161.1\| Secutor cf. insidiator JS-2005 histone H3 gene, p...	161	2e-36
421	gb\|DQ028160.1\| Secutor indicius histone H3 gene, partial cds	161	2e-36
422	gb\|DQ028159.1\| Secutor indicius histone H3 gene, partial cds	161	2e-36
423	gb\|DQ028155.1\| Leiognathus stercorarius histone H3 gene, partial...	161	2e-36
424	gb\|DQ028138.1\| Leiognathus dussumieri isolate L30 histone H3 gen...	161	2e-36
425	gb\|DQ028132.1\| Leiognathus daura isolate L1 histone H3 gene, par...	161	2e-36
426	gb\|DQ028130.1\| Leiognathus robustus isolate LEQ1s histone H3 gen...	161	2e-36
427	gb\|DQ028129.1\| Leiognathus robustus isolate L35 histone H3 gene,...	161	2e-36
428	gb\|DQ028128.1\| Leiognathus fasciatus histone H3 gene, partial cds	161	2e-36
429	gb\|DQ028125.1\| Leiognathus fasciatus isolate L16 histone H3 gene...	161	2e-36
430	gb\|DQ028118.1\| Leiognathus sp. Singapore histone H3 gene, partia...	161	2e-36
431	gb\|DQ028117.1\| Leiognathus sp. L41 histone H3 gene, partial cds	161	2e-36
432	gb\|DQ028116.1\| Leiognathus sp. L39 histone H3 gene, partial cds	161	2e-36
433	gb\|DQ028115.1\| Leiognathus sp. L25 histone H3 gene, partial cds	161	2e-36
434	gb\|DQ028113.1\| Gazza squamiventralis isolate WLS52 histone H3 ge...	161	2e-36
435	gb\|DQ028103.1\| Gazza sp. L22 histone H3 gene, partial cds	161	2e-36
436	emb\|X01064.1\|SGHIS2A3 Rainbow trout histone H2A and H3 genes	161	2e-36
437	gb\|DQ284400.1\| Microhyla sp. Rds 05 histone H3a gene, partial cds	161	2e-36
438	gb\|DQ284353.1\| Scotobleps gabonicus histone H3a gene, partial cds	161	2e-36
439	gb\|DQ284333.1\| Huia nasica histone H3a gene, partial cds	161	2e-36
440	gb\|DQ284292.1\| Rana yavapaiensis histone H3a gene, partial cds	161	2e-36
441	gb\|AY662930.1\| Crenicichla alta histone H3a gene, partial cds	161	2e-36
442	gb\|AY662900.1\| Paretroplus maromandia histone H3a-like gene, par...	161	2e-36
443	gb\|AY662888.1\| Embiotoca jacksoni histone H3a gene, partial cds	161	2e-36
444	gb\|AY662887.1\| Cymatogaster aggregata histone H3a gene, partial cds	161	2e-36
445	gb\|AY539264.1\| Perca flavescens histone H3 gene, partial cds	161	2e-36
446	gb\|AY749751.1\| Erythemis sp. OD024 histone H3 (H3) gene, partial...	161	2e-36
447	gb\|AY655592.1\| Fundulus heteroclitus histone H3a-like gene, part...	159	9e-36
448	gb\|AY655584.1\| Iso rhothophilus histone H3a gene, partial cds	159	9e-36
449	gb\|DQ028164.1\| Secutor cf. ruconius JS-2005 histone H3 gene, par...	159	9e-36
450	gb\|DQ284379.1\| Kaloula pulchra histone H3a gene, partial cds	159	9e-36
451	gb\|DQ284053.1\| Boophis tephraeomystax histone H3a gene, partial cds	159	9e-36
452	gb\|AY749736.1\| Atopopus sp. EP134 histone H3 (H3) gene, partial cds	159	9e-36
453	gb\|AY655580.1\| Atherinomorus lacunosus histone H3a gene, partial...	157	3e-35
454	gb\|AY655569.1\| Bedotia sp. 'Vevembe' histone H3a gene, partial cds	157	3e-35
455	gb\|AY655567.1\| Bedotia sp. 'Ranomafana' histone H3a gene, partia...	157	3e-35
456	gb\|AY655566.1\| Bedotia sp. 'Manombo' histone H3a gene, partial cds	157	3e-35
457	gb\|AY655563.1\| Bedotia sp. 'Ivoloina' histone H3a gene, partial cds	157	3e-35
458	gb\|AY655562.1\| Bedotia sp. 'Betampona' histone H3a gene, partial...	157	3e-35
459	gb\|AY655558.1\| Rheocles wrightae histone H3a gene, partial cds	157	3e-35
460	gb\|AY655553.1\| Bedotia tricolor histone H3a gene, partial cds	157	3e-35
461	gb\|AY655549.1\| Bedotia longianalis isolate 2 histone H3a gene, p...	157	3e-35
462	gb\|AY655548.1\| Bedotia longianalis isolate 1 histone H3a gene, p...	157	3e-35
463	gb\|AY655547.1\| Bedotia geayi histone H3a gene, partial cds	157	3e-35
464	gb\|DQ028162.1\| Secutor megalolepis histone H3 gene, partial cds	157	3e-35
465	gb\|DQ028157.1\| Secutor sp. L37 histone H3 gene, partial cds	157	3e-35
466	gb\|DQ028135.1\| Leiognathus decorus histone H3 gene, partial cds	157	3e-35
467	gb\|DQ028133.1\| Leiognathus daura isolate L28 histone H3 gene, pa...	157	3e-35
468	gb\|DQ028127.1\| Leiognathus fasciatus histone H3 gene, partial cds	157	3e-35
469	gb\|DQ028123.1\| Leiognathus equulus histone H3 gene, partial cds	157	3e-35
470	gb\|DQ028122.1\| Leiognathus equulus histone H3 gene, partial cds	157	3e-35
471	gb\|DQ028121.1\| Leiognathus equulus histone H3 gene, partial cds	157	3e-35
472	gb\|DQ028111.1\| Gazza minuta isolate L29 histone H3 gene, partial...	157	3e-35
473	gb\|DQ028110.1\| Gazza minuta isolate L4 histone H3 gene, partial cds	157	3e-35
474	gb\|DQ028106.1\| Gazza sp. WLS56 histone H3 gene, partial cds	157	3e-35
475	gb\|DQ028095.1\| Cepola pauciradiata histone H3 gene, partial cds	157	3e-35
476	gb\|DQ028094.1\| Cepola macrophthalma histone H3 gene, partial cds	157	3e-35
477	gb\|DQ028086.1\| Zeus faber histone H3 gene, partial cds	157	3e-35
478	ref\|XM_527285.1\| PREDICTED: Pan troglodytes similar to HIST1H3I ...	157	3e-35
479	gb\|BC058834.1\| Homo sapiens histone 1, H3c, mRNA (cDNA clone IMA...	157	3e-35
480	gb\|DQ284414.1\| Hamptophryne boliviana histone H3a gene, partial cds	157	3e-35
481	gb\|DQ284369.1\| Rana palmipes histone H3a gene, partial cds	157	3e-35
482	gb\|DQ284358.1\| Amolops chapaensis histone H3a gene, partial cds	157	3e-35
483	gb\|DQ284278.1\| Desmognathus quadramaculatus histone H3a gene, pa...	157	3e-35
484	gb\|DQ284269.1\| Rana temporaria histone H3a gene, partial cds	157	3e-35
485	gb\|DQ284241.1\| Genyophryne thomsoni histone H3a gene, partial cds	157	3e-35
486	gb\|DQ284240.1\| Copiula sp. AMS R124417 histone H3a gene, partial...	157	3e-35
487	gb\|DQ284232.1\| Discodeles guppyi histone H3a gene, partial cds	157	3e-35
488	gb\|DQ284230.1\| Ceratobatrachus guentheri histone H3a gene, parti...	157	3e-35
489	gb\|DQ284229.1\| Platymantis weberi histone H3a gene, partial cds	157	3e-35
490	gb\|DQ284184.1\| Calluella guttulata histone H3a gene, partial cds	157	3e-35
491	gb\|DQ284169.1\| Plethodon jordani histone H3a gene, partial cds	157	3e-35
492	gb\|DQ284167.1\| Rana pipiens histone H3a gene, partial cds	157	3e-35
493	gb\|DQ284152.1\| Rana forreri histone H3a gene, partial cds	157	3e-35
494	gb\|DQ284133.1\| Arthroleptis variabilis histone H3a gene, partial...	157	3e-35
495	gb\|DQ284131.1\| Schoutedenella sylvatica histone H3a gene, partia...	157	3e-35
496	gb\|AY662945.1\| Hemichromis guttatus histone H3a gene, partial cds	157	3e-35
497	gb\|AY662927.1\| Chaetobranchopsis orbicularis histone H3a gene, p...	157	3e-35
498	gb\|AY662922.1\| Ptychochromis sp. 'Sofia' histone H3a gene, parti...	157	3e-35
499	gb\|AY662921.1\| Ptychochromis sp. 'Makira' histone H3a gene, part...	157	3e-35
500	gb\|AY662920.1\| Ptychochromis sp. 'Garaka' histone H3a gene, part...	157	3e-35

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  381 bits (192), Expect = e-102
 Identities = 216/224 (96%)
 Strand = Plus / Minus

                                                                            
Query: 187      gcctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 246
                |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 37507568 gcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtg 37507509

                                                                            
Query: 247      acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgac 306
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
Sbjct: 37507508 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcc 37507449

                                                                            
Query: 307      tcggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaag 366
                ||||| |||||||| |||||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 37507448 tcggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 37507389

                                                            
Query: 367      tcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
                ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 37507388 tcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 37507345



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 203     cgcggatgcggcgggcgagct 223
               |||||||||||||||||||||
Sbjct: 9911750 cgcggatgcggcgggcgagct 9911730

to top

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score =  381 bits (192), Expect = e-102
 Identities = 216/224 (96%)
 Strand = Plus / Minus

                                                                          
Query: 187    gcctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 246
              |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 102105 gcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtg 102046

                                                                          
Query: 247    acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgac 306
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
Sbjct: 102045 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcc 101986

                                                                          
Query: 307    tcggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaag 366
              ||||| |||||||| |||||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 101985 tcggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 101926

                                                          
Query: 367    tcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
              ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 101925 tcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 101882

to top

>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full
           insert sequence
          Length = 1296

 Score =  381 bits (192), Expect = e-102
 Identities = 216/224 (96%)
 Strand = Plus / Minus

                                                                       
Query: 187 gcctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 246
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 491 gcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtg 432

                                                                       
Query: 247 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgac 306
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
Sbjct: 431 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcc 372

                                                                       
Query: 307 tcggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaag 366
           ||||| |||||||| |||||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 371 tcggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaag 312

                                                       
Query: 367 tcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 311 tcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 268

to top

>ref|NM_190750.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  377 bits (190), Expect = e-101
 Identities = 214/222 (96%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 248
           |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 ctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 249 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactc 308
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||
Sbjct: 351 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctc 292

                                                                       
Query: 309 ggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtc 368
           ||| |||||||| |||||||  ||||||||||||||||||||||||||||||||||||||
Sbjct: 291 ggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtc 232

                                                     
Query: 369 ctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 231 ctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 190

to top

>ref|XM_475315.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  369 bits (186), Expect = 5e-99
 Identities = 210/218 (96%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||||  ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||||||||||| ||||||||||||||||||||
Sbjct: 227 gcgatctcccgcaccagccgctggaacggcagcttgcg 190

to top

>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score =  369 bits (186), Expect = 5e-99
 Identities = 210/218 (96%)
 Strand = Plus / Plus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72765 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 72824

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             |||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||
Sbjct: 72825 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 72884

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| |||||||  ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72885 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 72944

                                                   
Query: 373   gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             ||||||||||||||||| ||||||||||||||||||||
Sbjct: 72945 gcgatctcccgcaccagccgctggaacggcagcttgcg 72982

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  369 bits (186), Expect = 5e-99
 Identities = 210/218 (96%)
 Strand = Plus / Plus

                                                                            
Query: 193      gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
                |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21355443 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 21355502

                                                                            
Query: 253      ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
                |||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||
Sbjct: 21355503 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 21355562

                                                                            
Query: 313      gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
                |||||||| |||||||  ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21355563 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 21355622

                                                      
Query: 373      gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
                ||||||||||||||||| ||||||||||||||||||||
Sbjct: 21355623 gcgatctcccgcaccagccgctggaacggcagcttgcg 21355660

to top

>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full
           insert sequence
          Length = 735

 Score =  369 bits (186), Expect = 5e-99
 Identities = 210/218 (96%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 492 gccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 433

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||
Sbjct: 432 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 373

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||||  ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 372 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgc 313

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||||||||||| ||||||||||||||||||||
Sbjct: 312 gcgatctcccgcaccagccgctggaacggcagcttgcg 275

to top

>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds
          Length = 1177

 Score =  333 bits (168), Expect = 3e-88
 Identities = 210/224 (93%)
 Strand = Plus / Minus

                                                                       
Query: 187 gcctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 246
           |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 958 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 899

                                                                       
Query: 247 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgac 306
           ||||||||||||||||||||||||||||||||||||||||| || ||||||||||| | |
Sbjct: 898 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcc 839

                                                                       
Query: 307 tcggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaag 366
           |||||||||||||| |||||||  |||||||||  |||||||||||||||||||||||||
Sbjct: 838 tcggcggcctcctgcagcgcggcgacggcggaggactggaagcggaggtcggtcttgaag 779

                                                       
Query: 367 tcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 778 tcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcg 735

to top

>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence
          Length = 887

 Score =  327 bits (165), Expect = 2e-86
 Identities = 204/217 (94%)
 Strand = Plus / Plus

                                                                       
Query: 191 aggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 250
           |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 224 aggccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 283

                                                                       
Query: 251 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcgg 310
           |||||||||||||||||||||||||||||||||||||||| || |||||||| | |||||
Sbjct: 284 gcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcgg 343

                                                                       
Query: 311 cggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcct 370
           |||||||||| ||||||| ||||||||||  |||||| |||||||| |||||||||||||
Sbjct: 344 cggcctcctgcagcgcggccacggcggaggactggaaccggaggtccgtcttgaagtcct 403

                                                
Query: 371 gcgcgatctcccgcaccaggcgctggaacggcagctt 407
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 404 gcgcgatctcccgcaccagccgctggaacggcagctt 440

to top

>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20,
              complete sequence
          Length = 127338

 Score =  327 bits (165), Expect = 2e-86
 Identities = 198/209 (94%)
 Strand = Plus / Minus

                                                                          
Query: 202    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118165 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 118106

                                                                          
Query: 262    atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
              ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 118105 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 118046

                                                                          
Query: 322    agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
              |||||||  ||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 118045 agcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcc 117986

                                           
Query: 382    cgcaccaggcgctggaacggcagcttgcg 410
              || || || |||||||| || ||||||||
Sbjct: 117985 cggacgagccgctggaaggggagcttgcg 117957

to top

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score =  327 bits (165), Expect = 2e-86
 Identities = 198/209 (94%)
 Strand = Plus / Minus

                                                                         
Query: 202   ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13771 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 13712

                                                                         
Query: 262   atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
             ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 13711 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 13652

                                                                         
Query: 322   agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
             |||||||  ||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 13651 agcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcc 13592

                                          
Query: 382   cgcaccaggcgctggaacggcagcttgcg 410
             || || || |||||||| || ||||||||
Sbjct: 13591 cggacgagccgctggaaggggagcttgcg 13563

to top

>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2
          Length = 1200

 Score =  327 bits (165), Expect = 2e-86
 Identities = 198/209 (94%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 798 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 739

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 738 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 679

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||||  ||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 678 agcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcc 619

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || || |||||||| || ||||||||
Sbjct: 618 cggacgagccgctggaaggggagcttgcg 590

to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  327 bits (165), Expect = 2e-86
 Identities = 198/209 (94%)
 Strand = Plus / Plus

                                                                           
Query: 202     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2608633 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 2608692

                                                                           
Query: 262     atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
               ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 2608693 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 2608752

                                                                           
Query: 322     agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
               |||||||  ||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 2608753 agcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcc 2608812

                                            
Query: 382     cgcaccaggcgctggaacggcagcttgcg 410
               || || || |||||||| || ||||||||
Sbjct: 2608813 cggacgagccgctggaaggggagcttgcg 2608841

to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  327 bits (165), Expect = 2e-86
 Identities = 198/209 (94%)
 Strand = Plus / Plus

                                                                           
Query: 202     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2617664 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 2617723

                                                                           
Query: 262     atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
               ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 2617724 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 2617783

                                                                           
Query: 322     agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
               |||||||  ||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 2617784 agcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcc 2617843

                                            
Query: 382     cgcaccaggcgctggaacggcagcttgcg 410
               || || || |||||||| || ||||||||
Sbjct: 2617844 cggacgagccgctggaaggggagcttgcg 2617872

to top

>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds
          Length = 642

 Score =  327 bits (165), Expect = 2e-86
 Identities = 198/209 (94%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 469 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 410

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 409 atggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgg 350

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||||  ||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 349 agcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgcgcgatctcc 290

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || || |||||||| || ||||||||
Sbjct: 289 cggacgagccgctggaaggggagcttgcg 261

to top

>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene
          Length = 1119

 Score =  327 bits (165), Expect = 2e-86
 Identities = 204/217 (94%)
 Strand = Plus / Minus

                                                                       
Query: 191 aggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 250
           |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 793 aggccctctcgccccggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 734

                                                                       
Query: 251 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcgg 310
           |||||||||||||||||||||||||||||||||||||||| || |||||||| | |||||
Sbjct: 733 gcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcgg 674

                                                                       
Query: 311 cggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcct 370
           |||||||||| ||||||| ||||||||||  |||||| |||||||| |||||||||||||
Sbjct: 673 cggcctcctgcagcgcggccacggcggaggactggaaccggaggtccgtcttgaagtcct 614

                                                
Query: 371 gcgcgatctcccgcaccaggcgctggaacggcagctt 407
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 613 gcgcgatctcccgcaccagccgctggaacggcagctt 577

to top

>emb|X00937.1|TAHI02 Wheat histone H3 gene
          Length = 811

 Score =  319 bits (161), Expect = 4e-84
 Identities = 209/225 (92%)
 Strand = Plus / Minus

                                                                       
Query: 186 agcctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 245
           ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 661 agcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 602

                                                                       
Query: 246 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacga 305
           ||||||||||||||||||||||||||||||||||||||||||||| || |||||||| | 
Sbjct: 601 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggc 542

                                                                       
Query: 306 ctcggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaa 365
           ||||||||||||||| || ||||| |||||||||  ||||||||||||||||||||||||
Sbjct: 541 ctcggcggcctcctgcagggcggagacggcggaggactggaagcggaggtcggtcttgaa 482

                                                        
Query: 366 gtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||| |||||||| ||||| ||||||||||| || ||||||||
Sbjct: 481 gtcctgggcgatctcgcgcactaggcgctggaaggggagcttgcg 437

to top

>ref|NM_185612.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  311 bits (157), Expect = 1e-81
 Identities = 196/209 (93%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| ||||| |||||||||||||||||||||||||||| ||| ||||||||||| 
Sbjct: 338 atggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgc 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 278 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || ||||||||||| || ||||||||
Sbjct: 218 cggacgaggcgctggaaggggagcttgcg 190

to top

>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence
          Length = 638

 Score =  311 bits (157), Expect = 1e-81
 Identities = 199/213 (93%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 344 ctccccgcggatgcggcgggcgagctgaatgtccttgggcatgatggtgacgcgcttggc 285

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           ||||||||||||||||||||||||||||||||| ||||||||||| | ||| ||||||||
Sbjct: 284 gtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctccgcggcctc 225

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||||  |||||||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 224 ctgcagcgcggcgacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 165

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| || |||||||||||||| || ||||||||
Sbjct: 164 ctcgcggaccaggcgctggaaggggagcttgcg 132

to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  311 bits (157), Expect = 1e-81
 Identities = 196/209 (93%)
 Strand = Plus / Plus

                                                                           
Query: 202     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3054217 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 3054276

                                                                           
Query: 262     atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
               |||||||| ||||| |||||||||||||||||||||||||||| ||| ||||||||||| 
Sbjct: 3054277 atggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgc 3054336

                                                                           
Query: 322     agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
               |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 3054337 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 3054396

                                            
Query: 382     cgcaccaggcgctggaacggcagcttgcg 410
               || || ||||||||||| || ||||||||
Sbjct: 3054397 cggacgaggcgctggaaggggagcttgcg 3054425



 Score =  303 bits (153), Expect = 2e-79
 Identities = 195/209 (93%)
 Strand = Plus / Plus

                                                                           
Query: 202     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
               |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3045570 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 3045629

                                                                           
Query: 262     atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
               |||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| 
Sbjct: 3045630 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 3045689

                                                                           
Query: 322     agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
               |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 3045690 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 3045749

                                            
Query: 382     cgcaccaggcgctggaacggcagcttgcg 410
               || || ||||||||||| || ||||||||
Sbjct: 3045750 cggacgaggcgctggaaggggagcttgcg 3045778



 Score =  303 bits (153), Expect = 2e-79
 Identities = 195/209 (93%)
 Strand = Plus / Plus

                                                                           
Query: 202     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1644709 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 1644768

                                                                           
Query: 262     atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
               ||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||
Sbjct: 1644769 atggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctcctgg 1644828

                                                                           
Query: 322     agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
               || |||  ||| |||  |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1644829 agggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgcgcgatctcg 1644888

                                            
Query: 382     cgcaccaggcgctggaacggcagcttgcg 410
               || || ||||||||||| || ||||||||
Sbjct: 1644889 cggacgaggcgctggaaggggagcttgcg 1644917



 Score =  295 bits (149), Expect = 6e-77
 Identities = 194/209 (92%)
 Strand = Plus / Plus

                                                                           
Query: 202     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
               |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3039540 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 3039599

