| Clone Name | rbart59g09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome Length = 3304561 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 210 acgaaagccggttccgcagcg 230 ||||||||||||||||||||| Sbjct: 2752173 acgaaagccggttccgcagcg 2752153
>gb|AC161285.2| Pan troglodytes BAC clone CH251-310B11 from chromosome 7, complete sequence Length = 171038 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 113 aaattaaaggtaaaagagtt 132 |||||||||||||||||||| Sbjct: 13475 aaattaaaggtaaaagagtt 13456
>gb|AC161473.5| Pan troglodytes BAC clone CH251-460F23 from chromosome 7, complete sequence Length = 170605 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 113 aaattaaaggtaaaagagtt 132 |||||||||||||||||||| Sbjct: 98334 aaattaaaggtaaaagagtt 98315
>gb|AC130713.4| Mus musculus BAC clone RP23-316K10 from chromosome 15, complete sequence Length = 192020 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 140 tagctctctgtgttttcaca 159 |||||||||||||||||||| Sbjct: 64340 tagctctctgtgttttcaca 64359
>emb|CR656067.2|CNS0F56X Tetraodon nigroviridis full-length cDNA Length = 378 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 gagcagcaaaacacatattt 20 |||||||||||||||||||| Sbjct: 335 gagcagcaaaacacatattt 354
>gb|AC142302.1| Pan troglodytes BAC clone RP43-128I16 from 7, complete sequence Length = 161986 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 113 aaattaaaggtaaaagagtt 132 |||||||||||||||||||| Sbjct: 135089 aaattaaaggtaaaagagtt 135108
>emb|CR812472.9| Zebrafish DNA sequence from clone DKEY-110G7 in linkage group 3, complete sequence Length = 194804 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 165 aaatgtgcttaaaaatccct 184 |||||||||||||||||||| Sbjct: 46206 aaatgtgcttaaaaatccct 46187
>emb|AL133461.10| Human DNA sequence from clone RP11-359E7 on chromosome 10 Contains the 3' end of the SAC2 gene for Sac domain-containing inositol phosphatase 2, a novel gene (FLJ13081), the 5' end of the SEC23IP gene for SEC23 interacting protein, a novel gene and three CpG islands, complete sequence Length = 124328 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 145 ctctgtgttttcacaaagta 164 |||||||||||||||||||| Sbjct: 35480 ctctgtgttttcacaaagta 35461
>emb|AL645764.15| Mouse DNA sequence from clone RP23-290B5 on chromosome 11 Contains the 5' end of the gene for a novel protein (9330163N21Rik), a ribosomal protein S2 (Rps2) pseudogene, the gene for a novel protein (E130018012Rik), the gene for a novel protein (6820428D13Rik), the Mrpl27 gene for mitochondrial ribosomal protein L27, the Xylt2 gene for xylosyltransferase II, a novel gene (5330426M11Rik), the gene for a novel protein (C230057C09Rik), the gene for a novel protein similar to Cdc34 and two pseudogenes similar to hypothetical protein Tr:Q8C517, complete sequence Length = 203262 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 155 tcacaaagtaaaatgtgctt 174 |||||||||||||||||||| Sbjct: 113351 tcacaaagtaaaatgtgctt 113370
>gb|AC027672.12| Homo sapiens chromosome 10 clone RP11-198M6, complete sequence Length = 187229 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 145 ctctgtgttttcacaaagta 164 |||||||||||||||||||| Sbjct: 183859 ctctgtgttttcacaaagta 183878
>emb|BX936464.7| Zebrafish DNA sequence from clone DKEY-246O4 in linkage group 18, complete sequence Length = 167114 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 taaaaatccctcctatttta 193 |||||||||||||||||||| Sbjct: 33412 taaaaatccctcctatttta 33393
>gb|AC151582.3| Pan troglodytes BAC clone RP43-3F18 from chromosome 7, complete sequence Length = 197992 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 113 aaattaaaggtaaaagagtt 132 |||||||||||||||||||| Sbjct: 156847 aaattaaaggtaaaagagtt 156828
>dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete genome Length = 3544776 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 223 ccgcagcggttcggacgctc 242 |||||||||||||||||||| Sbjct: 2644804 ccgcagcggttcggacgctc 2644823
>gb|AE017198.1| Lactobacillus johnsonii NCC 533, complete genome Length = 1992676 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 aaaattaaaggtaaaagagt 131 |||||||||||||||||||| Sbjct: 540893 aaaattaaaggtaaaagagt 540912
>emb|CT573076.1| Medicago truncatula chromosome 5 clone mth2-181d5, COMPLETE SEQUENCE Length = 89591 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 150 tgttttcacaaagtaaaatg 169 |||||||||||||||||||| Sbjct: 2420 tgttttcacaaagtaaaatg 2439 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,050,025 Number of Sequences: 3902068 Number of extensions: 3050025 Number of successful extensions: 62530 Number of sequences better than 10.0: 15 Number of HSP's better than 10.0 without gapping: 15 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 62481 Number of HSP's gapped (non-prelim): 49 length of query: 329 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 307 effective length of database: 17,147,199,772 effective search space: 5264190330004 effective search space used: 5264190330004 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)