>gb|AY643843.1|AY643842S2 Hordeum vulgare subsp. vulgare clones BAC 519K7 and 799C8 hardness locus
              region
          Length = 129099

 Score =  133 bits (67), Expect = 4e-28
 Identities = 70/71 (98%)
 Strand = Plus / Plus

                                                                          
Query: 82     aaacaaaagtacaatactccataagcaataggttaatggaattgatgtcgatgttcacac 141
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 105588 aaacaaaagtacaatactccataagcaataggttaatggaattgatgtggatgttcacac 105647

                         
Query: 142    tgataaatctt 152
              |||||||||||
Sbjct: 105648 tgataaatctt 105658

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   cctgatagcggccgaccatg 330
             ||||||||||||||||||||
Sbjct: 84934 cctgatagcggccgaccatg 84915


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,369,974
Number of Sequences: 3902068
Number of extensions: 2369974
Number of successful extensions: 38045
Number of sequences better than 10.0: 2
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38037
Number of HSP's gapped (non-prelim): 8
length of query: 339
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 317
effective length of database: 17,147,199,772
effective search space: 5435662327724
effective search space used: 5435662327724
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)