                                                                           
Query: 262     atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
               ||||| || ||||||||||||||||| |||||||||||||||| ||||||||||||||| 
Sbjct: 3039600 atggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 3039659

                                                                           
Query: 322     agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
               |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 3039660 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 3039719

                                            
Query: 382     cgcaccaggcgctggaacggcagcttgcg 410
               || || ||||||||||| || ||||||||
Sbjct: 3039720 cggacgaggcgctggaaggggagcttgcg 3039748



 Score =  287 bits (145), Expect = 1e-74
 Identities = 193/209 (92%)
 Strand = Plus / Minus

                                                                           
Query: 202     ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
               |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3055560 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 3055501

                                                                           
Query: 262     atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
               |||||||| ||||||||||||||||| |||||||||||||||| ||| ||||||||||| 
Sbjct: 3055500 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctcctgc 3055441

                                                                           
Query: 322     agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
               || ||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 3055440 agggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 3055381

                                            
Query: 382     cgcaccaggcgctggaacggcagcttgcg 410
               || || ||||||||||| || ||||||||
Sbjct: 3055380 cggacgaggcgctggaaggggagcttgcg 3055352

to top

>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0702F05
          Length = 145018

 Score =  311 bits (157), Expect = 1e-81
 Identities = 196/209 (93%)
 Strand = Plus / Plus

                                                                          
Query: 202    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142166 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 142225

                                                                          
Query: 262    atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
              |||||||| ||||| |||||||||||||||||||||||||||| ||| ||||||||||| 
Sbjct: 142226 atggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgc 142285

                                                                          
Query: 322    agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
              |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 142286 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 142345

                                           
Query: 382    cgcaccaggcgctggaacggcagcttgcg 410
              || || ||||||||||| || ||||||||
Sbjct: 142346 cggacgaggcgctggaaggggagcttgcg 142374



 Score =  303 bits (153), Expect = 2e-79
 Identities = 195/209 (93%)
 Strand = Plus / Plus

                                                                          
Query: 202    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
              |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 133519 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 133578

                                                                          
Query: 262    atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
              |||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| 
Sbjct: 133579 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 133638

                                                                          
Query: 322    agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
              |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 133639 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 133698

                                           
Query: 382    cgcaccaggcgctggaacggcagcttgcg 410
              || || ||||||||||| || ||||||||
Sbjct: 133699 cggacgaggcgctggaaggggagcttgcg 133727



 Score =  295 bits (149), Expect = 6e-77
 Identities = 194/209 (92%)
 Strand = Plus / Plus

                                                                          
Query: 202    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
              |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127489 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 127548

                                                                          
Query: 262    atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
              ||||| || ||||||||||||||||| |||||||||||||||| ||||||||||||||| 
Sbjct: 127549 atggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 127608

                                                                          
Query: 322    agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
              |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 127609 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 127668

                                           
Query: 382    cgcaccaggcgctggaacggcagcttgcg 410
              || || ||||||||||| || ||||||||
Sbjct: 127669 cggacgaggcgctggaaggggagcttgcg 127697



 Score =  287 bits (145), Expect = 1e-74
 Identities = 193/209 (92%)
 Strand = Plus / Minus

                                                                          
Query: 202    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
              |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143509 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 143450

                                                                          
Query: 262    atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
              |||||||| ||||||||||||||||| |||||||||||||||| ||| ||||||||||| 
Sbjct: 143449 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctcctgc 143390

                                                                          
Query: 322    agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
              || ||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 143389 agggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 143330

                                           
Query: 382    cgcaccaggcgctggaacggcagcttgcg 410
              || || ||||||||||| || ||||||||
Sbjct: 143329 cggacgaggcgctggaaggggagcttgcg 143301

to top

>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone:P0681F10
          Length = 170371

 Score =  311 bits (157), Expect = 1e-81
 Identities = 196/209 (93%)
 Strand = Plus / Plus

                                                                        
Query: 202  ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8402 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 8461

                                                                        
Query: 262  atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
            |||||||| ||||| |||||||||||||||||||||||||||| ||| ||||||||||| 
Sbjct: 8462 atggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccgcggcctcctgc 8521

                                                                        
Query: 322  agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
            |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 8522 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 8581

                                         
Query: 382  cgcaccaggcgctggaacggcagcttgcg 410
            || || ||||||||||| || ||||||||
Sbjct: 8582 cggacgaggcgctggaaggggagcttgcg 8610



 Score =  287 bits (145), Expect = 1e-74
 Identities = 193/209 (92%)
 Strand = Plus / Minus

                                                                        
Query: 202  ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
            |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9745 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 9686

                                                                        
Query: 262  atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
            |||||||| ||||||||||||||||| |||||||||||||||| ||| ||||||||||| 
Sbjct: 9685 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctcctgc 9626

                                                                        
Query: 322  agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
            || ||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 9625 agggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 9566

                                         
Query: 382  cgcaccaggcgctggaacggcagcttgcg 410
            || || ||||||||||| || ||||||||
Sbjct: 9565 cggacgaggcgctggaaggggagcttgcg 9537

to top

>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence
          Length = 636

 Score =  305 bits (154), Expect = 6e-80
 Identities = 193/206 (93%)
 Strand = Plus / Plus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 149 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttagcgtggatg 208

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           |||||||||||||||||||||||||| ||||||||||| | |||||||||||||||||||
Sbjct: 209 gcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctcctggagc 268

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||||  ||||||||| |||||||| ||||||||||||||||||||||| |||
Sbjct: 269 gccagcacggcgtggctctggaatcggaggtctgtcttgaagtcctgcgcgatctcgcgc 328

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           |||||||||||||| |||||||||||
Sbjct: 329 accaggcgctggaagggcagcttgcg 354

to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  305 bits (154), Expect = 6e-80
 Identities = 202/218 (92%)
 Strand = Plus / Plus

                                                                        
Query: 193  gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3348 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 3407

                                                                        
Query: 253  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
            ||||||||||||||||| ||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 3408 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 3467

                                                                        
Query: 313  gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
            |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 3468 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 3527

                                                  
Query: 373  gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            |||||||||||||||||||||||||| |||||||||||
Sbjct: 3528 gcgatctcccgcaccaggcgctggaagggcagcttgcg 3565

to top

>ref|XM_493701.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score =  303 bits (153), Expect = 2e-79
 Identities = 195/209 (93%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           ||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||
Sbjct: 338 atggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctcctgg 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || |||  ||| |||  |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 278 agggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgcgcgatctcg 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || ||||||||||| || ||||||||
Sbjct: 218 cggacgaggcgctggaaggggagcttgcg 190

to top

>ref|NM_185609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score =  303 bits (153), Expect = 2e-79
 Identities = 195/209 (93%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 419 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 360

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| 
Sbjct: 359 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 300

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 299 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 240

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || ||||||||||| || ||||||||
Sbjct: 239 cggacgaggcgctggaaggggagcttgcg 211

to top

>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score =  303 bits (153), Expect = 2e-79
 Identities = 195/209 (93%)
 Strand = Plus / Plus

                                                                         
Query: 202   ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 47880 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 47939

                                                                         
Query: 262   atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
             ||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||
Sbjct: 47940 atggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctcctgg 47999

                                                                         
Query: 322   agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
             || |||  ||| |||  |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 48000 agggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgcgcgatctcg 48059

                                          
Query: 382   cgcaccaggcgctggaacggcagcttgcg 410
             || || ||||||||||| || ||||||||
Sbjct: 48060 cggacgaggcgctggaaggggagcttgcg 48088

to top

>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds
          Length = 793

 Score =  303 bits (153), Expect = 2e-79
 Identities = 195/209 (93%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 486 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 427

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           ||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||
Sbjct: 426 atggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcggcctcctgg 367

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || |||  ||| |||  |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 366 agggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgcgcgatctcg 307

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || ||||||||||| || ||||||||
Sbjct: 306 cggacgaggcgctggaaggggagcttgcg 278

to top

>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12
          Length = 1920

 Score =  303 bits (153), Expect = 2e-79
 Identities = 195/209 (93%)
 Strand = Plus / Minus

                                                                        
Query: 202  ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
            |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1518 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 1459

                                                                        
Query: 262  atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
            |||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| 
Sbjct: 1458 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 1399

                                                                        
Query: 322  agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
            |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 1398 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 1339

                                         
Query: 382  cgcaccaggcgctggaacggcagcttgcg 410
            || || ||||||||||| || ||||||||
Sbjct: 1338 cggacgaggcgctggaaggggagcttgcg 1310

to top

>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end
          Length = 505

 Score =  303 bits (153), Expect = 2e-79
 Identities = 198/213 (92%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 234 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 175

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||
Sbjct: 174 gtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctc 115

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           |||||| ||   |||||||  |  |||||| | |||||||||||||||||||||||||||
Sbjct: 114 ctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcctgcgcgat 55

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||| |||||||||||||||||| ||||||||
Sbjct: 54  ctccctcaccaggcgctggaacgggagcttgcg 22

to top

>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488298), mRNA
          Length = 411

 Score =  301 bits (152), Expect = 9e-79
 Identities = 203/220 (92%)
 Strand = Plus / Minus

                                                                       
Query: 191 aggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 250
           ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||
Sbjct: 409 aggccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgc 350

                                                                       
Query: 251 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcgg 310
           ||||||||||||||||||||||||||||||||||||||||||| || ||||| | |||| 
Sbjct: 349 gcttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgc 290

                                                                       
Query: 311 cggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcct 370
             |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 289 acgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 230

                                                   
Query: 371 gcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||| |||||||||||||||||||||||||||||
Sbjct: 229 gcgcgatctcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>ref|XM_472456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  299 bits (151), Expect = 4e-78
 Identities = 199/215 (92%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||||  ||||||||   |||||| |||||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgc 228

                                              
Query: 373 gcgatctcccgcaccaggcgctggaacggcagctt 407
           ||||||||||||||||| ||||||||||| |||||
Sbjct: 227 gcgatctcccgcaccagccgctggaacgggagctt 193

to top

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  299 bits (151), Expect = 4e-78
 Identities = 202/219 (92%)
 Strand = Plus / Minus

                                                                       
Query: 192 ggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcg 251
           |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 408 ggccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcg 349

                                                                       
Query: 252 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggc 311
           |||||||||||||||||||||||||||||||||||||||||| || ||||| | ||||  
Sbjct: 348 cttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgca 289

                                                                       
Query: 312 ggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctg 371
            |||||||| |||||    ||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 288 cgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 229

                                                  
Query: 372 cgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||| |||||||||||||||||||||||||||||
Sbjct: 228 cgcgatctcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  299 bits (151), Expect = 4e-78
 Identities = 202/219 (92%)
 Strand = Plus / Minus

                                                                       
Query: 192 ggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcg 251
           |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 408 ggccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcg 349

                                                                       
Query: 252 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggc 311
           |||||||||||||||||||||||||||||||||||||||||| || ||||| | ||||  
Sbjct: 348 cttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgca 289

                                                                       
Query: 312 ggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctg 371
            |||||||| |||||    ||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 288 cgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctg 229

                                                  
Query: 372 cgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||| |||||||||||||||||||||||||||||
Sbjct: 228 cgcgatctcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  299 bits (151), Expect = 4e-78
 Identities = 199/215 (92%)
 Strand = Plus / Minus

                                                                            
Query: 193      gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
                |||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20749059 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 20749000

                                                                            
Query: 253      ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
                |||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||
Sbjct: 20748999 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 20748940

                                                                            
Query: 313      gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
                |||||||| |||||||  ||||||||   |||||| |||||||| |||||||||||||||
Sbjct: 20748939 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgc 20748880

                                                   
Query: 373      gcgatctcccgcaccaggcgctggaacggcagctt 407
                ||||||||||||||||| ||||||||||| |||||
Sbjct: 20748879 gcgatctcccgcaccagccgctggaacgggagctt 20748845



 Score =  113 bits (57), Expect = 5e-22
 Identities = 90/101 (89%)
 Strand = Plus / Minus

                                                                            
Query: 220      agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtg 279
                ||||| |||||||||||||||||||| || |||||||| ||||||||||| |||||||||
Sbjct: 22438361 agctgaatgtccttgggcatgatggtcacacgcttggcatggatggcgcacaggttggtg 22438302

                                                         
Query: 280      tcctcgaagagcccgacgaggtacgactcggcggcctcctg 320
                ||||||||||| || || ||||||| |||||| || |||||
Sbjct: 22438301 tcctcgaagagacccaccaggtacgcctcggcagcttcctg 22438261

to top

>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11,
             complete sequence
          Length = 124629

 Score =  299 bits (151), Expect = 4e-78
 Identities = 199/215 (92%)
 Strand = Plus / Minus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             |||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95210 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 95151

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             |||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||
Sbjct: 95150 ttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcg 95091

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| |||||||  ||||||||   |||||| |||||||| |||||||||||||||
Sbjct: 95090 gcctcctgcagcgcggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgc 95031

                                                
Query: 373   gcgatctcccgcaccaggcgctggaacggcagctt 407
             ||||||||||||||||| ||||||||||| |||||
Sbjct: 95030 gcgatctcccgcaccagccgctggaacgggagctt 94996

to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score =  297 bits (150), Expect = 1e-77
 Identities = 201/218 (92%)
 Strand = Plus / Minus

                                                                        
Query: 193  gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2267 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2208

                                                                        
Query: 253  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
            ||||||||||||||||| ||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 2207 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 2148

                                                                        
Query: 313  gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
            |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 2147 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 2088

                                                  
Query: 373  gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            |||||||| ||||||||||||||||| |||||||||||
Sbjct: 2087 gcgatctcgcgcaccaggcgctggaagggcagcttgcg 2050

to top

>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611519), mRNA
          Length = 471

 Score =  297 bits (150), Expect = 1e-77
 Identities = 201/218 (92%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 467 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 408

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||||||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 407 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 348

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 347 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 288

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 287 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 250

to top

>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488277), mRNA
          Length = 411

 Score =  297 bits (150), Expect = 1e-77
 Identities = 201/218 (92%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||||||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488275), mRNA
          Length = 459

 Score =  297 bits (150), Expect = 1e-77
 Identities = 201/218 (92%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 455 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 396

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||||||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 395 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 336

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 335 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 276

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 275 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 238

to top

>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611138), mRNA
          Length = 411

 Score =  297 bits (150), Expect = 1e-77
 Identities = 201/218 (92%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||||||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488307), mRNA
          Length = 411

 Score =  297 bits (150), Expect = 1e-77
 Identities = 201/218 (92%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||||||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488263), mRNA
          Length = 411

 Score =  297 bits (150), Expect = 1e-77
 Identities = 201/218 (92%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||||||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>ref|NM_185607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  295 bits (149), Expect = 6e-77
 Identities = 194/209 (92%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           ||||| || ||||||||||||||||| |||||||||||||||| ||||||||||||||| 
Sbjct: 338 atggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 278 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || ||||||||||| || ||||||||
Sbjct: 218 cggacgaggcgctggaaggggagcttgcg 190

to top

>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11
          Length = 1200

 Score =  295 bits (149), Expect = 6e-77
 Identities = 194/209 (92%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 798 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 739

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           ||||| || ||||||||||||||||| |||||||||||||||| ||||||||||||||| 
Sbjct: 738 atggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcggcctcctgc 679

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 678 agcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 619

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || ||||||||||| || ||||||||
Sbjct: 618 cggacgaggcgctggaaggggagcttgcg 590

to top

>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2,
           complete cds
          Length = 784

 Score =  293 bits (148), Expect = 2e-76
 Identities = 205/224 (91%)
 Strand = Plus / Minus

                                                                       
Query: 187 gcctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 246
           |||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 577 gcctaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 518

                                                                       
Query: 247 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgac 306
           |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
Sbjct: 517 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcc 458

                                                                       
Query: 307 tcggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaag 366
           ||||| ||||||||||||||   |||||||  ||||||||| || ||||| |||||||||
Sbjct: 457 tcggccgcctcctggagcgccagcacggcgtggctctggaaccgcaggtccgtcttgaag 398

                                                       
Query: 367 tcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||||||| || |||||||||||||| || ||||||||
Sbjct: 397 tcctgcgcgatctcgcggaccaggcgctggaaggggagcttgcg 354

to top

>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611167), mRNA
          Length = 504

 Score =  291 bits (147), Expect = 9e-76
 Identities = 198/215 (92%)
 Strand = Plus / Minus

                                                                       
Query: 196 ctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 255
           |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 497 ctctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 438

                                                                       
Query: 256 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcc 315
           |||||||||||||||||||||||||||||||||||||| || ||||| | ||||   |||
Sbjct: 437 gcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcc 378

                                                                       
Query: 316 tcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcg 375
           ||||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 377 tcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 318

                                              
Query: 376 atctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||| |||||||||||||||||||||||||||||
Sbjct: 317 atctcgcgcaccaggcgctggaacggcagcttgcg 283

to top

>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds
          Length = 411

 Score =  289 bits (146), Expect = 4e-75
 Identities = 200/218 (91%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| || | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcg 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||||  || ||||||  |||||||||||||||||||||||| ||||||
Sbjct: 287 gcctcctgcagcgcggcgacagcggaggactggaagcggaggtcggtcttgaaatcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || || ||||||||||| |||||||||||
Sbjct: 227 gcgatctcacggacgaggcgctggaagggcagcttgcg 190

to top

>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds
          Length = 1001

 Score =  289 bits (146), Expect = 4e-75
 Identities = 200/218 (91%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| || | ||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 828 gccctctcgcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 769

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||
Sbjct: 768 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcg 709

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||||  || ||||||  |||||||||||||||||||||||| ||||||
Sbjct: 708 gcctcctgcagcgcggcgacagcggaggactggaagcggaggtcggtcttgaaatcctgc 649

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || || ||||||||||| |||||||||||
Sbjct: 648 gcgatctcacggacgaggcgctggaagggcagcttgcg 611

to top

>ref|NM_185613.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  287 bits (145), Expect = 1e-74
 Identities = 193/209 (92%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 ccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| ||||||||||||||||| |||||||||||||||| ||| ||||||||||| 
Sbjct: 338 atggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcggcctcctgc 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || ||||  ||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 278 agggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgggcgatctcg 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || ||||||||||| || ||||||||
Sbjct: 218 cggacgaggcgctggaaggggagcttgcg 190

to top

>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC427890), mRNA
          Length = 600

 Score =  287 bits (145), Expect = 1e-74
 Identities = 196/213 (92%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 591 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 532

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 531 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 472

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 471 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 412

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 411 ctcgcgcaccaggcgctggaagggcagcttgcg 379

to top

>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958),
           mRNA
          Length = 1512

 Score =  287 bits (145), Expect = 1e-74
 Identities = 196/213 (92%)
 Strand = Plus / Plus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 577 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 636

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 637 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 696

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 697 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 756

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 757 ctcgcgcaccaggcgctggaagggcagcttgcg 789

to top

>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949),
           mRNA
          Length = 752

 Score =  287 bits (145), Expect = 1e-74
 Identities = 196/213 (92%)
 Strand = Plus / Plus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 322 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 381

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 382 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 441

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 442 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 501

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 502 ctcgcgcaccaggcgctggaagggcagcttgcg 534

to top

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  287 bits (145), Expect = 1e-74
 Identities = 196/213 (92%)
 Strand = Plus / Minus

                                                                        
Query: 198  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3237 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 3178

                                                                        
Query: 258  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 3177 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 3118

                                                                        
Query: 318  ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
            ||| |||||   |||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 3117 ctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 3058

                                             
Query: 378  ctcccgcaccaggcgctggaacggcagcttgcg 410
            ||| |||||||| |||||||| |||||||||||
Sbjct: 3057 ctcgcgcaccagccgctggaagggcagcttgcg 3025



 Score =  287 bits (145), Expect = 1e-74
 Identities = 196/213 (92%)
 Strand = Plus / Plus

                                                                        
Query: 198  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1484 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 1543

                                                                        
Query: 258  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 1544 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 1603

                                                                        
Query: 318  ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
            ||| |||||   |||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1604 ctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 1663

                                             
Query: 378  ctcccgcaccaggcgctggaacggcagcttgcg 410
            ||| |||||||| |||||||| |||||||||||
Sbjct: 1664 ctcgcgcaccagccgctggaagggcagcttgcg 1696

to top

>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15
          Length = 578

 Score =  287 bits (145), Expect = 1e-74
 Identities = 196/213 (92%)
 Strand = Plus / Plus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 141 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 200

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 201 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 260

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 261 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 320

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 321 ctcgcgcaccaggcgctggaagggcagcttgcg 353

to top

>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV
          Length = 1094

 Score =  287 bits (145), Expect = 1e-74
 Identities = 196/213 (92%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 816 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 757

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 756 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 697

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 696 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 637

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 636 ctcacgcaccaggcgctggaagggcagcttgcg 604

to top

>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds
          Length = 1809

 Score =  287 bits (145), Expect = 1e-74
 Identities = 196/213 (92%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 873 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 814

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 813 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 754

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 753 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 694

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 693 ctcgcgcaccaggcgctggaagggcagcttgcg 661

to top

>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds
          Length = 1271

 Score =  287 bits (145), Expect = 1e-74
 Identities = 196/213 (92%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 686 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 627

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 626 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 567

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 566 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 507

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 506 ctcgcgcaccaggcgctggaagggcagcttgcg 474

to top

>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds
          Length = 784

 Score =  287 bits (145), Expect = 1e-74
 Identities = 196/213 (92%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 755 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 696

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 695 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 636

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 635 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 576

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 575 ctcgcgcaccaggcgctggaagggcagcttgcg 543

to top

>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488306), mRNA
          Length = 411

 Score =  285 bits (144), Expect = 6e-74
 Identities = 195/212 (91%)
 Strand = Plus / Minus

                                                                       
Query: 199 tccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 258
           ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 401 tccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcg 342

                                                                       
Query: 259 tggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcc 318
           ||||||||||||||||||||||||||||||||||| || ||||| | ||||   ||||||
Sbjct: 341 tggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcc 282

                                                                       
Query: 319 tggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatc 378
           || |||||    ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 281 tgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatc 222

                                           
Query: 379 tcccgcaccaggcgctggaacggcagcttgcg 410
           || |||||||||||||||||||||||||||||
Sbjct: 221 tcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC617888), mRNA
          Length = 714

 Score =  281 bits (142), Expect = 9e-73
 Identities = 202/222 (90%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 248
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 714 ctaggccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgac 655

                                                                       
Query: 249 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactc 308
           |||||||||||||||||| || |||||||||||||||||||| || || ||||| | |||
Sbjct: 654 gcgcttggcgtggatggcacacaggttggtgtcctcgaagagtcccaccaggtaggcctc 595

                                                                       
Query: 309 ggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtc 368
           |   |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||
Sbjct: 594 gcacgcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtc 535

                                                     
Query: 369 ctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 534 ctgcgcgatctcgcgcaccagccgctggaacggcagcttgcg 493

to top

>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC521581), mRNA
          Length = 411

 Score =  281 bits (142), Expect = 9e-73
 Identities = 199/218 (91%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||| || ||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccagccgctggaacggcagcttgcg 190

to top

>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945),
           mRNA
          Length = 972

 Score =  280 bits (141), Expect = 3e-72
 Identities = 195/213 (91%)
 Strand = Plus / Plus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 385 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 444

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 445 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 504

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 505 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 564

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| ||||| |||||
Sbjct: 565 ctcgcgcaccaggcgctggaagggcagtttgcg 597

to top

>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V
          Length = 1107

 Score =  280 bits (141), Expect = 3e-72
 Identities = 195/213 (91%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 816 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 757

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            ||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 756 atggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 697

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 696 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 637

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 636 ctcgcgcaccaggcgctggaagggcagcttgcg 604

to top

>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds
          Length = 1204

 Score =  280 bits (141), Expect = 3e-72
 Identities = 195/213 (91%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 890 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 831

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 830 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 771

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 770 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttaaagtcctgcgcgat 711

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 710 ctcgcgcaccaggcgctggaagggcagcttgcg 678

to top

>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds
          Length = 711

 Score =  280 bits (141), Expect = 3e-72
 Identities = 192/209 (91%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 628 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 569

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| ||||| |||||||||||||||||||||||||||  ||| ||||||||||| 
Sbjct: 568 atggcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccgcggcctcctgc 509

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           ||||||   ||||||||  ||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 508 agcgcgcggacggcggacgtctggaagcggaggtcggtcttgaagtcctgggcgatctcg 449

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || ||||||||||| || ||||||||
Sbjct: 448 cggacgaggcgctggaaggggagcttgcg 420

to top

>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds
          Length = 1017

 Score =  280 bits (141), Expect = 3e-72
 Identities = 195/213 (91%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 562 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 503

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           ||| |||||||| ||||||||||||||||||||||| || ||||| | ||||   |||||
Sbjct: 502 gtgcatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 443

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 442 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 383

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| |||||||||||
Sbjct: 382 ctcgcgcaccaggcgctggaagggcagcttgcg 350

to top

>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds
          Length = 568

 Score =  280 bits (141), Expect = 3e-72
 Identities = 192/209 (91%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 535 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 476

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| ||||| |||||||||||||||||||||||||||  ||| ||||||||||| 
Sbjct: 475 atggcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccgcggcctcctgc 416

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           ||||||   ||||||||  ||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 415 agcgcgcggacggcggacgtctggaagcggaggtcggtcttgaagtcctgggcgatctcg 356

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || ||||||||||| || ||||||||
Sbjct: 355 cggacgaggcgctggaaggggagcttgcg 327

to top

>ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618948), mRNA
          Length = 484

 Score =  274 bits (138), Expect = 2e-70
 Identities = 198/218 (90%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||| || ||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccagccgctggaacggcagcttgcg 190

to top

>ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC540148), mRNA
          Length = 484

 Score =  274 bits (138), Expect = 2e-70
 Identities = 198/218 (90%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||| || ||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccagccgctggaacggcagcttgcg 190

to top

>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3
          Length = 657

 Score =  272 bits (137), Expect = 8e-70
 Identities = 191/209 (91%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 449 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 390

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| |||||||||||||||||||||||||||||||| | |||||| |||||||||
Sbjct: 389 atggcgcacaggttggtgtcctcgaagagcccgacgaggtaggcctcggccgcctcctgg 330

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||   |||||||  ||||||||| || ||||| || |||||||||||||||||||| 
Sbjct: 329 agcgccagcacggcgtggctctggaaccgcaggtccgttttgaagtcctgcgcgatctcg 270

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || ||||||||||| || ||||||||
Sbjct: 269 cggacgaggcgctggaaggggagcttgcg 241

to top

>gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial cds, clone W2
          Length = 486

 Score =  268 bits (135), Expect = 1e-68
 Identities = 177/191 (92%)
 Strand = Plus / Minus

                                                                       
Query: 220 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtg 279
           |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||
Sbjct: 486 agctggatgtccttgggcatgatggtgacgcgcttggcatggatggcgcaggggttggtg 427

                                                                       
Query: 280 tcctcgaagagcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggag 339
           ||||||||||||||||||||||||| |||||||||||||||||| ||   |||||||  |
Sbjct: 426 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagggccagcacggcgtgg 367

                                                                       
Query: 340 ctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaac 399
           ||||||||||| || || |||||||||||||| ||||||||||||| |||||||||||||
Sbjct: 366 ctctggaagcgcagatccgtcttgaagtcctgggcgatctcccgcagcaggcgctggaac 307

                      
Query: 400 ggcagcttgcg 410
           |||||||||||
Sbjct: 306 ggcagcttgcg 296

to top

>ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC523214), mRNA
          Length = 1459

 Score =  266 bits (134), Expect = 5e-68
 Identities = 197/218 (90%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 927 gccctttctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 868

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||| || ||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 867 ttggcgtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 808

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 807 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 748

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 747 gcgatctcgcgcaccagccgctggaacggcagcttgcg 710

to top

>ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA
          Length = 488

 Score =  266 bits (134), Expect = 5e-68
 Identities = 197/218 (90%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 438 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 379

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| || || || |||||||| | |||   |
Sbjct: 378 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 319

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 318 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 259

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 258 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 221

to top

>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483172), mRNA
          Length = 525

 Score =  266 bits (134), Expect = 5e-68
 Identities = 197/218 (90%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 521 gcccgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 462

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| ||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 461 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 402

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||    ||||| |||||||||||||| ||||| |||||||||||||||
Sbjct: 401 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 342

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 341 gcgatctcgcgcaccagccgctggaacggcagcttgcg 304

to top

>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483167), mRNA
          Length = 525

 Score =  266 bits (134), Expect = 5e-68
 Identities = 197/218 (90%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 521 gcccgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgc 462

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| ||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 461 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctc 402

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||    ||||| |||||||||||||| ||||| |||||||||||||||
Sbjct: 401 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 342

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 341 gcgatctcgcgcaccagccgctggaacggcagcttgcg 304

to top

>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA
          Length = 411

 Score =  266 bits (134), Expect = 5e-68
 Identities = 200/222 (90%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 248
           |||||| | |||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ctaggcgcgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 249 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactc 308
           ||||||||||||||||||||| ||||||||||||||||||||||| || ||||| | |||
Sbjct: 351 gcgcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 309 ggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtc 368
           |   |||||||| |||||    ||||| |||||||||||||| ||||| |||||||||||
Sbjct: 291 gctcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtc 232

                                                     
Query: 369 ctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 231 ctgcgcgatctcgcgcaccagccgctggaacggcagcttgcg 190

to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  266 bits (134), Expect = 5e-68
 Identities = 197/218 (90%)
 Strand = Plus / Minus

                                                                          
Query: 193    gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
              |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 139055 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 138996

                                                                          
Query: 253    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
              ||||||||||||||||| |||||||||||||| || || || |||||||| | |||   |
Sbjct: 138995 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 138936

                                                                          
Query: 313    gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
              |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 138935 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 138876

                                                    
Query: 373    gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
              |||||||| |||||||||||||||||||||||||||||
Sbjct: 138875 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 138838



 Score =  242 bits (122), Expect = 7e-61
 Identities = 194/218 (88%)
 Strand = Plus / Plus

                                                                          
Query: 193    gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
              |||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 203954 gccctctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 204013

                                                                          
Query: 253    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
              ||||||||||||||||| |||||||||||||| || || || |||||||| | |||   |
Sbjct: 204014 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 204073

                                                                          
Query: 313    gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
              |||||||| || ||    || || |||||||||||||| |||||||||||||||||||||
Sbjct: 204074 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 204133

                                                    
Query: 373    gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
              |||||||| |||||||||||||||||||||||||||||
Sbjct: 204134 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 204171

to top

>gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, complete cds
          Length = 1408

 Score =  266 bits (134), Expect = 5e-68
 Identities = 197/218 (90%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| || || || |||||||| | |||   |
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 788

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 728

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 690

to top

>gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds
          Length = 927

 Score =  266 bits (134), Expect = 5e-68
 Identities = 197/218 (90%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 745 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 686

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| || || || |||||||| | |||   |
Sbjct: 685 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 626

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 625 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 566

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 565 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 528

to top

>ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC539875), mRNA
          Length = 411

 Score =  258 bits (130), Expect = 1e-65
 Identities = 196/218 (89%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||||||||| ||||||||||||||||| || || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcgcagagattggtgtcctcgaagaggcccaccaggtaggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||| ||||| |||||||||||||||||||| 
Sbjct: 287 gcctcctgcagcgccatcaccgccgagctctgaaagcgcaggtcggtcttgaagtcctga 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccagccgctggaacggcagcttgcg 190

to top

>ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA
          Length = 492

 Score =  258 bits (130), Expect = 1e-65
 Identities = 196/218 (89%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 435 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 376

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| || || || |||||||| | |||   |
Sbjct: 375 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 316

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 315 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 256

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 255 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 218

to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  258 bits (130), Expect = 1e-65
 Identities = 196/218 (89%)
 Strand = Plus / Plus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 99526 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 99585

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             ||||||||||||||||| |||||||||||||| || || || |||||||| | |||   |
Sbjct: 99586 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 99645

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 99646 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 99705

                                                   
Query: 373   gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             |||||||| |||||||||||||||||||||||||||||
Sbjct: 99706 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 99743



 Score =  242 bits (122), Expect = 7e-61
 Identities = 194/218 (88%)
 Strand = Plus / Minus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             |||| ||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 73419 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 73360

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             ||||||||||||||||| |||||||||||||| || || || |||||||| | ||||   
Sbjct: 73359 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 73300

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 73299 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 73240

                                                   
Query: 373   gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             |||||||| |||||||||||||||||||||||||||||
Sbjct: 73239 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 73202



 Score =  234 bits (118), Expect = 2e-58
 Identities = 193/218 (88%)
 Strand = Plus / Plus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             |||| ||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 90487 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 90546

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             ||||||||||||||||| |||||||||||||| || || || || ||||| | ||||   
Sbjct: 90547 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 90606

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 90607 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 90666

                                                   
Query: 373   gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             |||||||| |||||||||||||||||||||||||||||
Sbjct: 90667 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 90704



 Score =  234 bits (118), Expect = 2e-58
 Identities = 193/218 (88%)
 Strand = Plus / Plus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 59170 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 59229

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             |||||||||||||| || |||||||||||||| || || || |||||||| | ||||   
Sbjct: 59230 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 59289

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 59290 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 59349

                                                   
Query: 373   gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             |||||||| |||||||||||||||||||||||||||||
Sbjct: 59350 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 59387

to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  258 bits (130), Expect = 1e-65
 Identities = 196/218 (89%)
 Strand = Plus / Minus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 16454 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 16395

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             ||||||||||||||||| |||||||||||||| || || || |||||||| | |||   |
Sbjct: 16394 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 16335

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 16334 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 16275

                                                   
Query: 373   gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             |||||||| |||||||||||||||||||||||||||||
Sbjct: 16274 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 16237



 Score =  242 bits (122), Expect = 7e-61
 Identities = 194/218 (88%)
 Strand = Plus / Plus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             |||| ||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 42565 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 42624

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             ||||||||||||||||| |||||||||||||| || || || |||||||| | ||||   
Sbjct: 42625 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 42684

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 42685 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 42744

                                                   
Query: 373   gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             |||||||| |||||||||||||||||||||||||||||
Sbjct: 42745 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 42782



 Score =  234 bits (118), Expect = 2e-58
 Identities = 193/218 (88%)
 Strand = Plus / Minus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 56814 gccctctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 56755

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             |||||||||||||| || |||||||||||||| || || || |||||||| | ||||   
Sbjct: 56754 ttggcgtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctc 56695

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 56694 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 56635

                                                   
Query: 373   gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             |||||||| |||||||||||||||||||||||||||||
Sbjct: 56634 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 56597



 Score =  234 bits (118), Expect = 2e-58
 Identities = 193/218 (88%)
 Strand = Plus / Minus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             |||| ||| |||||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 25493 gcccgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgc 25434

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             ||||||||||||||||| |||||||||||||| || || || || ||||| | ||||   
Sbjct: 25433 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 25374

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 25373 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 25314

                                                   
Query: 373   gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             |||||||| |||||||||||||||||||||||||||||
Sbjct: 25313 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 25276

to top

>gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, complete cds
          Length = 1405

 Score =  258 bits (130), Expect = 1e-65
 Identities = 196/218 (89%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 904 gccctctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgc 845

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| || || || |||||||| | |||   |
Sbjct: 844 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacag 785

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 784 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 725

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 724 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 687

to top

>ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611340), mRNA
          Length = 573

 Score =  256 bits (129), Expect = 5e-65
 Identities = 174/189 (92%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtc 281
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 450 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtc 391

                                                                       
Query: 282 ctcgaagagcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagct 341
           |||||||||||| || ||||| | ||||   |||||||| |||||    ||||| |||||
Sbjct: 390 ctcgaagagccccaccaggtaggcctcgcacgcctcctgcagcgccatgacggccgagct 331

                                                                       
Query: 342 ctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacgg 401
           ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 330 ctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgcaccaggcgctggaacgg 271

                    
Query: 402 cagcttgcg 410
           |||||||||
Sbjct: 270 cagcttgcg 262

to top

>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence
          Length = 716

 Score =  254 bits (128), Expect = 2e-64
 Identities = 197/220 (89%)
 Strand = Plus / Minus

                                                                       
Query: 191 aggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 250
           |||||||||| || | ||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 469 aggccctctctcccctgatgcggcgcgcgagctggatgtccttgggcatgatggtgacgc 410

                                                                       
Query: 251 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcgg 310
           ||||||||||||||||||| ||| | |||||||| |||||||| |||||||| | |||||
Sbjct: 409 gcttggcgtggatggcgcacagggtagtgtcctcaaagagccccacgaggtaggcctcgg 350

                                                                       
Query: 311 cggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcct 370
           |||||||||| ||||| || |||||||||  |||||||||||| |||||||||||| |||
Sbjct: 349 cggcctcctgcagcgcagagacggcggaggactggaagcggagatcggtcttgaagccct 290

                                                   
Query: 371 gcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||| || || ||||||||||| |||| ||||||
Sbjct: 289 gcgcgatctcacggacgaggcgctggaagggcaacttgcg 250

to top

>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds
          Length = 1264

 Score =  254 bits (128), Expect = 2e-64
 Identities = 197/220 (89%)
 Strand = Plus / Minus

                                                                       
Query: 191 aggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 250
           |||||||||| || | ||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 934 aggccctctctcccctgatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgc 875

                                                                       
Query: 251 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcgg 310
           ||||||||||||||||||||||||| |||||||| |||||||| || ||||| | |||||
Sbjct: 874 gcttggcgtggatggcgcagaggttagtgtcctcaaagagccccacaaggtaggcctcgg 815

                                                                       
Query: 311 cggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcct 370
           |||||||||| ||||| |  |||||||||  |||||||||||| ||||||||||||||||
Sbjct: 814 cggcctcctgcagcgcagcgacggcggaggactggaagcggagatcggtcttgaagtcct 755

                                                   
Query: 371 gcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||| || || ||||||||||| |||| ||||||
Sbjct: 754 gcgcgatctcacggacgaggcgctggaagggcaacttgcg 715

to top

>gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial cds, clone W1
          Length = 479

 Score =  252 bits (127), Expect = 8e-64
 Identities = 175/191 (91%)
 Strand = Plus / Minus

                                                                       
Query: 220 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtg 279
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 479 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 420

                                                                       
Query: 280 tcctcgaagagcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggag 339
           |||||||| ||||| || ||||||| |||||| ||||||||||| ||   |||||||  |
Sbjct: 419 tcctcgaacagccccaccaggtacgcctcggccgcctcctggagggccagcacggcgtgg 360

                                                                       
Query: 340 ctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaac 399
             ||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 359 gactggaagcggaggtccgtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 300

                      
Query: 400 ggcagcttgcg 410
           |||||||||||
Sbjct: 299 ggcagcttgcg 289

to top

>ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA
          Length = 480

 Score =  250 bits (126), Expect = 3e-63
 Identities = 195/218 (89%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 431 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 372

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| || || || || ||||| | ||||   
Sbjct: 371 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 312

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||    || || |||||||||||||| |||||||||||||||||||||
Sbjct: 311 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 252

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 251 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 214

to top

>ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618987), partial mRNA
          Length = 521

 Score =  250 bits (126), Expect = 3e-63
 Identities = 196/218 (89%), Gaps = 1/218 (0%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 410 gccctctctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 351

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||| || |||||||||||||| ||||| || || ||||| | ||||   
Sbjct: 350 ttggcgtggatggcacacaggttggtgtcctc-aagagtcccaccaggtaggcctcgcac 292

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 291 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 232

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 231 gcgatctcgcgcaccagccgctggaacggcagcttgcg 194

to top

>ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC613840), partial mRNA
          Length = 547

 Score =  250 bits (126), Expect = 3e-63
 Identities = 196/218 (89%), Gaps = 1/218 (0%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 436 gccctctctccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgc 377

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||| || |||||||||||||| ||||| || || ||||| | ||||   
Sbjct: 376 ttggcgtggatggcacacaggttggtgtcctc-aagagtcccaccaggtaggcctcgcac 318

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 317 gcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgc 258

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 257 gcgatctcgcgcaccagccgctggaacggcagcttgcg 220

to top

>ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618149), mRNA
          Length = 411

 Score =  250 bits (126), Expect = 3e-63
 Identities = 195/218 (89%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           ||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 407 gccctctccccgcggatccggcgggcaagctggatgtctttgggcatgatggtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||| || ||||||||||||||||||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcctcgaagagccccaccaggtaggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||| 
Sbjct: 287 gcctcctgcagcgccatcaccgcagagctctggaagcgcaggtcggtcttgaagtcctgt 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||| ||||||||
Sbjct: 227 gcgatctcgcgcaccagccgctggaacggtagcttgcg 190

to top

>gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds
          Length = 372

 Score =  250 bits (126), Expect = 3e-63
 Identities = 168/182 (92%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 309

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||||||||| | ||||  ||||||||| |||||    ||||||||||||||||||
Sbjct: 308 aggccgacgaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaag 249

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || ||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||
Sbjct: 248 cgcaggtcggtcttgaagtcctgcgcgatctcgcgcactaggcgctggaagggcagcttg 189

             
Query: 409 cg 410
           ||
Sbjct: 188 cg 187

to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score =  250 bits (126), Expect = 3e-63
 Identities = 195/218 (89%)
 Strand = Plus / Minus

                                                                        
Query: 193  gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 3041 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 2982

                                                                        
Query: 253  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
            ||||||||||||||||| |||||||||||||| || || || || ||||| | ||||   
Sbjct: 2981 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 2922

                                                                        
Query: 313  gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
            |||||||| || ||    || || |||||||||||||| |||||||||||||||||||||
Sbjct: 2921 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 2862

                                                  
Query: 373  gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            |||||||| |||||||||||||||||||||||||||||
Sbjct: 2861 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 2824

to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  250 bits (126), Expect = 3e-63
 Identities = 195/218 (89%)
 Strand = Plus / Minus

                                                                          
Query: 193    gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
              |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 143287 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 143228

                                                                          
Query: 253    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
              ||||||||||||||||| |||||||||||||| || || || || ||||| | ||||   
Sbjct: 143227 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 143168

                                                                          
Query: 313    gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
              |||||||| || ||    || || |||||||||||||| |||||||||||||||||||||
Sbjct: 143167 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 143108

                                                    
Query: 373    gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
              |||||||| |||||||||||||||||||||||||||||
Sbjct: 143107 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 143070



 Score =  250 bits (126), Expect = 3e-63
 Identities = 195/218 (89%)
 Strand = Plus / Plus

                                                                          
Query: 193    gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
              ||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 135592 gccctctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 135651

                                                                          
Query: 253    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
              ||||||||||||||||| |||||||||||||| || || || || ||||| | ||||   
Sbjct: 135652 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 135711

                                                                          
Query: 313    gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
              |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 135712 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 135771

                                                    
Query: 373    gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
              |||||||| |||||||||||||||||||||||||||||
Sbjct: 135772 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 135809



 Score =  250 bits (126), Expect = 3e-63
 Identities = 195/218 (89%)
 Strand = Plus / Minus

                                                                          
Query: 193    gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
              |||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||
Sbjct: 126431 gccctctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgc 126372

                                                                          
Query: 253    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
              ||||||||||||||||| |||||||||||||| || || || || ||||| | |||   |
Sbjct: 126371 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 126312

                                                                          
Query: 313    gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
              |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 126311 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 126252

                                                    
Query: 373    gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
              |||||||| |||||||||||||||||||||||||||||
Sbjct: 126251 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 126214

to top

>gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, complete cds
          Length = 1408

 Score =  250 bits (126), Expect = 3e-63
 Identities = 195/218 (89%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 907 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgc 848

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| || || || || ||||| | ||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctc 788

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||    || || |||||||||||||| |||||||||||||||||||||
Sbjct: 787 gcctcctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 728

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 690

to top

>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2,
           mRNA
          Length = 546

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 537 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 478

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 477 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 418

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 417 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 358

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 357 ctcgcgcaccaggcgctggaacggcagcttgcg 325

to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                        
Query: 198  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
            |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 1734 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 1675

                                                                        
Query: 258  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 1674 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 1615

                                                                        
Query: 318  ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
            ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 1614 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 1555

                                             
Query: 378  ctcccgcaccaggcgctggaacggcagcttgcg 410
            ||| |||||||||||||||||||||||||||||
Sbjct: 1554 ctcgcgcaccaggcgctggaacggcagcttgcg 1522

to top

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                        
Query: 198  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
            |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 1734 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 1675

                                                                        
Query: 258  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 1674 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 1615

                                                                        
Query: 318  ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
            ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 1614 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 1555

                                             
Query: 378  ctcccgcaccaggcgctggaacggcagcttgcg 410
            ||| |||||||||||||||||||||||||||||
Sbjct: 1554 ctcgcgcaccaggcgctggaacggcagcttgcg 1522

to top

>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2
          Length = 2927

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                        
Query: 198  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
            ||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||
Sbjct: 2757 ctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgcttggc 2698

                                                                        
Query: 258  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            |||||||||||| ||||||||||||||||| || || || ||||| | ||||   |||||
Sbjct: 2697 gtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctcgcctc 2638

                                                                        
Query: 318  ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
            ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 2637 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 2578

                                             
Query: 378  ctcccgcaccaggcgctggaacggcagcttgcg 410
            ||| |||||||||||||||||||||||||||||
Sbjct: 2577 ctcgcgcaccaggcgctggaacggcagcttgcg 2545

to top

>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430517B15
            product:unclassifiable, full insert sequence
          Length = 3217

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Plus

                                                                        
Query: 198  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
            |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 1196 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 1255

                                                                        
Query: 258  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 1256 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 1315

                                                                        
Query: 318  ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
            ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 1316 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 1375

                                             
Query: 378  ctcccgcaccaggcgctggaacggcagcttgcg 410
            ||| |||||||||||||||||||||||||||||
Sbjct: 1376 ctcgcgcaccaggcgctggaacggcagcttgcg 1408

to top

>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616
           (H2b-616) genes, complete cds
          Length = 2371

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 982 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 923

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 922 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 863

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 862 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 803

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 802 ctcgcgcaccaggcgctggaacggcagcttgcg 770

to top

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                        
Query: 198  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
            |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 2717 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 2658

                                                                        
Query: 258  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 2657 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 2598

                                                                        
Query: 318  ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
            ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 2597 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 2538

                                             
Query: 378  ctcccgcaccaggcgctggaacggcagcttgcg 410
            ||| |||||||||||||||||||||||||||||
Sbjct: 2537 ctcgcgcaccaggcgctggaacggcagcttgcg 2505

to top

>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1
          Length = 1411

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 902 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 843

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 783

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 782 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 723

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcg 690

to top

>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454
           IMAGE:5099464), complete cds
          Length = 1831

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 603 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 544

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 543 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 484

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 483 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 424

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 423 ctcgcgcaccaggcgctggaacggcagcttgcg 391

to top

>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence
          Length = 1411

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 902 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 843

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 783

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 782 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 723

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcg 690

to top

>ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone protein Hist2h3c1
           (LOC310679), mRNA
          Length = 573

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||
Sbjct: 564 ctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgcttggc 505

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| || || || ||||| | ||||   |||||
Sbjct: 504 gtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctcgcctc 445

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 444 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 385

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 384 ctcgcgcaccaggcgctggaacggcagcttgcg 352

to top

>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds
          Length = 1411

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 902 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 843

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 783

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 782 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 723

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcg 690

to top

>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds
          Length = 1675

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                        
Query: 198  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
            |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 1088 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 1029

                                                                        
Query: 258  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 1028 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 969

                                                                        
Query: 318  ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
            ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 968  ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 909

                                             
Query: 378  ctcccgcaccaggcgctggaacggcagcttgcg 410
            ||| |||||||||||||||||||||||||||||
Sbjct: 908  ctcgcgcaccaggcgctggaacggcagcttgcg 876

to top

>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds
          Length = 1500

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Plus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 519 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 578

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 579 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 638

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 639 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 698

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 699 ctcgcgcaccaggcgctggaacggcagcttgcg 731

to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                         
Query: 198   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
             |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 93734 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 93675

                                                                         
Query: 258   gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
             |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 93674 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 93615

                                                                         
Query: 318   ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
             ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 93614 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 93555

                                              
Query: 378   ctcccgcaccaggcgctggaacggcagcttgcg 410
             ||| |||||||||||||||||||||||||||||
Sbjct: 93554 ctcgcgcaccaggcgctggaacggcagcttgcg 93522



 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                         
Query: 198   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
             |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 71926 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 71867

                                                                         
Query: 258   gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
             |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 71866 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 71807

                                                                         
Query: 318   ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
             ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 71806 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 71747

                                              
Query: 378   ctcccgcaccaggcgctggaacggcagcttgcg 410
             ||| |||||||||||||||||||||||||||||
Sbjct: 71746 ctcgcgcaccaggcgctggaacggcagcttgcg 71714



 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Plus

                                                                         
Query: 198   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
             |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 63179 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 63238

                                                                         
Query: 258   gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
             |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 63239 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 63298

                                                                         
Query: 318   ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
             ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 63299 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 63358

                                              
Query: 378   ctcccgcaccaggcgctggaacggcagcttgcg 410
             ||| |||||||||||||||||||||||||||||
Sbjct: 63359 ctcgcgcaccaggcgctggaacggcagcttgcg 63391

to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                         
Query: 198   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
             |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 37514 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 37455

                                                                         
Query: 258   gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
             |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 37454 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 37395

                                                                         
Query: 318   ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
             ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 37394 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 37335

                                              
Query: 378   ctcccgcaccaggcgctggaacggcagcttgcg 410
             ||| |||||||||||||||||||||||||||||
Sbjct: 37334 ctcgcgcaccaggcgctggaacggcagcttgcg 37302



 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Plus

                                                                         
Query: 198   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
             |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 28767 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 28826

                                                                         
Query: 258   gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
             |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 28827 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 28886

                                                                         
Query: 318   ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
             ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 28887 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 28946

                                              
Query: 378   ctcccgcaccaggcgctggaacggcagcttgcg 410
             ||| |||||||||||||||||||||||||||||
Sbjct: 28947 ctcgcgcaccaggcgctggaacggcagcttgcg 28979



 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Plus

                                                                        
Query: 198  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
            |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 6959 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 7018

                                                                        
Query: 258  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 7019 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 7078

                                                                        
Query: 318  ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
            ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 7079 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 7138

                                             
Query: 378  ctcccgcaccaggcgctggaacggcagcttgcg 410
            ||| |||||||||||||||||||||||||||||
Sbjct: 7139 ctcgcgcaccaggcgctggaacggcagcttgcg 7171

to top

>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA
          Length = 411

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 402 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 343

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 283

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 223

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3
          Length = 529

 Score =  248 bits (125), Expect = 1e-62
 Identities = 187/209 (89%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 470 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggagacgcgcttggcgtgg 411

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           ||||||||||||||||| || |||||||||| |||||||||    |||||||| || |||
Sbjct: 410 atggcgcagaggttggtntcntcgaagagccngacgaggtagccttcggcggcttcttgg 351

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||||  ||||||||||||||||| |||||||| || | |||||| ||||||||||||
Sbjct: 350 agcgcggcgacggcggagctctggaaccggaggtccgtntagaagtcatgcgcgatctcc 291

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || || |||||||| || ||||||||
Sbjct: 290 cggacgagccgctggaaggggagcttgcg 262

to top

>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds
          Length = 1110

 Score =  248 bits (125), Expect = 1e-62
 Identities = 191/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 741 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 682

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 681 gtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 622

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 621 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 562

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 561 ctcgcgcaccaggcgctggaacggcagcttgcg 529

to top

>ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC525511), mRNA
          Length = 448

 Score =  244 bits (123), Expect = 2e-61
 Identities = 192/215 (89%)
 Strand = Plus / Minus

                                                                       
Query: 196 ctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 255
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 404 ctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttg 345

                                                                       
Query: 256 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcc 315
           ||||||||||| || |||||||||||||| |||||||| || ||||| | ||||   |||
Sbjct: 344 gcgtggatggcacacaggttggtgtcctcaaagagccccaccaggtaggcctcgcacgcc 285

                                                                       
Query: 316 tcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcg 375
           ||||| |||||   ||| || ||||||||||| || | ||||||||||||||||||||| 
Sbjct: 284 tcctgcagcgccatcaccgcagagctctggaaacgcaagtcggtcttgaagtcctgcgca 225

                                              
Query: 376 atctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||| |||||||| ||||||||||||||||||||
Sbjct: 224 atctcgcgcaccagccgctggaacggcagcttgcg 190

to top

>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence
          Length = 663

 Score =  242 bits (122), Expect = 7e-61
 Identities = 194/218 (88%)
 Strand = Plus / Plus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| || | |||||||||||||||||||||||||||||||||||||||||| | |
Sbjct: 154 gccctctcgcccctgatgcggcgggcgagctggatgtccttgggcatgatggtgaccctc 213

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||||||||||||||||||||||||||| || ||||||| ||| |||
Sbjct: 214 ttggcgtggatggcgcagaggttggtgtcctcgaagagccccaccaggtacgcctccgcg 273

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| ||||| | ||| || ||   |||||| || ||||| |||||||||||||||
Sbjct: 274 gcctcctgcagcgccgccaccgccgacgactggaaccgcaggtccgtcttgaagtcctgc 333

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || |||||||||||||| || ||||||||
Sbjct: 334 gcgatctcgcgaaccaggcgctggaaggggagcttgcg 371

to top

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score =  242 bits (122), Expect = 7e-61
 Identities = 185/206 (89%)
 Strand = Plus / Minus

                                                                        
Query: 205  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
            |||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2536 cggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgcttggcgtggatg 2477

                                                                        
Query: 265  gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
            ||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||||| |||
Sbjct: 2476 gcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctcctgcagc 2417

                                                                        
Query: 325  gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
            ||    ||||| |||||||||||||| ||||| ||||||||||||||||||||||| |||
Sbjct: 2416 gccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgatctcgcgc 2357

                                      
Query: 385  accaggcgctggaacggcagcttgcg 410
            ||||||||||||||||||||||||||
Sbjct: 2356 accaggcgctggaacggcagcttgcg 2331

to top

>emb|X80325.1|MPMPH315 M.pahari mpH315 gene
          Length = 974

 Score =  242 bits (122), Expect = 7e-61
 Identities = 194/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 588 gccctctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgc 529

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| || || || || ||||| | |||   |
Sbjct: 528 ttggcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacag 469

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 468 gcctcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgc 409

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| ||||| || ||||||||||||||||||||
Sbjct: 408 gcgatctcgcgcactagccgctggaacggcagcttgcg 371

to top

>gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MGC:18559
           IMAGE:4240748), complete cds
          Length = 1124

 Score =  240 bits (121), Expect = 3e-60
 Identities = 190/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 588 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 529

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || || || | ||||   |||||
Sbjct: 528 gtggatggcgcacaggttggtgtcctcgaacagccccaccagataggcctcgctcgcctc 469

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 468 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 409

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 408 ctcgcgcaccaggcgctggaacggcagcttgcg 376

to top

>ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA
          Length = 1124

 Score =  240 bits (121), Expect = 3e-60
 Identities = 190/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 588 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 529

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| ||||| || || || | ||||   |||||
Sbjct: 528 gtggatggcgcacaggttggtgtcctcgaacagccccaccagataggcctcgctcgcctc 469

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 468 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 409

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 408 ctcgcgcaccaggcgctggaacggcagcttgcg 376

to top

>gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequence
          Length = 517

 Score =  240 bits (121), Expect = 3e-60
 Identities = 187/209 (89%)
 Strand = Plus / Plus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 129 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 188

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| |||||||||||||||||||| ||||||||||| | ||||  ||||||||||
Sbjct: 189 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 248

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || ||    |||||||||||||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 249 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 308

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || ||||| |||||||| |||||||||||
Sbjct: 309 cggaccagacgctggaagggcagcttgcg 337

to top

>gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence
          Length = 517

 Score =  240 bits (121), Expect = 3e-60
 Identities = 187/209 (89%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 389 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 330

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| |||||||||||||||||||| ||||||||||| | ||||  ||||||||||
Sbjct: 329 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 270

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || ||    |||||||||||||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 269 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 210

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || ||||| |||||||| |||||||||||
Sbjct: 209 cggaccagacgctggaagggcagcttgcg 181

to top

>gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequence
          Length = 438

 Score =  240 bits (121), Expect = 3e-60
 Identities = 187/209 (89%)
 Strand = Plus / Plus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 50  ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 109

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| |||||||||||||||||||| ||||||||||| | ||||  ||||||||||
Sbjct: 110 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 169

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || ||    |||||||||||||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 170 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 229

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || ||||| |||||||| |||||||||||
Sbjct: 230 cggaccagacgctggaagggcagcttgcg 258

to top

>gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequence
          Length = 490

 Score =  240 bits (121), Expect = 3e-60
 Identities = 187/209 (89%)
 Strand = Plus / Plus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 103 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 162

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| |||||||||||||||||||| ||||||||||| | ||||  ||||||||||
Sbjct: 163 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 222

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || ||    |||||||||||||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 223 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 282

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || ||||| |||||||| |||||||||||
Sbjct: 283 cggaccagacgctggaagggcagcttgcg 311

to top

>ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (predicted)
           (Hist2h3c2_predicted), mRNA
          Length = 411

 Score =  240 bits (121), Expect = 3e-60
 Identities = 190/213 (89%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           ||||||||||||||| ||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 402 ctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgtttggc 343

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           |||||||||||| ||||||||||||||||| || || || ||||| | ||||   |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctcgcctc 283

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 223

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequence
          Length = 188026

 Score =  236 bits (119), Expect = 5e-59
 Identities = 197/223 (88%)
 Strand = Plus / Plus

                                                                          
Query: 188    cctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 247
              ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| || |
Sbjct: 183192 cctaggcccgctccccgcggatgcggcgggccagctggatgtccttgggcatgatagtca 183251

                                                                          
Query: 248    cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgact 307
              |||||||||||||||||||||| ||||| ||||| ||||| ||||| || ||||| | ||
Sbjct: 183252 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 183311

                                                                          
Query: 308    cggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagt 367
              ||  ||||||||| |||||   |||||| |||||||||||||| ||||| ||||| ||||
Sbjct: 183312 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 183371

                                                         
Query: 368    cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
              ||||||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 183372 cctgcgctatctcgcgcaccagtcgctggaaaggcagcttgcg 183414

to top

>ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616819), mRNA
          Length = 411

 Score =  236 bits (119), Expect = 5e-59
 Identities = 191/215 (88%)
 Strand = Plus / Minus

                                                                       
Query: 196 ctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 255
           |||||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||
Sbjct: 404 ctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttg 345

                                                                       
Query: 256 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcc 315
           ||||||||||| || ||||||||||| ||||||||||| || || || | ||||   |||
Sbjct: 344 gcgtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcacgcc 285

                                                                       
Query: 316 tcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcg 375
           ||||| |||||   |||||| |||||||||||||| ||||| ||||||||||||||||||
Sbjct: 284 tcctgcagcgccatcacggccgagctctggaagcgcaggtcagtcttgaagtcctgcgcg 225

                                              
Query: 376 atctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||| || ||||| ||||||||||||||||||||
Sbjct: 224 atctcgcgtaccagccgctggaacggcagcttgcg 190

to top

>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence
          Length = 639

 Score =  234 bits (118), Expect = 2e-58
 Identities = 181/202 (89%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 397 ccgcggatgcggcgggcgagctggatgtctttgggcatgatggtgacgcgcttggcgtgg 338

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||||||||||||||||||||| || ||||||||||| | ||||||||| ||||||
Sbjct: 337 atggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcctcggcggcttcctgg 278

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || ||    ||||||  ||||||||| || || || |||||||||||||| |||||||| 
Sbjct: 277 agggccaggacggcgtggctctggaaccgcagatccgtcttgaagtcctgagcgatctca 218

                                 
Query: 382 cgcaccaggcgctggaacggca 403
           || |||||||||||||| ||||
Sbjct: 217 cggaccaggcgctggaagggca 196

to top

>emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score =  234 bits (118), Expect = 2e-58
 Identities = 196/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 189 ctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 248
           ||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||
Sbjct: 648 ctaggccctctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtgac 589

                                                                       
Query: 249 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactc 308
            | |||||||||||||||||| ||||||||||||||||| || || || ||||| | |||
Sbjct: 588 cctcttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctc 529

                                                                       
Query: 309 ggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtc 368
           |   |||||||| || ||   ||| || |||||||||||||| ||||| |||||||||||
Sbjct: 528 gctcgcctcctgcagggccatcacagccgagctctggaagcgcaggtccgtcttgaagtc 469

                                                     
Query: 369 ctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||||||| ||||||||||||||| |||||||||||
Sbjct: 468 ctgcgcgatctccctcaccaggcgctggaagggcagcttgcg 427

to top

>gb|AY125229.1| Argia vivida histone 3 gene, partial cds
          Length = 372

 Score =  234 bits (118), Expect = 2e-58
 Identities = 166/182 (91%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 309

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||||||||| | |||||  |||||||| || ||    ||||||||||||||||||
Sbjct: 308 agaccgacgaggtaggcctcggacgcctcctgcagagccatgacggcggagctctggaag 249

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           ||||||||||||||||||||||| |||||||| || |||||||||||||| |||||||||
Sbjct: 248 cggaggtcggtcttgaagtcctgggcgatctcgcggaccaggcgctggaagggcagcttg 189

             
Query: 409 cg 410
           ||
Sbjct: 188 cg 187

to top

>ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 1,
           mRNA
          Length = 411

 Score =  232 bits (117), Expect = 7e-58
 Identities = 189/213 (88%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 402 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 343

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
           ||| |||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 342 gtgcatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 283

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 223

                                            
Query: 378 ctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||| |||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaagcgctggaacggcagcttgcg 190

to top

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score =  232 bits (117), Expect = 7e-58
 Identities = 189/213 (88%)
 Strand = Plus / Minus

                                                                        
Query: 198  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
            |||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||
Sbjct: 2574 ctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgtttggc 2515

                                                                        
Query: 258  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            ||| |||||||| ||||||||||||||||| ||||| || ||||| | ||||   |||||
Sbjct: 2514 gtgcatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctcgcctc 2455

                                                                        
Query: 318  ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
            ||| |||||    ||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 2454 ctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcgat 2395

                                             
Query: 378  ctcccgcaccaggcgctggaacggcagcttgcg 410
            ||| ||||||| |||||||||||||||||||||
Sbjct: 2394 ctcgcgcaccaagcgctggaacggcagcttgcg 2362

to top

>gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence
          Length = 517

 Score =  232 bits (117), Expect = 7e-58
 Identities = 186/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 388 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 329

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| |||||||||||||||||| | ||||||||||| | ||||  ||||||||||
Sbjct: 328 atggcgcacaggttggtgtcctcgaagggaccgacgaggtaagcctcgctggcctcctgg 269

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || ||    |||||||||||||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 268 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 209

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || ||||| |||||||| |||||||||||
Sbjct: 208 cggaccagacgctggaagggcagcttgcg 180

to top

>gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene
          Length = 921

 Score =  230 bits (116), Expect = 3e-57
 Identities = 188/212 (88%)
 Strand = Plus / Minus

                                                                       
Query: 198 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 257
           |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||
Sbjct: 742 ctccccgcggatgcggcgggtgagctggatgtccttgggcatgatggagacgcgcttggc 683

                                                                       
Query: 258 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctc 317
            |||||||||||||||||||||||||| |||||||| || ||||| | ||||  ||||||
Sbjct: 682 atggatggcgcagaggttggtgtcctcaaagagccccaccaggtaggcctcgctggcctc 623

                                                                       
Query: 318 ctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgat 377
           ||| || ||   |||||| || ||||||||||| || ||||||||||||||||| || ||
Sbjct: 622 ctgcagtgccatcacggctgaactctggaagcgcagatcggtcttgaagtcctgtgcaat 563

                                           
Query: 378 ctcccgcaccaggcgctggaacggcagcttgc 409
           ||| |||||||| |||||||| ||||||||||
Sbjct: 562 ctcgcgcaccagccgctggaagggcagcttgc 531

to top

>gb|L19706.1| Rattus norvegicus H3 histone gene, complete cds
          Length = 2040

 Score =  226 bits (114), Expect = 4e-56
 Identities = 192/218 (88%)
 Strand = Plus / Minus

                                                                        
Query: 193  gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
            |||||||| || || ||||||||||| |||||||||||||||||||||||||| || |||
Sbjct: 1923 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 1864

                                                                        
Query: 253  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
            ||||||||||||||||| |||||||||||||| || || || || ||||| | |||   |
Sbjct: 1863 ttggcgtggatggcgcataggttggtgtcctcaaacagacccacaaggtaggcctcacag 1804

                                                                        
Query: 313  gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
            |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||| 
Sbjct: 1803 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctga 1744

                                                  
Query: 373  gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            |||||||| |||||||||||||||||||||||||||||
Sbjct: 1743 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 1706

to top

>ref|XM_871486.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC619165), partial mRNA
          Length = 552

 Score =  226 bits (114), Expect = 4e-56
 Identities = 192/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||| |||||||||||||||||| || ||||||||||| |||||||||||||| ||||||
Sbjct: 472 gcccgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgc 413

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| ||||| ||||| || || ||||| || ||||| | ||||   
Sbjct: 412 ttggcgtggatggcgcacaggttcgtgtcttcaaacagccccaccaggtaggcctcgctc 353

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   |||||| |||||||||||||| ||||| |||||||||||||||
Sbjct: 352 gcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 293

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 292 gcgatctcgcgcaccagccgctggaacggcagcttgcg 255

to top

>ref|XM_871460.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC619141), partial mRNA
          Length = 552

 Score =  226 bits (114), Expect = 4e-56
 Identities = 192/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||| |||||||||||||||||| || ||||||||||| |||||||||||||| ||||||
Sbjct: 472 gcccgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgc 413

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| ||||| ||||| || || ||||| || ||||| | ||||   
Sbjct: 412 ttggcgtggatggcgcacaggttcgtgtcttcaaacagccccaccaggtaggcctcgctc 353

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   |||||| |||||||||||||| ||||| |||||||||||||||
Sbjct: 352 gcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 293

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 292 gcgatctcgcgcaccagccgctggaacggcagcttgcg 255

to top

>ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616800), mRNA
          Length = 411

 Score =  226 bits (114), Expect = 4e-56
 Identities = 192/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           ||||||||||||||||||||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           |||||||||||||| || ||||||||||| ||||||||||| || || || | ||||   
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || ||||||||||| || |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcactgccgagctctggaaacgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| |||||||| |||||||||||
Sbjct: 227 gcgatctcgcgtaccagccgctggaaaggcagcttgcg 190

to top

>ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
            (LOC615056), mRNA
          Length = 1029

 Score =  226 bits (114), Expect = 4e-56
 Identities = 192/218 (88%)
 Strand = Plus / Minus

                                                                        
Query: 193  gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
            |||| |||||||||||||||||| || ||||||||||| |||||||||||||| ||||||
Sbjct: 1025 gcccgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgc 966

                                                                        
Query: 253  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
            ||||||||||||||||| ||||| ||||| || || ||||| || ||||| | ||||   
Sbjct: 965  ttggcgtggatggcgcacaggttcgtgtcttcaaacagccccaccaggtaggcctcgctc 906

                                                                        
Query: 313  gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
            |||||||| |||||   |||||| |||||||||||||| ||||| |||||||||||||||
Sbjct: 905  gcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 846

                                                  
Query: 373  gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            |||||||| |||||||| ||||||||||||||||||||
Sbjct: 845  gcgatctcgcgcaccagccgctggaacggcagcttgcg 808

to top

>ref|XM_866686.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC615006), mRNA
          Length = 886

 Score =  226 bits (114), Expect = 4e-56
 Identities = 192/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||| |||||||||||||||||| || ||||||||||| |||||||||||||| ||||||
Sbjct: 806 gcccgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgc 747

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| ||||| ||||| || || ||||| || ||||| | ||||   
Sbjct: 746 ttggcgtggatggcgcacaggttcgtgtcttcaaacagccccaccaggtaggcctcgctc 687

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   |||||| |||||||||||||| ||||| |||||||||||||||
Sbjct: 686 gcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 627

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 626 gcgatctcgcgcaccagccgctggaacggcagcttgcg 589

to top

>ref|NM_001013056.1| Rattus norvegicus histone 1, H2ai (predicted)
           (Hist1h2ai_predicted), mRNA
          Length = 411

 Score =  226 bits (114), Expect = 4e-56
 Identities = 192/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| || || ||||||||||| |||||||||||||||||||||||||| || |||
Sbjct: 407 gccctctcgccacgaatgcggcgggccagctggatgtccttgggcatgatggtcacacgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| || || || || ||||| | |||   |
Sbjct: 347 ttggcgtggatggcgcataggttggtgtcctcaaacagacccacaaggtaggcctcacag 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||    ||||| |||||||||||||| |||||||||||||||||||| 
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctga 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcg 190

to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4
           (ch4-III), histone H2B (ch2b-III) and histone H2A
           (ch2a-III) genes, complete cds
          Length = 4582

 Score =  226 bits (114), Expect = 4e-56
 Identities = 183/206 (88%)
 Strand = Plus / Plus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||
Sbjct: 480 cggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggcgtggatg 539

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||||||||||||||| || || || ||||| | ||| ||||||||||| |||
Sbjct: 540 gcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcagcggcctcctgcagc 599

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   ||||||   |||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 600 gccagcacggcctggctctggaagcgcaggtcggtcttgaagtcctgggcaatctcacgg 659

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||||||||||||||||||||||||
Sbjct: 660 accaggcgctggaacggcagcttgcg 685

to top

>gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, partial cds
          Length = 373

 Score =  226 bits (114), Expect = 4e-56
 Identities = 165/182 (90%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 370 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 311

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || || |||||||| | ||||  |||||||||||| ||    ||||||||||||||||||
Sbjct: 310 agacccacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaag 251

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           ||||||||||||||||||||||| |||||||| || || || ||||||||||||| ||||
Sbjct: 250 cggaggtcggtcttgaagtcctgggcgatctcgcggacgagtcgctggaacggcaacttg 191

             
Query: 409 cg 410
           ||
Sbjct: 190 cg 189

to top

>ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476), mRNA
          Length = 576

 Score =  224 bits (113), Expect = 2e-55
 Identities = 194/221 (87%)
 Strand = Plus / Minus

                                                                       
Query: 190 taggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 249
           ||||||| ||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 575 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 516

                                                                       
Query: 250 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcg 309
           |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| | ||||
Sbjct: 515 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 456

                                                                       
Query: 310 gcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcc 369
             ||||||||| |||||   |||||| |||||||||||||| ||||| ||||| ||||||
Sbjct: 455 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcc 396

                                                    
Query: 370 tgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||||| || ||||| |||||||| |||||||||||
Sbjct: 395 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcg 355

to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
             (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
             IgG, high affinity Ia, receptor for (CD64), a novel gene
             similar to histone 2, H2be (HIST2H2BE), a novel gene
             similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
             histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
             HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
             pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
             (HIST2H2BC), a novel gene similar to histone 2, H2aa
             (HIST2H2AA), a novel gene similar to histone 2, H3c
             (HIST2H3C), a novel gene similar to histone 1, H4
             (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
             HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
             histone 2, H2ab, a novel protein similar to histone 2, a
             novel gene, the SV2A gene for synaptic vesicle
             glycoprotein 2A, the 3' end of the SF3B4 gene for splicing
             factor 3b, subunit 4, 49kDa and five CpG islands, complete
             sequence
          Length = 188956

 Score =  224 bits (113), Expect = 2e-55
 Identities = 194/221 (87%)
 Strand = Plus / Plus

                                                                         
Query: 190   taggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 249
             ||||||| ||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 74987 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 75046

                                                                         
Query: 250   cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcg 309
             |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| | ||||
Sbjct: 75047 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 75106

                                                                         
Query: 310   gcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcc 369
               ||||||||| |||||   |||||| |||||||||||||| ||||| ||||| ||||||
Sbjct: 75107 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcc 75166

                                                      
Query: 370   tgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             ||||||||||| || ||||| |||||||| |||||||||||
Sbjct: 75167 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcg 75207



 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                          
Query: 205    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
              |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 114771 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 114712

                                                                          
Query: 265    gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
              ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 114711 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 114652

                                                                          
Query: 325    gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
              ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 114651 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 114592

                                        
Query: 385    accaggcgctggaacggcagcttgcg 410
              ||||| |||||||| |||||||||||
Sbjct: 114591 accagccgctggaagggcagcttgcg 114566



 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Plus

                                                                          
Query: 205    cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
              |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 102495 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 102554

                                                                          
Query: 265    gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
              ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 102555 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 102614

                                                                          
Query: 325    gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
              ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 102615 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 102674

                                        
Query: 385    accaggcgctggaacggcagcttgcg 410
              ||||| |||||||| |||||||||||
Sbjct: 102675 accagccgctggaagggcagcttgcg 102700

to top

>ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, family 2 isoform 2
           (LOC653604), mRNA
          Length = 543

 Score =  224 bits (113), Expect = 2e-55
 Identities = 194/221 (87%)
 Strand = Plus / Minus

                                                                       
Query: 190 taggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 249
           ||||||| ||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 542 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 483

                                                                       
Query: 250 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcg 309
           |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| | ||||
Sbjct: 482 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 423

                                                                       
Query: 310 gcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcc 369
             ||||||||| |||||   |||||| |||||||||||||| ||||| ||||| ||||||
Sbjct: 422 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcc 363

                                                    
Query: 370 tgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||||| || ||||| |||||||| |||||||||||
Sbjct: 362 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcg 322

to top

>gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cds, clone B1
          Length = 494

 Score =  220 bits (111), Expect = 3e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtg 279
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 494 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 435

                                                                       
Query: 280 tcctcgaagagcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggag 339
           |||||||| ||||||   ||||| | |||||| ||||||||||| ||   |||||||  |
Sbjct: 434 tcctcgaacagcccgcgaaggtatgcctcggcagcctcctggagggccagcacggcgtgg 375

                                                                       
Query: 340 ctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaac 399
             |||||| | ||||||||||||||||||||| |||||||||| ||||||||||||||||
Sbjct: 374 gactggaacctgaggtcggtcttgaagtcctgagcgatctccctcaccaggcgctggaac 315

                      
Query: 400 ggcagcttgcg 410
           |||||||||||
Sbjct: 314 ggcagcttgcg 304

to top

>ref|XM_527604.1| PREDICTED: Pan troglodytes similar to histone 1, H3g (LOC472230),
           mRNA
          Length = 411

 Score =  218 bits (110), Expect = 1e-53
 Identities = 191/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 347 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| |||||||| |||||||||||
Sbjct: 227 gcgatctcacgtaccagacgctggaatggcagcttgcg 190

to top

>gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds
          Length = 372

 Score =  218 bits (110), Expect = 1e-53
 Identities = 164/182 (90%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaag 309

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||| ||||| | ||||  ||||||||| |||||    ||||||||||||||||| 
Sbjct: 308 aggccgacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaac 249

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           |||||||| ||||||||||||||||| ||||| ||||||||||||||||| |||||||||
Sbjct: 248 cggaggtccgtcttgaagtcctgcgctatctcgcgcaccaggcgctggaagggcagcttg 189

             
Query: 409 cg 410
           ||
Sbjct: 188 cg 187

to top

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
           genes, complete cds
          Length = 1338

 Score =  218 bits (110), Expect = 1e-53
 Identities = 182/206 (88%)
 Strand = Plus / Plus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||
Sbjct: 216 cggatgcggcgggccagctggatgtccttgggcatgatggtcacacgcttggcgtggatg 275

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||||||||| || || || ||||| | ||| ||||||||||| |||
Sbjct: 276 gcgcacaggttcgtgtcctcgaacaggcccaccaggtaggcctcagcggcctcctgcagc 335

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   ||||||   |||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 336 gccagcacggcctggctctggaagcgcaggtcggtcttgaagtcctgggcaatctcacgg 395

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||||||||||||||||||||||||
Sbjct: 396 accaggcgctggaacggcagcttgcg 421

to top

>gb|AY749737.1| Platybaetis probus histone H3 (H3) gene, partial cds
          Length = 376

 Score =  218 bits (110), Expect = 1e-53
 Identities = 164/182 (90%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaag 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||||||||| | ||||  ||||||||| || ||   |||||| ||||||||||||
Sbjct: 311 aggccgacgaggtaggcctcgctggcctcctgcagggccatcacggccgagctctggaag 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || |||||||||||||||||||| |||||||| ||||| || ||||||||||||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgagcgatctcacgcacgagccgctggaacggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds
          Length = 375

 Score =  218 bits (110), Expect = 1e-53
 Identities = 164/182 (90%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||| ||||| | ||||  ||||||||| || ||   |||||| ||||||||||||
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatcacggccgagctctggaag 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || |||||||||||||||||||| |||||||| |||||||| |||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgcaccagacgctggaagggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  218 bits (110), Expect = 1e-53
 Identities = 164/182 (90%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaag 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||||||||| | ||||  |||||||||||| ||    || || ||||||||||||
Sbjct: 311 agaccgacgaggtaggcctcgctggcctcctggagggccatgactgccgagctctggaag 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           ||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||
Sbjct: 251 cggaggtcggtcttgaagtcctgcgcgatttcacgcaccaggcgctggaagggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA
          Length = 507

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 431 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 372

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 371 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 312

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 311 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 252

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| |||||||||||
Sbjct: 251 accagccgctggaagggcagcttgcg 226

to top

>gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds
          Length = 1227

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 804 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 745

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 744 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 685

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 684 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 625

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| |||||||||||
Sbjct: 624 accagccgctggaagggcagcttgcg 599

to top

>gb|BC067492.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC:79345
           IMAGE:7002073), complete cds
          Length = 468

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 347 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 227 gcgatctcacgtaccagacgctggaatggtagcttgcg 190

to top

>ref|XM_580747.2| PREDICTED: Bos taurus similar to CG31613-PA (LOC504599), mRNA
          Length = 411

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||| ||||||||||||||| || || ||||||||||| |||||||||||||| ||||||
Sbjct: 407 gcccgctccccgcggatgcgacgagccagctggatgtctttgggcatgatggtcacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| ||||| ||||| || || ||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttcgtgtcttcaaacagccccaccaggtaggcctcgctc 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   |||||| |||||||||||||| || |||||||| |||||||||
Sbjct: 287 gcctcctgcagcgccatcacggccgagctctggaagcgcagatcggtcttaaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccagccgctggaacggcagcttgcg 190

to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6
          Length = 269712

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Plus

                                                                          
Query: 193    gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
              |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 234199 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 234258

                                                                          
Query: 253    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
              ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 234259 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 234318

                                                                          
Query: 313    gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
              |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 234319 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 234378

                                                    
Query: 373    gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
              |||||||| || ||||| |||||||| || ||||||||
Sbjct: 234379 gcgatctcacgtaccagacgctggaatggtagcttgcg 234416



 Score =  194 bits (98), Expect = 2e-46
 Identities = 179/206 (86%)
 Strand = Plus / Minus

                                                                        
Query: 193  gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
            |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 4838 gccctctctccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 4779

                                                                        
Query: 253  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
            ||||||||||||||||| ||||| |||||||| || ||||| || | ||| | ||||   
Sbjct: 4778 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 4719

                                                                        
Query: 313  gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
            |||||||| || ||   ||| |||||||||||||| || ||||| || || |||||||||
Sbjct: 4718 gcctcctgcagagccatcacagcggagctctggaaacgcaggtctgttttaaagtcctgc 4659

                                      
Query: 373  gcgatctcccgcaccaggcgctggaa 398
            || ||||| |||||||||||||||||
Sbjct: 4658 gcaatctcgcgcaccaggcgctggaa 4633



 Score =  180 bits (91), Expect = 2e-42
 Identities = 184/215 (85%)
 Strand = Plus / Minus

                                                                          
Query: 193    gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
              ||||||||||| || ||||||||||| ||||||||||| || ||||||||||| ||||| 
Sbjct: 209561 gccctctccccacgaatgcggcgggcaagctggatgtctttaggcatgatggtcacgcgt 209502

                                                                          
Query: 253    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
              ||||| || || ||||| ||||||||||||||||| ||||| || | ||| | ||||  |
Sbjct: 209501 ttggcatgaatagcgcacaggttggtgtcctcgaaaagccccaccaagtaggcctcgcag 209442

                                                                          
Query: 313    gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
              |||||||| |||||   ||| ||||| ||||||||||| |||||||||||||||||||| 
Sbjct: 209441 gcctcctgcagcgccatcaccgcggaactctggaagcgcaggtcggtcttgaagtcctga 209382

                                                 
Query: 373    gcgatctcccgcaccaggcgctggaacggcagctt 407
              || || || |||||||||||||| |||||||||||
Sbjct: 209381 gctatttctcgcaccaggcgctgaaacggcagctt 209347



 Score =  163 bits (82), Expect = 6e-37
 Identities = 184/218 (84%)
 Strand = Plus / Plus

                                                                          
Query: 193    gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
              ||||||||||| || |||||||| || ||||||||||||||||||||||| || || |||
Sbjct: 180844 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 180903

                                                                          
Query: 253    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
              |||||||| |||||||| |||||||||||||| || ||||| || ||||| | ||||  |
Sbjct: 180904 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 180963

                                                                          
Query: 313    gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
              |||||||| |||||   ||| || |||||||| || || || || |||||||||||||||
Sbjct: 180964 gcctcctgcagcgccatcaccgccgagctctgaaaacgcagatcagtcttgaagtcctgc 181023

                                                    
Query: 373    gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
              |||||||| || || || |||||||| ||||| |||||
Sbjct: 181024 gcgatctcacggactagacgctggaatggcagtttgcg 181061



 Score =  149 bits (75), Expect = 8e-33
 Identities = 180/215 (83%)
 Strand = Plus / Minus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             ||||| ||||| |||||||| || || |||||||| || |||||||||||||||||||| 
Sbjct: 29759 gccctttccccacggatgcgacgtgccagctggatatctttgggcatgatggtgacgcgt 29700

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             || ||||| || ||||| || |||||||| |||||||| || || ||||| | |||    
Sbjct: 29699 ttagcgtgaatagcgcacagattggtgtcttcgaagagtcccaccaggtaggcctcacaa 29640

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| |||||   ||| || ||||||||||| || |||||||| ||||||||||| 
Sbjct: 29639 gcctcctgcagcgccatcaccgcagagctctggaaacgcaggtcggttttgaagtcctgg 29580

                                                
Query: 373   gcgatctcccgcaccaggcgctggaacggcagctt 407
             ||||| || ||||||||||||||||||||||||||
Sbjct: 29579 gcgatttctcgcaccaggcgctggaacggcagctt 29545



 Score =  147 bits (74), Expect = 3e-32
 Identities = 173/206 (83%)
 Strand = Plus / Plus

                                                                         
Query: 202   ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
             ||||| |||||||| |||||||||||||| |||||||| || || || ||||| || |||
Sbjct: 15605 ccgcgaatgcggcgagcgagctggatgtctttgggcataatagtcactcgcttagcatgg 15664

                                                                         
Query: 262   atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
             |||||||| ||||| |||||||| |||||||| || | ||| | |||    |||||||| 
Sbjct: 15665 atggcgcaaaggtttgtgtcctcaaagagccctaccaagtaggcctcacaagcctcctgc 15724

                                                                         
Query: 322   agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
             |||||   ||| || |||||||||||||| || |||||||||||||| || ||||| || 
Sbjct: 15725 agcgccatcaccgcagagctctggaagcgaagatcggtcttgaagtcttgggcgatttct 15784

                                       
Query: 382   cgcaccaggcgctggaacggcagctt 407
             ||||||||||||||||||||||||||
Sbjct: 15785 cgcaccaggcgctggaacggcagctt 15810



 Score =  133 bits (67), Expect = 5e-28
 Identities = 178/215 (82%)
 Strand = Plus / Plus

                                                                          
Query: 196    ctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 255
              |||||||| || |||||||| |||||||| ||||||||||||||||| || || ||||| 
Sbjct: 254981 ctctccccacgaatgcggcgagcgagctgaatgtccttgggcatgatagtcactcgctta 255040

                                                                          
Query: 256    gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcc 315
              || |||||||| || |||||||| ||||| |||||||| || | ||| | ||||  ||||
Sbjct: 255041 gcatggatggcacacaggttggtatcctcaaagagccccaccaagtaggcctcgcaggcc 255100

                                                                          
Query: 316    tcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcg 375
              ||||| || ||   ||| ||||| ||||| ||||| || || |||||||||||||| |||
Sbjct: 255101 tcctgcagggccatcaccgcggaactctgaaagcgcagatctgtcttgaagtcctgagcg 255160

                                                 
Query: 376    atctcccgcaccaggcgctggaacggcagcttgcg 410
              || || ||||||||||| ||||| |||| ||||||
Sbjct: 255161 atttctcgcaccaggcgttggaaaggcaacttgcg 255195

to top

>gb|AF531279.1| Homo sapiens histone H3 (HIST1H3F) gene, complete cds
          Length = 1227

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 816 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 757

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 756 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 697

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 696 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 637

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 636 gcgatctcacgtaccagacgctggaatggtagcttgcg 599

to top

>gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNING: chimeric clone
           ****
          Length = 1047

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 408 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 349

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 348 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 289

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 288 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 229

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| |||||||||||
Sbjct: 228 accagccgctggaagggcagcttgcg 203

to top

>gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMAGE:3913365)
          Length = 1672

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 431 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 372

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 371 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 312

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 311 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 252

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| |||||||||||
Sbjct: 251 accagccgctggaagggcagcttgcg 226

to top

>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2
             Contains seventeen histone (pseudo)genes and gene RPS10P1
             (40S Ribosomal protein S10 pseudogene 1), three CpG
             islands, ESTs, STSs and GSSs, complete sequence
          Length = 89301

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Plus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 55581 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 55640

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 55641 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 55700

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 55701 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 55760

                                                   
Query: 373   gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             |||||||| || ||||| |||||||| || ||||||||
Sbjct: 55761 gcgatctcacgtaccagacgctggaatggtagcttgcg 55798



 Score =  180 bits (91), Expect = 2e-42
 Identities = 184/215 (85%)
 Strand = Plus / Minus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             ||||||||||| || ||||||||||| ||||||||||| || ||||||||||| ||||| 
Sbjct: 30943 gccctctccccacgaatgcggcgggcaagctggatgtctttaggcatgatggtcacgcgt 30884

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             ||||| || || ||||| ||||||||||||||||| ||||| || | ||| | ||||  |
Sbjct: 30883 ttggcatgaatagcgcacaggttggtgtcctcgaaaagccccaccaagtaggcctcgcag 30824

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| |||||   ||| ||||| ||||||||||| |||||||||||||||||||| 
Sbjct: 30823 gcctcctgcagcgccatcaccgcggaactctggaagcgcaggtcggtcttgaagtcctga 30764

                                                
Query: 373   gcgatctcccgcaccaggcgctggaacggcagctt 407
             || || || |||||||||||||| |||||||||||
Sbjct: 30763 gctatttctcgcaccaggcgctgaaacggcagctt 30729



 Score =  163 bits (82), Expect = 6e-37
 Identities = 184/218 (84%)
 Strand = Plus / Plus

                                                                        
Query: 193  gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
            ||||||||||| || |||||||| || ||||||||||||||||||||||| || || |||
Sbjct: 2226 gccctctccccacgaatgcggcgagcaagctggatgtccttgggcatgatagtcactcgc 2285

                                                                        
Query: 253  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
            |||||||| |||||||| |||||||||||||| || ||||| || ||||| | ||||  |
Sbjct: 2286 ttggcgtgaatggcgcataggttggtgtcctcaaacagccccaccaggtaggcctcgcag 2345

                                                                        
Query: 313  gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
            |||||||| |||||   ||| || |||||||| || || || || |||||||||||||||
Sbjct: 2346 gcctcctgcagcgccatcaccgccgagctctgaaaacgcagatcagtcttgaagtcctgc 2405

                                                  
Query: 373  gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            |||||||| || || || |||||||| ||||| |||||
Sbjct: 2406 gcgatctcacggactagacgctggaatggcagtttgcg 2443



 Score =  133 bits (67), Expect = 5e-28
 Identities = 178/215 (82%)
 Strand = Plus / Plus

                                                                         
Query: 196   ctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 255
             |||||||| || |||||||| |||||||| ||||||||||||||||| || || ||||| 
Sbjct: 76363 ctctccccacgaatgcggcgagcgagctgaatgtccttgggcatgatagtcactcgctta 76422

                                                                         
Query: 256   gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcc 315
             || |||||||| || |||||||| ||||| |||||||| || | ||| | ||||  ||||
Sbjct: 76423 gcatggatggcacacaggttggtatcctcaaagagccccaccaagtaggcctcgcaggcc 76482

                                                                         
Query: 316   tcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcg 375
             ||||| || ||   ||| ||||| ||||| ||||| || || |||||||||||||| |||
Sbjct: 76483 tcctgcagggccatcaccgcggaactctgaaagcgcagatctgtcttgaagtcctgagcg 76542

                                                
Query: 376   atctcccgcaccaggcgctggaacggcagcttgcg 410
             || || ||||||||||| ||||| |||| ||||||
Sbjct: 76543 atttctcgcaccaggcgttggaaaggcaacttgcg 76577

to top

>gb|BC096131.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC:116777
           IMAGE:40002512), complete cds
          Length = 463

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 347 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 227 gcgatctcacgtaccagacgctggaatggtagcttgcg 190

to top

>ref|NM_021018.2| Homo sapiens histone 1, H3f (HIST1H3F), mRNA
          Length = 466

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 409 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 350

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 349 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 290

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 289 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 230

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 229 gcgatctcacgtaccagacgctggaatggtagcttgcg 192

to top

>ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (LOC653611), mRNA
          Length = 824

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 684 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 625

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 624 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 565

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 564 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 505

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| |||||||||||
Sbjct: 504 accagccgctggaagggcagcttgcg 479

to top

>emb|CR542011.1| Homo sapiens full open reading frame cDNA clone RZPDo834F0335D for
           gene HIST1H3F, histone 1, H3f; complete cds, without
           stopcodon
          Length = 408

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 347 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 227 gcgatctcacgtaccagacgctggaatggtagcttgcg 190

to top

>emb|CR541983.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0335D for
           gene HIST1H3F, histone 1, H3f; complete cds, incl.
           stopcodon
          Length = 411

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 347 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 227 gcgatctcacgtaccagacgctggaatggtagcttgcg 190

to top

>ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudogene on chromosome 1
          Length = 1323

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 918 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 859

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 858 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 799

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 798 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 739

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| |||||||||||
Sbjct: 738 accagccgctggaagggcagcttgcg 713

to top

>ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA
          Length = 411

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 395 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 336

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 335 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 276

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 275 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 216

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| |||||||||||
Sbjct: 215 accagccgctggaagggcagcttgcg 190

to top

>gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE:30915509),
           partial cds
          Length = 481

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 423 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 364

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 363 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 304

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 303 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 244

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| |||||||||||
Sbjct: 243 accagccgctggaagggcagcttgcg 218

to top

>gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete cds
          Length = 1227

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 804 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 745

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 744 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 685

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 684 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 625

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| |||||||||||
Sbjct: 624 accagccgctggaagggcagcttgcg 599

to top

>gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, complete sequence
          Length = 1323

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 918 cggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttggcgtggatg 859

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||| ||||| ||||| ||||| || ||||| | ||||  ||||||||| |||
Sbjct: 858 gcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcctcctgcagc 799

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   |||||| |||||||||||||| ||||| ||||| ||||||||||||||||| || 
Sbjct: 798 gccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcgatctcgcgt 739

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| |||||||||||
Sbjct: 738 accagccgctggaagggcagcttgcg 713

to top

>gb|BC069818.1| Homo sapiens histone 1, H3f, mRNA (cDNA clone MGC:97445
           IMAGE:7262721), complete cds
          Length = 463

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 409 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 350

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 349 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 290

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 289 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 230

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 229 gcgatctcacgtaccagacgctggaatggtagcttgcg 192

to top

>emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11
          Length = 538

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| || ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 425 gccctctcgcctcggatcctgcgggccagctggatgtccttgggcatgatggtgaccctc 366

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| ||||| ||||| || || | ||||  |
Sbjct: 365 ttggcgtggatggcgcacaggttggtgtcctcaaagagaccgaccagataagcctcgctg 306

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||    ||||| |||||||||||||| |||||||||||||||||||| 
Sbjct: 305 gcctcctgcagagccatgacggctgagctctggaagcgcaggtcggtcttgaagtcctga 246

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||||| |||||||||||||| ||||| |||||
Sbjct: 245 gcgatctcccggaccaggcgctggaaaggcagtttgcg 208

to top

>emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chromosome 11, complete
             sequence
          Length = 103129

 Score =  210 bits (106), Expect = 3e-51
 Identities = 196/226 (86%)
 Strand = Plus / Minus

                                                                         
Query: 185   gagcctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatgg 244
             ||||||| ||||  || ||||||||||| || || | ||||||||| |||||||||||||
Sbjct: 46698 gagcctaagcccgttctccgcggatgcgccgagccaactggatgtctttgggcatgatgg 46639

                                                                         
Query: 245   tgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacg 304
             | || |||||||||||||| ||||| ||||| ||||| ||||| ||||| ||||||||||
Sbjct: 46638 tcacccgcttggcgtggatagcgcacaggttcgtgtcttcgaacagccccacgaggtacg 46579

                                                                         
Query: 305   actcggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttga 364
             |||||  ||||||||| |||||   ||| ||||||||||||||||| |||||||||||||
Sbjct: 46578 actcgcaggcctcctgcagcgccatcaccgcggagctctggaagcgcaggtcggtcttga 46519

                                                           
Query: 365   agtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             ||||||| |||||||| ||||||| ||||||||| |||| ||||||
Sbjct: 46518 agtcctgggcgatctcacgcaccaagcgctggaatggcaacttgcg 46473

to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
           histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
           complete cds
          Length = 3777

 Score =  210 bits (106), Expect = 3e-51
 Identities = 181/206 (87%)
 Strand = Plus / Plus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           |||||||||||||| ||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 260 cggatgcggcgggccagctggatgtccttgggcatgatcgtcacacgcttggcgtggatg 319

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| ||||||||||||||||| || || || ||||| | ||||||||||||||| |||
Sbjct: 320 gcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcggcggcctcctgtagc 379

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||   ||||||   ||| ||||| || |||||||||||||||||||| || ||||| || 
Sbjct: 380 gccagcacggcctggctttggaaacgcaggtcggtcttgaagtcctgggcaatctcacgg 439

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||||||||||||||||||||||||
Sbjct: 440 accaggcgctggaacggcagcttgcg 465

to top

>gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, partial cds
          Length = 361

 Score =  210 bits (106), Expect = 3e-51
 Identities = 160/178 (89%)
 Strand = Plus / Minus

                                                                       
Query: 233 tgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcc 292
           |||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||| |
Sbjct: 361 tgggcatgatggtgacgcgcttagcgtggattgcgcacaggttggtgtcctcgaagagac 302

                                                                       
Query: 293 cgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcgga 352
           |||||||||| | ||||  |||||||||||| ||    ||||||||||||||||||||||
Sbjct: 301 cgacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaagcgga 242

                                                                     
Query: 353 ggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||||||||||||| |||||||| || || ||||||||||| |||||||||||
Sbjct: 241 ggtcggtcttgaagtcctgagcgatctcgcggacgaggcgctggaagggcagcttgcg 184

to top

>gb|AY749744.1| Dipteromimus sp. EP150 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  210 bits (106), Expect = 3e-51
 Identities = 163/182 (89%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaac 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||||||||| | ||||  ||||||||| |||||    ||||| ||||||||||||
Sbjct: 311 agaccgacgaggtaagcctcgctggcctcctgcagcgccatgacggcagagctctggaag 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || ||||| |||||||||||||| |||||||| |||||||| |||||||| |||||||||
Sbjct: 251 cgcaggtccgtcttgaagtcctgggcgatctcgcgcaccagccgctggaagggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial cds
          Length = 375

 Score =  210 bits (106), Expect = 3e-51
 Identities = 163/182 (89%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || || |||||||| | ||||  ||||||||| || ||   |||||||||||||||||| 
Sbjct: 311 agacccacgaggtaagcctcgctggcctcctgcagagccatcacggcggagctctggaaa 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           ||||||||||||||||||||||| ||||| || ||||||||||| ||||| ||||| |||
Sbjct: 251 cggaggtcggtcttgaagtcctgtgcgatttcacgcaccaggcgttggaagggcagtttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>emb|Z80786.1|HSH3I H.sapiens H3/i gene
          Length = 701

 Score =  210 bits (106), Expect = 3e-51
 Identities = 190/218 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| ||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 546 gccctctctccgcgaatgcggcgagcgagctggatgtccttgggcatgatagtcactcgc 487

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||| || || |||||||||||||| |||||||| || ||||| | ||||  |
Sbjct: 486 ttggcgtggatagcacacaggttggtgtcctcaaagagccccaccaggtaagcctcgcag 427

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   ||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 426 gcctcctgcagcgccatcacagccgagctctggaagcgcaggtcggtcttgaagtcctgc 367

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| |||||||| || ||||||||
Sbjct: 366 gcgatctcacgtaccagacgctggaatggtagcttgcg 329

to top

>ref|XM_356549.3| PREDICTED: Mus musculus similar to histone 1, H2ai (predicted)
           (LOC382523), mRNA
          Length = 411

 Score =  208 bits (105), Expect = 1e-50
 Identities = 183/209 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||| || || | ||||||||| |||||||||||||| || ||||||||||||
Sbjct: 398 ccgcggatgcgccgagccaactggatgtctttgggcatgatggtcacccgcttggcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           || ||||| ||||| ||||| ||||| ||||| |||||||||||||||  ||||||||| 
Sbjct: 338 atagcgcacaggttcgtgtcttcgaacagccccacgaggtacgactcgcaggcctcctgc 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||   ||| ||||||||||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 278 agcgccatcaccgcggagctctggaagcgcaggtcggtcttgaagtcctgggcgatctca 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           ||||||| ||||||||| |||| ||||||
Sbjct: 218 cgcaccaagcgctggaatggcaacttgcg 190

to top

>gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 protein mRNA,
           complete cds
          Length = 610

 Score =  208 bits (105), Expect = 1e-50
 Identities = 187/212 (88%), Gaps = 3/212 (1%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 499 ccgcgaatacggcgtgcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtgg 440

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagag--cccgacg-aggtacgactcggcggcctcc 318
           |||||||| | ||||||||||||||| ||  ||| ||| ||||| | |||||||||||| 
Sbjct: 439 atggcgcacaagttggtgtcctcgaacagtcccccacgaaggtaggcctcggcggcctct 380

                                                                       
Query: 319 tggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatc 378
           || ||||||  |||||| |||||||||||||| ||||||| |||||||||||| ||||||
Sbjct: 379 tgcagcgcgagcacggccgagctctggaagcgcaggtcggacttgaagtcctgggcgatc 320

                                           
Query: 379 tcccgcaccaggcgctggaacggcagcttgcg 410
           || || || |||||||||||||| ||||||||
Sbjct: 319 tcacggacgaggcgctggaacggaagcttgcg 288

to top

>gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  208 bits (105), Expect = 1e-50
 Identities = 159/177 (89%)
 Strand = Plus / Minus

                                                                       
Query: 234 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 293
           |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaagaggcc 295

                                                                       
Query: 294 gacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcggag 353
           ||| ||||| | ||||  ||||||||| |||||    ||||||||||||||||| |||||
Sbjct: 294 gacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaaccggag 235

                                                                    
Query: 354 gtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| ||||||||||||||||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 234 gtccgtcttgaagtcctgcgctatctcgcgcaccaggcgctggaagggcagcttgcg 178

to top

>gb|AY749703.1| Callibaetis sp. EP020 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  206 bits (104), Expect = 4e-50
 Identities = 162/182 (89%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacangttggtgtcctcgaag 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||| ||||| | ||||  ||||||||| |  ||   |||||| ||||||||||||
Sbjct: 311 agaccgaccaggtangcctcgctggcctcctgcaaagccatcacggcagagctctggaag 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || |||||||||||||||||||||||||| || |||||||| |||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgcgcgatttcacgcaccagccgctggaagggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462
          Length = 2706

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                        
Query: 193  gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
            |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 2289 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 2230

                                                                        
Query: 253  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
            ||||||||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 2229 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 2170

                                                                        
Query: 313  gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
            ||||| || |||||   ||| ||||||||||||||||| | |||||||||||||||||||
Sbjct: 2169 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 2110

                                               
Query: 373  gcgatctcccgcaccaggcgctggaacggcagctt 407
            |||||||| |||||||| ||||| || ||||||||
Sbjct: 2109 gcgatctcacgcaccagacgctgaaaaggcagctt 2075

to top

>gb|BC007518.2| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:4577
           IMAGE:3030790), complete cds
          Length = 1387

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 545 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 486

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 485 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 426

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           ||||| || |||||   ||| ||||||||||||||||| | |||||||||||||||||||
Sbjct: 425 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 366

                                              
Query: 373 gcgatctcccgcaccaggcgctggaacggcagctt 407
           |||||||| |||||||| ||||| || ||||||||
Sbjct: 365 gcgatctcacgcaccagacgctgaaaaggcagctt 331

to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Plus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 83972 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 84031

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             ||||||||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 84032 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 84091

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             ||||| || |||||   ||| ||||||||||||||||| | |||||||||||||||||||
Sbjct: 84092 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 84151

                                                
Query: 373   gcgatctcccgcaccaggcgctggaacggcagctt 407
             |||||||| |||||||| ||||| || ||||||||
Sbjct: 84152 gcgatctcacgcaccagacgctgaaaaggcagctt 84186



 Score =  149 bits (75), Expect = 8e-33
 Identities = 171/203 (84%)
 Strand = Plus / Minus

                                                                         
Query: 193   gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
             ||||||||||| ||||||||||| || ||||||||||| || ||||| || |||||||| 
Sbjct: 22543 gccctctcccctcggatgcggcgcgcaagctggatgtctttaggcataatagtgacgcgt 22484

                                                                         
Query: 253   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
             |||||||| |||||||| |||||||| ||||| || ||||| || ||||| | ||||   
Sbjct: 22483 ttggcgtgaatggcgcacaggttggtatcctcaaatagccccaccaggtaggcctcgcaa 22424

                                                                         
Query: 313   gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
             |||||||| |||||   ||| || |||||||||||||| || |||||||| |||||||| 
Sbjct: 22423 gcctcctgcagcgccatcaccgccgagctctggaagcgcagatcggtcttaaagtcctgt 22364

                                    
Query: 373   gcgatctcccgcaccaggcgctg 395
             ||||||||||| |||| ||||||
Sbjct: 22363 gcgatctcccgtaccaagcgctg 22341



 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                        
Query: 220  agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtg 279
            |||||||||||||| ||||| || ||||| ||||||||||| || || ||||||||||||
Sbjct: 4039 agctggatgtccttaggcataatagtgacacgcttggcgtgaatagcacagaggttggtg 3980

                                                                        
Query: 280  tcctcgaagagcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggag 339
            || || ||||| || || || || | ||||   ||||| || |||||   ||| || |||
Sbjct: 3979 tcttcaaagagacccaccagataggcctcgcacgcctcttgcagcgccatcaccgccgag 3920

                                                                        
Query: 340  ctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaac 399
            |||||||| || |||||||| ||||| ||||||||||| || |||||||||||||| || 
Sbjct: 3919 ctctggaaacgaaggtcggttttgaaatcctgcgcgatttctcgcaccaggcgctgaaat 3860

                       
Query: 400  ggcagcttgcg 410
            ||||| |||||
Sbjct: 3859 ggcagtttgcg 3849

to top

>ref|NM_003536.2| Homo sapiens histone 1, H3h (HIST1H3H), mRNA
          Length = 473

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 417 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 358

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 357 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 298

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           ||||| || |||||   ||| ||||||||||||||||| | |||||||||||||||||||
Sbjct: 297 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 238

                                              
Query: 373 gcgatctcccgcaccaggcgctggaacggcagctt 407
           |||||||| |||||||| ||||| || ||||||||
Sbjct: 237 gcgatctcacgcaccagacgctgaaaaggcagctt 203

to top

>gb|AF531281.1| Homo sapiens histone H3 (HIST1H3H) gene, complete cds
          Length = 1227

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 817 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 758

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 757 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 698

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           ||||| || |||||   ||| ||||||||||||||||| | |||||||||||||||||||
Sbjct: 697 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 638

                                              
Query: 373 gcgatctcccgcaccaggcgctggaacggcagctt 407
           |||||||| |||||||| ||||| || ||||||||
Sbjct: 637 gcgatctcacgcaccagacgctgaaaaggcagctt 603

to top

>emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 on chromosome 6p21.3-22.2
              Contains a novel pseudogene, a 60S Ribosomal protein L30
              (RPL30) pseudogene, H4 histone family member F pseudogene
              H4FFP and histone genes H2BFC, H2AFC, H3FK. Contains ESTs,
              STSs, GSSs and two CpG islands, complete sequence
          Length = 139904

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                          
Query: 193    gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
              |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 138631 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 138572

                                                                          
Query: 253    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
              ||||||||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 138571 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 138512

                                                                          
Query: 313    gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
              ||||| || |||||   ||| ||||||||||||||||| | |||||||||||||||||||
Sbjct: 138511 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 138452

                                                 
Query: 373    gcgatctcccgcaccaggcgctggaacggcagctt 407
              |||||||| |||||||| ||||| || ||||||||
Sbjct: 138451 gcgatctcacgcaccagacgctgaaaaggcagctt 138417

to top

>gb|BC096130.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:116776
           IMAGE:40002510), complete cds
          Length = 463

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           ||||| || |||||   ||| ||||||||||||||||| | |||||||||||||||||||
Sbjct: 287 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 228

                                              
Query: 373 gcgatctcccgcaccaggcgctggaacggcagctt 407
           |||||||| |||||||| ||||| || ||||||||
Sbjct: 227 gcgatctcacgcaccagacgctgaaaaggcagctt 193

to top

>gb|BC096128.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:116774
           IMAGE:40002508), complete cds
          Length = 463

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           ||||| || |||||   ||| ||||||||||||||||| | |||||||||||||||||||
Sbjct: 287 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 228

                                              
Query: 373 gcgatctcccgcaccaggcgctggaacggcagctt 407
           |||||||| |||||||| ||||| || ||||||||
Sbjct: 227 gcgatctcacgcaccagacgctgaaaaggcagctt 193

to top

>gb|BC096129.1| Homo sapiens histone 1, H3h, mRNA (cDNA clone MGC:116775
           IMAGE:40002509), complete cds
          Length = 463

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 407 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           ||||| || |||||   ||| ||||||||||||||||| | |||||||||||||||||||
Sbjct: 287 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 228

                                              
Query: 373 gcgatctcccgcaccaggcgctggaacggcagctt 407
           |||||||| |||||||| ||||| || ||||||||
Sbjct: 227 gcgatctcacgcaccagacgctgaaaaggcagctt 193

to top

>emb|Z83735.1|HSZ83735 H.sapiens hH3/k gene
          Length = 819

 Score =  204 bits (103), Expect = 2e-49
 Identities = 187/215 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 726 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 667

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 666 ttggcgtggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 607

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           ||||| || |||||   ||| ||||||||||||||||| | |||||||||||||||||||
Sbjct: 606 gcctcttgcagcgccatcaccgcggagctctggaagcgcaagtcggtcttgaagtcctgc 547

                                              
Query: 373 gcgatctcccgcaccaggcgctggaacggcagctt 407
           |||||||| |||||||| ||||| || ||||||||
Sbjct: 546 gcgatctcacgcaccagacgctgaaaaggcagctt 512

to top

>ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC582332), mRNA
          Length = 411

 Score =  202 bits (102), Expect = 6e-49
 Identities = 180/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           ||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 395 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 336

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| |||||||||||||||||||| ||||| | ||| | ||||  ||||||||| || 
Sbjct: 335 gcgcacaggttggtgtcctcgaagagaccgaccaagtatgcctcgctggcctcctgaaga 276

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||    || |||||||||||||| ||||| ||||||||||||||||| |||||||| || 
Sbjct: 275 gccatgactgcggagctctggaatcggagctcggtcttgaagtcctgagcgatctcacgg 216

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           ||||| |||||||| || ||||||||
Sbjct: 215 accagacgctggaaggggagcttgcg 190

to top

>emb|CR541858.1| Homo sapiens full open reading frame cDNA clone RZPDo834H0632D for
           gene HIST1H3A, histone 1, H3a; complete cds, incl.
           stopcodon
          Length = 411

 Score =  202 bits (102), Expect = 6e-49
 Identities = 180/206 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 407 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| ||||| |||||||| || ||||| || | ||| | ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||   ||| |||||||||||||| || ||||| || || |||||||||
Sbjct: 287 gcctcctgcagagccatcacagcggagctctggaaacgcaggtctgttttaaagtcctgc 228

                                     
Query: 373 gcgatctcccgcaccaggcgctggaa 398
           || ||||| |||||||||||||||||
Sbjct: 227 gcaatctcgcgcaccaggcgctggaa 202

to top

>gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3) gene, partial
           cds
          Length = 369

 Score =  202 bits (102), Expect = 6e-49
 Identities = 159/179 (88%)
 Strand = Plus / Minus

                                                                       
Query: 232 ttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagc 291
           |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| 
Sbjct: 369 ttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcaaagagg 310

                                                                       
Query: 292 ccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcgg 351
           ||||| ||||| | ||||  ||||||||| |||||    |||||||||||||||||||| 
Sbjct: 309 ccgaccaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaagcgc 250

                                                                      
Query: 352 aggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||| |||||||||||||| |||||||| |||||||  |||||||| |||||||||||
Sbjct: 249 aggtcsgtcttgaagtcctgagcgatctcrcgcaccanacgctggaagggcagcttgcg 191

to top

>gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds
          Length = 345

 Score =  202 bits (102), Expect = 6e-49
 Identities = 158/177 (89%)
 Strand = Plus / Minus

                                                                       
Query: 234 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 293
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaagagtcc 286

                                                                       
Query: 294 gacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcggag 353
            |||||||| | ||||  ||||||||| || ||    |||||||||||||||||||| ||
Sbjct: 285 nacgaggtaagcctcgctggcctcctgcagagccatgacggcggagctctggaagcgcag 226

                                                                    
Query: 354 gtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||| |||||||||||||| |||||||| ||||| ||||||||||| |||||||||||
Sbjct: 225 gtcagtcttgaagtcctgtgcgatctcacgcacgaggcgctggaagggcagcttgcg 169

to top

>gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partial cds
          Length = 375

 Score =  202 bits (102), Expect = 6e-49
 Identities = 162/182 (89%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||| ||||| | ||||  ||||||||| || ||    ||||| ||||||||||||
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatgacggccgagctctggaag 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || |||||||||||||||||||| ||||| || |||||||| |||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacgcaccagacgctggaagggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>gb|AY749701.1| Paraleptophlebia vaciva histone H3 (H3) gene, partial cds
          Length = 375

 Score =  202 bits (102), Expect = 6e-49
 Identities = 162/182 (89%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcatggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || || || ||||| | ||||  ||||||||| || ||   |||||||  ||||||||||
Sbjct: 311 agacccaccaggtaggcctcgctggcctcctgcagagccatcacggcgctgctctggaag 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           ||||||||||||||||||||||| |||||||| || |||||||||||||| |||||||||
Sbjct: 251 cggaggtcggtcttgaagtcctgagcgatctcacggaccaggcgctggaagggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>ref|XM_905850.2| PREDICTED: Mus musculus similar to histone 1, H2ai (predicted)
           (LOC382523), mRNA
          Length = 411

 Score =  200 bits (101), Expect = 3e-48
 Identities = 182/209 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||| || || | ||||||||| |||||||||||||| || ||||||||||||
Sbjct: 398 ccgcggatgcgccgagccaactggatgtctttgggcatgatggtcacccgcttggcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           || ||||| ||||| || || ||||| ||||| |||||||||||||||  ||||||||| 
Sbjct: 338 atagcgcacaggttcgtatcttcgaacagccccacgaggtacgactcgcaggcctcctgc 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||   ||| ||||||||||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 278 agcgccatcaccgcggagctctggaagcgcaggtcggtcttgaagtcctgggcgatctca 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           ||||||| ||||||||| |||| ||||||
Sbjct: 218 cgcaccaagcgctggaatggcaacttgcg 190

to top

>gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  200 bits (101), Expect = 3e-48
 Identities = 158/177 (89%)
 Strand = Plus / Minus

                                                                       
Query: 234 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 293
           |||||||||||||||||||||||||||||| ||||| ||||| ||||||||||| || ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatcgcgcacaggttcgtgtcctcgaacaggcc 295

                                                                       
Query: 294 gacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcggag 353
           ||||||||||| ||||  ||||||||| || ||    ||||| |||||||||||||||||
Sbjct: 294 gacgaggtacgcctcgctggcctcctgcagggccatgacggccgagctctggaagcggag 235

                                                                    
Query: 354 gtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||||||||||| |||||||| |||||||| |||||||| |||||||||||
Sbjct: 234 gtcggtcttgaagtcctgggcgatctcgcgcaccagacgctggaagggcagcttgcg 178

to top

>ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641
           (ENSANGG00000024840), partial mRNA
          Length = 411

 Score =  200 bits (101), Expect = 3e-48
 Identities = 182/209 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 ccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| || || ||||| ||||| || || || ||||||| ||||  ||| ||||| 
Sbjct: 338 atggcgcacagattcgtgtcttcgaacagaccaaccaggtacgcctcgctggcttcctgc 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||    ||||| ||||||||||||||||| || |||||||||||||| |||||||| 
Sbjct: 278 agcgccatgacggctgagctctggaagcggagatcagtcttgaagtcctgggcgatctca 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           ||||||| ||||||||| |||||||||||
Sbjct: 218 cgcaccaagcgctggaagggcagcttgcg 190

to top

>ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005
           (ENSANGG00000013516), partial mRNA
          Length = 411

 Score =  200 bits (101), Expect = 3e-48
 Identities = 182/209 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 ccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| || || ||||| ||||| || || || || |||| ||||  ||| ||||| 
Sbjct: 338 atggcgcacagattcgtgtcttcgaacagaccaaccagatacgcctcgctggcttcctgc 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||    ||||| ||||||||||||||||| || |||||||||||||| |||||||| 
Sbjct: 278 agcgccatgacggctgagctctggaagcggagatcagtcttgaagtcctgggcgatctca 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           ||||||| ||||||||| |||||||||||
Sbjct: 218 cgcaccaagcgctggaagggcagcttgcg 190

to top

>ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387
           (ENSANGG00000001186), partial mRNA
          Length = 408

 Score =  200 bits (101), Expect = 3e-48
 Identities = 182/209 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 ccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 336

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| || || ||||| ||||| || || || || |||| ||||  ||| ||||| 
Sbjct: 335 atggcgcacagattcgtgtcttcgaacagaccaaccagatacgcctcgctggcttcctgc 276

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||    ||||| ||||||||||||||||| || |||||||||||||| |||||||| 
Sbjct: 275 agcgccatgacggctgagctctggaagcggagatcagtcttgaagtcctgggcgatctca 216

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           ||||||| ||||||||| |||||||||||
Sbjct: 215 cgcaccaagcgctggaagggcagcttgcg 187

to top

>ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784
           (ENSANGG00000010295), partial mRNA
          Length = 411

 Score =  200 bits (101), Expect = 3e-48
 Identities = 182/209 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 ccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| || || ||||| ||||| || || || || |||| ||||  ||| ||||| 
Sbjct: 338 atggcgcacagattcgtgtcttcgaacagaccaaccagatacgcctcgctggcttcctgc 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||    ||||| ||||||||||||||||| || |||||||||||||| |||||||| 
Sbjct: 278 agcgccatgacggctgagctctggaagcggagatcagtcttgaagtcctgggcgatctca 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           ||||||| ||||||||| |||||||||||
Sbjct: 218 cgcaccaagcgctggaagggcagcttgcg 190

to top

>gb|AY338621.1| Metretopus borealis histone 3 gene, partial cds
          Length = 345

 Score =  200 bits (101), Expect = 3e-48
 Identities = 158/177 (89%)
 Strand = Plus / Minus

                                                                       
Query: 234 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 293
           |||||||||||||||||||||||||||||||||||| | |||||||||||| ||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaagagacc 286

                                                                       
Query: 294 gacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcggag 353
            |||||||||| ||||  ||||||||| || ||   |||||||||||||||||| || ||
Sbjct: 285 cacgaggtacgcctcgctggcctcctgaagagccatcacggcggagctctggaaacgcag 226

                                                                    
Query: 354 gtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||||||||||| |||||||| |||||||| |||||||| |||||||||||
Sbjct: 225 gtcggtcttgaagtcctgagcgatctcacgcaccagacgctggaagggcagcttgcg 169

to top

>gb|AY338619.1| Baetis sp. Eph11 histone 3 gene, partial cds
          Length = 345

 Score =  200 bits (101), Expect = 3e-48
 Identities = 158/177 (89%)
 Strand = Plus / Minus

                                                                       
Query: 234 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 293
           |||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaagagacc 286

                                                                       
Query: 294 gacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcggag 353
           ||||||||| | ||||  ||||||||| || ||    ||||| |||||||||||||| ||
Sbjct: 285 gacgaggtaggcctcgctggcctcctgcagggccatgacggccgagctctggaagcgcag 226

                                                                    
Query: 354 gtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||||||||||||||||| || |||||||| |||||||| |||||||||||
Sbjct: 225 gtcggtcttgaagtcctgcgcgatttcacgcaccagacgctggaagggcagcttgcg 169

to top

>gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, complete cds
          Length = 626

 Score =  198 bits (100), Expect = 1e-47
 Identities = 193/224 (86%)
 Strand = Plus / Minus

                                                                       
Query: 187 gcctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 246
           |||||||| | ||| || |||||||||||||| ||||||||||||||||||||||| || 
Sbjct: 424 gcctaggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtc 365

                                                                       
Query: 247 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgac 306
           || |||||||||||||||||||| ||||||||||||||||| |||||||||||||| | |
Sbjct: 364 acacgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtaggcc 305

                                                                       
Query: 307 tcggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaag 366
           |||||||||||||| ||||| |  |  || | ||||||||| |  ||||| || ||||||
Sbjct: 304 tcggcggcctcctgcagcgccgcgatcgcagcgctctggaacctcaggtccgttttgaag 245

                                                       
Query: 367 tcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||| || ||||| || || ||||||||||| |||||||||||
Sbjct: 244 tcctgggcaatctcgcggacgaggcgctggaagggcagcttgcg 201

to top

>ref|XM_610495.1| PREDICTED: Bos taurus similar to CG31613-PA (LOC531990), mRNA
          Length = 411

 Score =  194 bits (98), Expect = 2e-46
 Identities = 188/218 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||| ||||||||||||||| || || ||||||||||| |||||||| ||||| ||||||
Sbjct: 407 gcccgctccccgcggatgcgacgagccagctggatgtctttgggcataatggtcacgcgc 348

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| ||||| ||||| || || ||||| || ||||| | ||||   
Sbjct: 347 ttggcgtggatggcgcacaggttcgtgtcttcaaacagccccaccaggtaggcctcgctc 288

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| |||||   |||||| |||||||||||||| || |||||||| |||||||||
Sbjct: 287 gcctcctgcagcgccatcacggccgagctctggaagcgcagatcggtcttaaagtcctgc 228

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || ||||| ||||||||||||||||||||
Sbjct: 227 gcgatctcgcgtaccagccgctggaacggcagcttgcg 190

to top

>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3
            and H4
          Length = 8592

 Score =  194 bits (98), Expect = 2e-46
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                        
Query: 193  gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
            |||||||| || ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 5556 gccctctctcctcggatcctgcgggccagctggatgtccttgggcatgatggtgactctc 5615

                                                                        
Query: 253  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
            ||||||||||||||||| ||||||||||||||||||||||| || || || | ||||  |
Sbjct: 5616 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccagataagcctcgctg 5675

                                                                        
Query: 313  gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
            |||||||| || ||    ||||| ||||||||||||||||| ||||||||||||||||| 
Sbjct: 5676 gcctcctgcagagccatgacggctgagctctggaagcggagatcggtcttgaagtcctgg 5735

                                                  
Query: 373  gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            ||||||||||| || |  |||||||| ||||| |||||
Sbjct: 5736 gcgatctcccgaactaaacgctggaaaggcagtttgcg 5773

to top

>gb|AY521728.1| Aphanicerca capensis voucher BYU_ACPL028 histone H3 (H3) gene,
           partial cds
          Length = 354

 Score =  194 bits (98), Expect = 2e-46
 Identities = 155/174 (89%)
 Strand = Plus / Minus

                                                                       
Query: 234 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 293
           ||||||||||||||| |||||||||||||| ||||| | |||||||||||||||||| ||
Sbjct: 354 gggcatgatggtgactcgcttggcgtggatcgcgcacaagttggtgtcctcgaagagtcc 295

                                                                       
Query: 294 gacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcggag 353
           ||||||||||| ||||  |||||||||||| ||   |||||| ||||||||||| || ||
Sbjct: 294 gacgaggtacgcctcgctggcctcctggagagccatcacggccgagctctggaaacgcag 235

                                                                 
Query: 354 gtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagctt 407
           ||||||||||||||||||||||||||| || || || |||||||||||||||||
Sbjct: 234 gtcggtcttgaagtcctgcgcgatctcgcggacgagtcgctggaacggcagctt 181

to top

>ref|XM_314445.2| Anopheles gambiae str. PEST ENSANGP00000016056
           (ENSANGG00000013567), partial mRNA
          Length = 411

 Score =  194 bits (98), Expect = 2e-46
 Identities = 179/206 (86%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           ||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatacggcgagccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| || |||||||| ||||| || || || | ||||| |||   ||| ||||| |||
Sbjct: 335 gcgcacagattggtgtcttcgaaaagaccaaccaagtacgcctcactggcttcctgcagc 276

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           |||| ||| ||||  ||||||||||| || ||||||||||| |||||||| ||||| |||
Sbjct: 275 gcggccacagcggcactctggaagcgcagatcggtcttgaaatcctgcgcaatctcacgc 216

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           |||| |||||||||||||||||||||
Sbjct: 215 accaagcgctggaacggcagcttgcg 190

to top

>gb|AY749738.1| Jubabaetis sp. EP139 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  194 bits (98), Expect = 2e-46
 Identities = 161/182 (88%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaag 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||| | ||| | ||||  ||||||||| || ||    ||||| ||||||||||| 
Sbjct: 311 aggccgaccaagtaggcctcgctggcctcctgcagggccatgacggccgagctctggaaa 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || ||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgcgcgatctcgcgcacgaggcgctggaagggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds
          Length = 377

 Score =  194 bits (98), Expect = 2e-46
 Identities = 161/182 (88%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatcgcgcacaggttggtgtcctcgaac 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || || || ||||| | ||||  ||||||||| || ||    ||||||||||||||||||
Sbjct: 311 agacccaccaggtaagcctcgctggcctcctgcagagccatgacggcggagctctggaag 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || |||||||||||||||||||| |||||||| |||||||| |||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgcaccagacgctggaagggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  194 bits (98), Expect = 2e-46
 Identities = 161/182 (88%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           |||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacacgcttggcgtggatggcgcacaagttggtgtcctcgaaa 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||| ||||| | ||||  ||||||||| || ||   |||||||||||||||||| 
Sbjct: 311 aggccgaccaggtaggcctcgctggcctcctgcagggccatcacggcggagctctggaaa 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || |||||||||||||||||||| ||||| || ||||||||||||||||| |||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacgcaccaggcgctggaagggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 genes, complete cds, and
            histone H3 gene, 3' end, gene cluster X1h3
          Length = 8608

 Score =  194 bits (98), Expect = 2e-46
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                        
Query: 193  gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
            |||||||| || ||||| | |||||| ||||||||||||||||||||||||||||| | |
Sbjct: 5573 gccctctctcctcggatcctgcgggccagctggatgtccttgggcatgatggtgactctc 5632

                                                                        
Query: 253  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
            ||||||||||||||||| ||||||||||||||||||||||| || || || | ||||  |
Sbjct: 5633 ttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccagataagcctcgctg 5692

                                                                        
Query: 313  gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
            |||||||| || ||    ||||| ||||||||||||||||| ||||||||||||||||| 
Sbjct: 5693 gcctcctgcagagccatgacggctgagctctggaagcggagatcggtcttgaagtcctgg 5752

                                                  
Query: 373  gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            ||||||||||| || |  |||||||| ||||| |||||
Sbjct: 5753 gcgatctcccgaactaaacgctggaaaggcagtttgcg 5790

to top

>emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a
          Length = 969

 Score =  194 bits (98), Expect = 2e-46
 Identities = 179/206 (86%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 714 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatagtgacgcgc 655

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||||||||||||||| ||||| |||||||| || ||||| || | ||| | ||||   
Sbjct: 654 ttggcgtggatggcgcacaggttagtgtcctcaaatagccctaccaagtaggcctcgcac 595

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| || ||   ||| |||||||||||||| || ||||| || || |||||||||
Sbjct: 594 gcctcctgcagagccatcacagcggagctctggaaacgcaggtctgttttaaagtcctgc 535

                                     
Query: 373 gcgatctcccgcaccaggcgctggaa 398
           || ||||| ||||| |||||||||||
Sbjct: 534 gcaatctcgcgcactaggcgctggaa 509

to top

>ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462506),
           mRNA
          Length = 792

 Score =  192 bits (97), Expect = 6e-46
 Identities = 172/197 (87%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| |||||||| || || |||||||||||||||||||||||||| || || |||
Sbjct: 788 gccctctcgccgcggatacgacgtgcgagctggatgtccttgggcatgatagtcacccgc 729

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           ||||| ||||||||||| |||||||||||||| |||||||| || ||||| | ||||   
Sbjct: 728 ttggcatggatggcgcacaggttggtgtcctcaaagagccccaccaggtaggcctcgcat 669

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           ||||| || |||||   ||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 668 gcctcttgcagcgccatcaccgcggagctctggaagcgcaggtcggtcttgaagtcctgc 609

                            
Query: 373 gcgatctcccgcaccag 389
           |||||||| ||||||||
Sbjct: 608 gcgatctcacgcaccag 592

to top

>emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N21 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme HBUCE1 pseudogene, the FCGR1C
             gene for Fc fragment of IgG high affinity Ic receptor for
             (CD64), two novel genes, the HIST2H2BA gene for histone 2
             H2ba, the gene for a novel protein similar to histone 2
             H3c (HIST2H3C), a novel gene, a ribosomal protein L22
             (RPL22) pseudogene, a novel gene and three CpG islands,
             complete sequence
          Length = 129426

 Score =  192 bits (97), Expect = 6e-46
 Identities = 190/221 (85%)
 Strand = Plus / Plus

                                                                         
Query: 190   taggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 249
             ||||||| ||||||||||||||||| | | | |||||||||||||||||||||||| |||
Sbjct: 69914 taggcccgctccccgcggatgcggctgaccaactggatgtccttgggcatgatggtcacg 69973

                                                                         
Query: 250   cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcg 309
             |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| | ||| 
Sbjct: 69974 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctct 70033

                                                                         
Query: 310   gcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcc 369
               ||||||||| |||||   |||||| |||||||||||||| ||||| ||||| || |||
Sbjct: 70034 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaactcc 70093

                                                      
Query: 370   tgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
             ||||||||||| || ||||| |||||||| |||||||||||
Sbjct: 70094 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcg 70134

to top

>ref|NM_001025303.1| Homo sapiens similar to histone H2B histone family (LOC440686),
           mRNA
          Length = 411

 Score =  192 bits (97), Expect = 6e-46
 Identities = 190/221 (85%)
 Strand = Plus / Minus

                                                                       
Query: 190 taggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 249
           ||||||| ||||||||||||||||| | | | |||||||||||||||||||||||| |||
Sbjct: 410 taggcccgctccccgcggatgcggctgaccaactggatgtccttgggcatgatggtcacg 351

                                                                       
Query: 250 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcg 309
           |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| | ||| 
Sbjct: 350 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctct 291

                                                                       
Query: 310 gcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcc 369
             ||||||||| |||||   |||||| |||||||||||||| ||||| ||||| || |||
Sbjct: 290 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaactcc 231

                                                    
Query: 370 tgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||||| || ||||| |||||||| |||||||||||
Sbjct: 230 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcg 190

to top

>ref|XM_307606.1| Anopheles gambiae str. PEST ENSANGP00000016172
           (ENSANGG00000013683), partial mRNA
          Length = 411

 Score =  192 bits (97), Expect = 6e-46
 Identities = 181/209 (86%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 ccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgcttggcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| || || ||||| ||||| || || || || |||| ||||  ||| ||||| 
Sbjct: 338 atggcgcacagattcgtgtcttcgaacagaccaaccagatacgcctcgctggcttcctgc 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           |||||    ||||| ||||||||||||||||| || |||||||||||||| |||||||| 
Sbjct: 278 agcgccatgacggctgagctctggaagcggagatcagtcttgaagtcctgggcgatctca 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           ||||||| ||||||||| |||||||||||
Sbjct: 218 cgcaccaagcgctggaagggcagcttgcg 190

to top

>gb|AY555567.1| Heterojapyx sp. GG-2001 histone H3 gene, partial cds
          Length = 327

 Score =  192 bits (97), Expect = 6e-46
 Identities = 145/161 (90%)
 Strand = Plus / Minus

                                                                       
Query: 250 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcg 309
           |||||||||||||||||||| ||||||||||||||||||||||| |||||||| | ||||
Sbjct: 326 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagccccacgaggtaggcctcg 267

                                                                       
Query: 310 gcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcc 369
              |||||||| || ||   |||||| |||||||||||||| ||||||||||||||||||
Sbjct: 266 ctcgcctcctgcagggccatcacggcagagctctggaagcgcaggtcggtcttgaagtcc 207

                                                    
Query: 370 tgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           ||||||||||| ||||||||||||||||| |||||||||||
Sbjct: 206 tgcgcgatctcgcgcaccaggcgctggaagggcagcttgcg 166

to top

>gb|AY749740.1| Isonychia sp. EP142 histone H3 (H3) gene, partial cds
          Length = 374

 Score =  192 bits (97), Expect = 6e-46
 Identities = 157/177 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 293
           |||||||||||||||||||||||||||||||||||| | ||||||||||||||| || ||
Sbjct: 368 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaacagacc 309

                                                                       
Query: 294 gacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcggag 353
            |||||||| | ||||  ||||||||| || ||    ||||| |||||||||||||| ||
Sbjct: 308 cacgaggtaagcctcgctggcctcctgcagggccatgacggccgagctctggaagcgaag 249

                                                                    
Query: 354 gtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 248 gtcggtcttgaagtcctgtgcgatctcacgcaccaggcgctggaagggcagcttgcg 192

to top

>gb|BC069079.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:95354
           IMAGE:7216893), complete cds
          Length = 482

 Score =  188 bits (95), Expect = 1e-44
 Identities = 191/223 (85%)
 Strand = Plus / Minus

                                                                       
Query: 188 cctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 247
           ||||||||| |||||||||||| ||||| || |||||||||||||| |||||||||||||
Sbjct: 412 cctaggcccgctccccgcggatacggcgtgccagctggatgtccttaggcatgatggtga 353

                                                                       
Query: 248 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgact 307
           | || ||||| |||||| | || |||||||||||||| || ||||| || ||||| ||||
Sbjct: 352 cccgtttggcatggatgacacacaggttggtgtcctcaaacagccccaccaggtaagact 293

                                                                       
Query: 308 cggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagt 367
           ||   |||||||| |||||   |||||| |||||||||||||| ||||||||||| ||||
Sbjct: 292 cgcacgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttaaagt 233

                                                      
Query: 368 cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||| |||||||| |||| ||| |||||||| |||| ||||||
Sbjct: 232 cctgagcgatctcgcgcatcagccgctggaagggcaacttgcg 190

to top

>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3,
              complete sequence
          Length = 151563

 Score =  188 bits (95), Expect = 1e-44
 Identities = 191/223 (85%)
 Strand = Plus / Minus

                                                                          
Query: 188    cctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 247
              ||||||||| |||||||||||| ||||| || |||||||||||||| |||||||||||||
Sbjct: 133451 cctaggcccgctccccgcggatacggcgtgccagctggatgtccttaggcatgatggtga 133392

                                                                          
Query: 248    cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgact 307
              | || ||||| |||||| | || |||||||||||||| || ||||| || ||||| ||||
Sbjct: 133391 cccgtttggcatggatgacacacaggttggtgtcctcaaacagccccaccaggtaagact 133332

                                                                          
Query: 308    cggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagt 367
              ||   |||||||| |||||   |||||| |||||||||||||| ||||||||||| ||||
Sbjct: 133331 cgcacgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttaaagt 133272

                                                         
Query: 368    cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
              |||| |||||||| |||| ||| |||||||| |||| ||||||
Sbjct: 133271 cctgagcgatctcgcgcatcagccgctggaagggcaacttgcg 133229

to top

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score =  188 bits (95), Expect = 1e-44
 Identities = 176/203 (86%)
 Strand = Plus / Minus

                                                                        
Query: 208  atgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcg 267
            |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1495 atgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcg 1436

                                                                        
Query: 268  cagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagcgcg 327
            || |||||||| |||||||| || || || ||||| | |||||| |||||||| ||||| 
Sbjct: 1435 cacaggttggtatcctcgaacaggcccaccaggtaggcctcggcagcctcctgcagcgcc 1376

                                                                        
Query: 328  gacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgcacc 387
              ||||||   |||||||||||| || || |||||||||||||| || ||||| ||||||
Sbjct: 1375 agcacggcctggctctggaagcgcagatccgtcttgaagtcctgggcaatctcgcgcacc 1316

                                   
Query: 388  aggcgctggaacggcagcttgcg 410
            || |||||||| || ||||||||
Sbjct: 1315 agccgctggaaaggaagcttgcg 1293

to top

>emb|Z49861.1|HS2132H3 H.sapiens gene for histone H3
          Length = 776

 Score =  188 bits (95), Expect = 1e-44
 Identities = 191/223 (85%)
 Strand = Plus / Minus

                                                                       
Query: 188 cctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 247
           ||||||||| |||||||||||| ||||| || |||||||||||||| |||||||||||||
Sbjct: 605 cctaggcccgctccccgcggatacggcgtgccagctggatgtccttaggcatgatggtga 546

                                                                       
Query: 248 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgact 307
           | || ||||| |||||| | || |||||||||||||| || ||||| || ||||| ||||
Sbjct: 545 cccgtttggcatggatgacacacaggttggtgtcctcaaacagccccaccaggtaagact 486

                                                                       
Query: 308 cggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagt 367
           ||   |||||||| |||||   |||||| |||||||||||||| ||||||||||| ||||
Sbjct: 485 cgcacgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttaaagt 426

                                                      
Query: 368 cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||| |||||||| |||| ||| |||||||| |||| ||||||
Sbjct: 425 cctgagcgatctcgcgcatcagccgctggaagggcaacttgcg 383

to top

>ref|NM_003493.2| Homo sapiens histone 3, H3 (HIST3H3), mRNA
          Length = 481

 Score =  188 bits (95), Expect = 1e-44
 Identities = 191/223 (85%)
 Strand = Plus / Minus

                                                                       
Query: 188 cctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 247
           ||||||||| |||||||||||| ||||| || |||||||||||||| |||||||||||||
Sbjct: 412 cctaggcccgctccccgcggatacggcgtgccagctggatgtccttaggcatgatggtga 353

                                                                       
Query: 248 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgact 307
           | || ||||| |||||| | || |||||||||||||| || ||||| || ||||| ||||
Sbjct: 352 cccgtttggcatggatgacacacaggttggtgtcctcaaacagccccaccaggtaagact 293

                                                                       
Query: 308 cggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagt 367
           ||   |||||||| |||||   |||||| |||||||||||||| ||||||||||| ||||
Sbjct: 292 cgcacgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttaaagt 233

                                                      
Query: 368 cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||| |||||||| |||| ||| |||||||| |||| ||||||
Sbjct: 232 cctgagcgatctcgcgcatcagccgctggaagggcaacttgcg 190

to top

>gb|DQ284391.1| Scaphiophryne marmorata histone H3a gene, partial cds
          Length = 328

 Score =  188 bits (95), Expect = 1e-44
 Identities = 143/159 (89%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggc 311
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| | ||||  
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgaccaggtaagcctcgct 266

                                                                       
Query: 312 ggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctg 371
           ||||||||| || ||    |||||||||||||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                  
Query: 372 cgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            |||||||| ||||||||||||||||| |||||||||||
Sbjct: 205 ggcgatctcgcgcaccaggcgctggaagggcagcttgcg 167

to top

>gb|AF531308.1| Homo sapiens histone H3 (HIST3H3) gene, complete cds
          Length = 1227

 Score =  188 bits (95), Expect = 1e-44
 Identities = 191/223 (85%)
 Strand = Plus / Minus

                                                                       
Query: 188 cctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 247
           ||||||||| |||||||||||| ||||| || |||||||||||||| |||||||||||||
Sbjct: 822 cctaggcccgctccccgcggatacggcgtgccagctggatgtccttaggcatgatggtga 763

                                                                       
Query: 248 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgact 307
           | || ||||| |||||| | || |||||||||||||| || ||||| || ||||| ||||
Sbjct: 762 cccgtttggcatggatgacacacaggttggtgtcctcaaacagccccaccaggtaagact 703

                                                                       
Query: 308 cggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagt 367
           ||   |||||||| |||||   |||||| |||||||||||||| ||||||||||| ||||
Sbjct: 702 cgcacgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttaaagt 643

                                                      
Query: 368 cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||| |||||||| |||| ||| |||||||| |||| ||||||
Sbjct: 642 cctgagcgatctcgcgcatcagccgctggaagggcaacttgcg 600

to top

>gb|AY923963.1| Nerita polita isolate NR2 histone H3 (H3) gene, partial cds
          Length = 376

 Score =  188 bits (95), Expect = 1e-44
 Identities = 160/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| 
Sbjct: 372 tccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtgtcctcgaac 313

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||| ||||| | ||||  ||||||||| || ||    ||||| ||||||||||| 
Sbjct: 312 agaccgaccaggtaggcctcgctggcctcctgcagngccatgacggccgagctctggaat 253

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || ||||| |||||||||||||| |||||||| |||||||| ||||||||||||||||||
Sbjct: 252 cgcaggtccgtcttgaagtcctgagcgatctcacgcaccagacgctggaacggcagcttg 193

             
Query: 409 cg 410
           ||
Sbjct: 192 cg 191

to top

>gb|AY662898.1| Paretroplus cf. kieneri 'Amboaboa' histone H3a gene, partial cds
          Length = 333

 Score =  188 bits (95), Expect = 1e-44
 Identities = 143/159 (89%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggc 311
           ||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||  
Sbjct: 329 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgaccaggtaagcctcgct 270

                                                                       
Query: 312 ggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctg 371
           ||||||||| || ||    |||||||||||||||||||| ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                  
Query: 372 cgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            |||||||| || |||||||||||||| |||||||||||
Sbjct: 209 agcgatctcgcggaccaggcgctggaagggcagcttgcg 171

to top

>gb|BC101837.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:126886
           IMAGE:8069343), complete cds
          Length = 536

 Score =  188 bits (95), Expect = 1e-44
 Identities = 191/223 (85%)
 Strand = Plus / Minus

                                                                       
Query: 188 cctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 247
           ||||||||| |||||||||||| ||||| || |||||||||||||| |||||||||||||
Sbjct: 460 cctaggcccgctccccgcggatacggcgtgccagctggatgtccttaggcatgatggtga 401

                                                                       
Query: 248 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgact 307
           | || ||||| |||||| | || |||||||||||||| || ||||| || ||||| ||||
Sbjct: 400 cccgtttggcatggatgacacacaggttggtgtcctcaaacagccccaccaggtaagact 341

                                                                       
Query: 308 cggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagt 367
           ||   |||||||| |||||   |||||| |||||||||||||| ||||||||||| ||||
Sbjct: 340 cgcacgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttaaagt 281

                                                      
Query: 368 cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||| |||||||| |||| ||| |||||||| |||| ||||||
Sbjct: 280 cctgagcgatctcgcgcatcagccgctggaagggcaacttgcg 238

to top

>gb|BC101839.1| Homo sapiens histone 3, H3, mRNA (cDNA clone MGC:126888
           IMAGE:8069345), complete cds
          Length = 536

 Score =  188 bits (95), Expect = 1e-44
 Identities = 191/223 (85%)
 Strand = Plus / Minus

                                                                       
Query: 188 cctaggccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 247
           ||||||||| |||||||||||| ||||| || |||||||||||||| |||||||||||||
Sbjct: 460 cctaggcccgctccccgcggatacggcgtgccagctggatgtccttaggcatgatggtga 401

                                                                       
Query: 248 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgact 307
           | || ||||| |||||| | || |||||||||||||| || ||||| || ||||| ||||
Sbjct: 400 cccgtttggcatggatgacacacaggttggtgtcctcaaacagccccaccaggtaagact 341

                                                                       
Query: 308 cggcggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagt 367
           ||   |||||||| |||||   |||||| |||||||||||||| ||||||||||| ||||
Sbjct: 340 cgcacgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttaaagt 281

                                                      
Query: 368 cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||| |||||||| |||| ||| |||||||| |||| ||||||
Sbjct: 280 cctgagcgatctcgcgcatcagccgctggaagggcaacttgcg 238

to top

>gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds
          Length = 411

 Score =  186 bits (94), Expect = 4e-44
 Identities = 178/206 (86%)
 Strand = Plus / Minus

                                                                       
Query: 205 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 264
           ||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 395 cggatgcggcgagcgagctgaatgtccttgggcatgatggtgacacgcttggcgtggatg 336

                                                                       
Query: 265 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctggagc 324
           ||||| | |||||||||||||||||||||||||||||| | ||| ||||| |||||||| 
Sbjct: 335 gcgcacaagttggtgtcctcgaagagcccgacgaggtaagcctcagcggcttcctggaga 276

                                                                       
Query: 325 gcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 384
           ||    || |||||   |||||| || || ||||||||||||||||| |||||||| |||
Sbjct: 275 gcaaggacagcggacgactggaaacgcagatcggtcttgaagtcctgggcgatctcacgc 216

                                     
Query: 385 accaggcgctggaacggcagcttgcg 410
           || || | |||||| || ||||||||
Sbjct: 215 acaagtctctggaaagggagcttgcg 190

to top

>emb|X95625.1|NPHISTOH3 N.pseudonarcissus mRNA for histone H3
          Length = 610

 Score =  186 bits (94), Expect = 4e-44
 Identities = 157/179 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtg 279
           |||||||| ||||| |||||||||||||| | ||| || ||||||||||| |  ||||||
Sbjct: 358 agctggatatccttaggcatgatggtgaccctcttcgcatggatggcgcaaanattggtg 299

                                                                       
Query: 280 tcctcgaagagcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggag 339
           ||||| || || || ||||||||||||||||| |||||||||||||||| ||| ||||| 
Sbjct: 298 tcctcaaacaggcccacgaggtacgactcggccgcctcctggagcgcggccacagcggan 239

                                                                      
Query: 340 ctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaa 398
           ||||||||||||||||| |||||||||||||| |||||||| || |||| |||||||||
Sbjct: 238 ctctggaagcggaggtcagtcttgaagtcctgggcgatctcgcggaccangcgctggaa 180

to top

>dbj|AB195975.1| Lilium longiflorum YAH3 mRNA for histone H3, complete cds
          Length = 463

 Score =  186 bits (94), Expect = 4e-44
 Identities = 187/218 (85%)
 Strand = Plus / Minus

                                                                       
Query: 193 gccctctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 252
           |||||||| |||||||| |  | |||||||||||||||||| |||||||| || || | |
Sbjct: 414 gccctctcgccgcggatcctcctggcgagctggatgtccttcggcatgatagtcaccctc 355

                                                                       
Query: 253 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcg 312
           || ||||| |||||||| ||||||||||||||||| ||||| || ||||| ||||| |  
Sbjct: 354 ttagcgtgaatggcgcacaggttggtgtcctcgaacagccccaccaggtaagactccgac 295

                                                                       
Query: 313 gcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgc 372
           |||||||| ||||| |  ||||| |||||||||||||||||||||| |||||||||||| 
Sbjct: 294 gcctcctgcagcgccgctacggccgagctctggaagcggaggtcggccttgaagtcctga 235

                                                 
Query: 373 gcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||| || || |||||||||||||| ||||||||
Sbjct: 234 gcgatctcgcggacaaggcgctggaacggaagcttgcg 197

to top

>gb|AY338642.1| Malenka californica histone 3 gene, partial cds
          Length = 345

 Score =  186 bits (94), Expect = 4e-44
 Identities = 154/174 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 293
           |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatcgcgcacaggttggtgtcctcgaagagacc 286

                                                                       
Query: 294 gacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcggag 353
           ||| ||||||| ||||   |||||||| || ||   |||||| ||||||||||| || ||
Sbjct: 285 gaccaggtacgcctcgctcgcctcctgcagggccatcacggccgagctctggaaacgcag 226

                                                                 
Query: 354 gtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagctt 407
           ||||||||||||||||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 225 gtcggtcttgaagtcctgcgcgatctcgcgcacgagtcgctggaagggcagctt 172

to top

>gb|AY749729.1| Edmundsius agilis histone H3 (H3) gene, partial cds
          Length = 377

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacagattggtgtcctcgaag 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||| | ||| | ||||  |||||||||||| ||    ||||| ||||||||||||
Sbjct: 311 agaccgaccaagtaagcctcgctggcctcctggagtgccatgacggcagagctctggaag 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || || ||||||||||||||||| || ||||| ||||| ||||||||||| |||||||||
Sbjct: 251 cgcagatcggtcttgaagtcctgggcaatctcacgcacgaggcgctggaaaggcagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>gb|AY749702.1| Thraulodes sp. EP014 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 229 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 288
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 289 agcccgacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaag 348
           || ||||| ||||| | ||||  ||||||||| || ||    ||||| ||||||||||| 
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatgacggccgagctctggaaa 252

                                                                       
Query: 349 cggaggtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttg 408
           || |||||||||||||||||||| ||||| || ||||| ||||||||||| || ||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacgcacgaggcgctggaaggggagcttg 192

             
Query: 409 cg 410
           ||
Sbjct: 191 cg 190

to top

>gb|AY669068.1| Chaetomium globosum histone H3 mRNA, complete cds
          Length = 739

 Score =  184 bits (93), Expect = 2e-43
 Identities = 180/209 (86%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||| ||| || ||||||||||||||||| | |  ||||||||| ||||||||||||
Sbjct: 494 ccgcggaggcgacgagcgagctggatgtccttcgactggatggtgacacgcttggcgtgg 435

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           |||||||| ||||||||||||||||||||   ||||||||| |||||| ||| |||||||
Sbjct: 434 atggcgcacaggttggtgtcctcgaagagagagacgaggtaagactcgacggactcctgg 375

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || ||    | |||||||||||||||||||||||||| |||||||||||| ||||| || 
Sbjct: 374 agggcaccaatggcggagctctggaagcggaggtcggacttgaagtcctgagcgatttcg 315

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || ||||| |||||||| || ||||||||
Sbjct: 314 cgaaccagacgctggaaggggagcttgcg 286

to top

>ref|XM_950910.1| Neurospora crassa OR74A HISTONE H3 (NCU01635.1) partial mRNA
          Length = 411

 Score =  184 bits (93), Expect = 2e-43
 Identities = 180/209 (86%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||| |||||||||||||||||||||||||  |  ||||||||| ||||| ||||||
Sbjct: 398 ccgcggaggcggcgggcgagctggatgtccttgctctggatggtgacacgcttagcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           || ||||||||||||||||||||||||||   ||||||||| |||||| ||| |||||||
Sbjct: 338 atagcgcagaggttggtgtcctcgaagagagagacgaggtaagactcgacggactcctgg 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || |||   | ||| |||||||||||||||||||||| |||||||||||| || ||||| 
Sbjct: 278 agagcgccgatggcagagctctggaagcggaggtcggacttgaagtcctgggcaatctca 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || || |||||||| || ||||||||
Sbjct: 218 cggacgagacgctggaaggggagcttgcg 190

to top

>ref|XM_328073.1| Neurospora crassa OR74A HISTONE H3 (NCU01635.1) partial mRNA
          Length = 411

 Score =  184 bits (93), Expect = 2e-43
 Identities = 180/209 (86%)
 Strand = Plus / Minus

                                                                       
Query: 202 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 261
           ||||||| |||||||||||||||||||||||||  |  ||||||||| ||||| ||||||
Sbjct: 398 ccgcggaggcggcgggcgagctggatgtccttgctctggatggtgacacgcttagcgtgg 339

                                                                       
Query: 262 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggcggcctcctgg 321
           || ||||||||||||||||||||||||||   ||||||||| |||||| ||| |||||||
Sbjct: 338 atagcgcagaggttggtgtcctcgaagagagagacgaggtaagactcgacggactcctgg 279

                                                                       
Query: 322 agcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcc 381
           || |||   | ||| |||||||||||||||||||||| |||||||||||| || ||||| 
Sbjct: 278 agagcgccgatggcagagctctggaagcggaggtcggacttgaagtcctgggcaatctca 219

                                        
Query: 382 cgcaccaggcgctggaacggcagcttgcg 410
           || || || |||||||| || ||||||||
Sbjct: 218 cggacgagacgctggaaggggagcttgcg 190

to top

>gb|AY662905.1| Paretroplus sp. 'Kamoro' histone H3a gene, partial cds
          Length = 333

 Score =  184 bits (93), Expect = 2e-43
 Identities = 141/159 (88%)
 Strand = Plus / Minus

                                                                       
Query: 252 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgactcggc 311
           |||||||||||||||||| ||||||||||||||||| |||||||| ||||| | ||||  
Sbjct: 329 cttggcgtggatggcgcasaggttggtgtcctcgaasagcccgaccaggtaagcctcgct 270

                                                                       
Query: 312 ggcctcctggagcgcggacacggcggagctctggaagcggaggtcggtcttgaagtcctg 371
           ||||||||| || ||    |||||||||||||||||||| ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                  
Query: 372 cgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            |||||||| || |||||||||||||| |||||||||||
Sbjct: 209 agcgatctcscggaccaggcgctggaagggcagcttgcg 171

to top

>gb|AY338638.1| Hetaerina americana histone 3 gene, partial cds
          Length = 345

 Score =  184 bits (93), Expect = 2e-43
 Identities = 156/177 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 293
           ||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||| ||
Sbjct: 345 gggcatgatggtgacacgcttagcgtggatggcgcagaggttggtgtcctcaaagagacc 286

                                                                       
Query: 294 gacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcggag 353
            || ||||| | ||||  |||||||||||| ||    ||||||||||||||||| || ||
Sbjct: 285 cactaggtaagcctcgctggcctcctggagagccatgacggcggagctctggaaccgaag 226

                                                                    
Query: 354 gtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
            ||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 225 atcggtcttgaagtcctgggcgatctcacgcaccaggcgctggaagggcagcttgcg 169

to top

>gb|AY338636.1| Calopteryx aequabilis histone 3 gene, partial cds
          Length = 345

 Score =  184 bits (93), Expect = 2e-43
 Identities = 156/177 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 gggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 293
           |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatcgcgcacaggttggtgtcctcgaagagacc 286

                                                                       
Query: 294 gacgaggtacgactcggcggcctcctggagcgcggacacggcggagctctggaagcggag 353
            |||||||| | ||||  |||||||||||| ||    ||||| |||||||||||||||||
Sbjct: 285 cacgaggtaagcctcgctggcctcctggagtgccatgacggcagagctctggaagcggag 226

                                                                    
Query: 354 gtcggtcttgaagtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcg 410
           |||||||||||| ||||| |||||||| || ||||  |||||||| |||||||||||
Sbjct: 225 gtcggtcttgaaatcctgagcgatctcacggaccaaacgctggaagggcagcttgcg 169


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,457,846
Number of Sequences: 3902068
Number of extensions: 2457846
Number of successful extensions: 64317
Number of sequences better than 10.0: 3636
Number of HSP's better than 10.0 without gapping: 3641
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 56585
Number of HSP's gapped (non-prelim): 6810
length of query: 410
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 388
effective length of database: 17,147,199,772
effective search space: 6653113511536
effective search space used: 6653113511536
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result