| Clone Name | rbart36b07 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_475314.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1032 Score = 153 bits (77), Expect = 6e-34 Identities = 182/217 (83%) Strand = Plus / Minus Query: 271 gactccgaagcgtacagtgatttaatctcctccacatcatcgtagctcccgaggaatatc 330 ||||| |||||||||| || ||| || |||||||| ||||| |||||||| |||||||| Sbjct: 1019 gactctgaagcgtacaatgctttgatatcctccacgtcatcatagctccccaggaatatt 960 Query: 331 ggagacctctggtgtatgtcacaagggacaatttcaagggcccgctgtttgccggtgaaa 390 ||||| || | || || | | || |||| |||||||||||| |||||||| |||||| Sbjct: 959 ggagatctatcatgaatctttctgggaacaagttcaagggcccgttgtttgcctgtgaaa 900 Query: 391 gattggcctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacga 450 | ||| ||||| ||||||||||||| ||||||||| ||||| || ||||||||||||||| Sbjct: 899 gcttgtcctccagcttgctccatcaagaatgacattgggaacacttcgtacagaacacga 840 Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 || |||||||| |||||||||| ||||| ||||||| Sbjct: 839 agttttccgtttgggctcttctgatccgcagggtaca 803
>ref|NM_190752.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1110 Score = 127 bits (64), Expect = 4e-26 Identities = 109/124 (87%) Strand = Plus / Minus Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423 ||||| ||||| | |||||| |||||||| |||||||| || |||||||||||||||||| Sbjct: 980 tcaagagcccgttctttgcctgtgaaagactggcctccagcctgctccatcaggaatgac 921 Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcgggg 483 ||||||||||| || ||||||||||| || ||||| || |||||||||||||| || ||| Sbjct: 920 atggggaaaacttcatacagaacacggagttttccatttgggctcttcttgtctgcaggg 861 Query: 484 taca 487 |||| Sbjct: 860 taca 857
>dbj|AK119536.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B07, full insert sequence Length = 1315 Score = 127 bits (64), Expect = 4e-26 Identities = 109/124 (87%) Strand = Plus / Minus Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423 ||||| ||||| | |||||| |||||||| |||||||| || |||||||||||||||||| Sbjct: 1023 tcaagagcccgttctttgcctgtgaaagactggcctccagcctgctccatcaggaatgac 964 Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcgggg 483 ||||||||||| || ||||||||||| || ||||| || |||||||||||||| || ||| Sbjct: 963 atggggaaaacttcatacagaacacggagttttccatttgggctcttcttgtctgcaggg 904 Query: 484 taca 487 |||| Sbjct: 903 taca 900
>gb|AF218845.1|AF218845 Porteresia coarctata fructose-1,6-bisphosphatase mRNA, complete cds Length = 1035 Score = 127 bits (64), Expect = 4e-26 Identities = 109/124 (87%) Strand = Plus / Minus Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423 ||||| ||||| | |||||| |||||||| |||||||| || |||||||||||||||||| Sbjct: 920 tcaagagcccgttctttgcctgtgaaagactggcctccagcctgctccatcaggaatgac 861 Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcgggg 483 ||||||||||| || ||||||||||| || ||||| || |||||||||||||| || ||| Sbjct: 860 atggggaaaacttcatacagaacacggagttttccattcgggctcttcttgtctgcaggg 801 Query: 484 taca 487 |||| Sbjct: 800 taca 797
>dbj|AK070516.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023057C24, full insert sequence Length = 1376 Score = 127 bits (64), Expect = 4e-26 Identities = 109/124 (87%) Strand = Plus / Minus Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423 ||||| ||||| | |||||| |||||||| |||||||| || |||||||||||||||||| Sbjct: 1031 tcaagagcccgttctttgcctgtgaaagactggcctccagcctgctccatcaggaatgac 972 Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcgggg 483 ||||||||||| || ||||||||||| || ||||| || |||||||||||||| || ||| Sbjct: 971 atggggaaaacttcatacagaacacggagttttccatttgggctcttcttgtctgcaggg 912 Query: 484 taca 487 |||| Sbjct: 911 taca 908
>dbj|AB007193.1| Oryza sativa mRNA for fructose-1,6-bisphosphatase (cytosolic isoform), complete cds Length = 1544 Score = 127 bits (64), Expect = 4e-26 Identities = 109/124 (87%) Strand = Plus / Minus Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423 ||||| ||||| | |||||| |||||||| |||||||| || |||||||||||||||||| Sbjct: 1000 tcaagagcccgttctttgcctgtgaaagactggcctccagcctgctccatcaggaatgac 941 Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcgggg 483 ||||||||||| || ||||||||||| || ||||| || |||||||||||||| || ||| Sbjct: 940 atggggaaaacttcatacagaacacggagttttccatttgggctcttcttgtctgcaggg 881 Query: 484 taca 487 |||| Sbjct: 880 taca 877
>emb|X89006.1|SHRNAF16B Saccharum hybrid cultivar H65-7052 mRNA for cytosolic fructose-1,6-bisphosphatase Length = 1318 Score = 103 bits (52), Expect = 5e-19 Identities = 169/208 (81%) Strand = Plus / Minus Query: 280 gcgtacagtgatttaatctcctccacatcatcgtagctcccgaggaatatcggagacctc 339 ||||||| || ||| || ||||||||||| |||||||| |||||||||||||| || ||| Sbjct: 1074 gcgtacaatgctttgatttcctccacatcgtcgtagctgccgaggaatatcggggatctc 1015 Query: 340 tggtgtatgtcacaagggacaatttcaagggcccgctgtttgccggtgaaagattggcct 399 | ||| || | ||||| | ||||| ||||| | |||||| ||||| || || ||| Sbjct: 1014 tcgtggatcttggttgggaccagatcaagagcccgttctttgcctgtgaaggactgacct 955 Query: 400 ccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagctttccg 459 || || |||||||| |||||||||||||||||||| || || || ||||| |||||||| Sbjct: 954 ccagcctgctccattaggaatgacatggggaaaacttcataaaggacacggagctttcca 895 Query: 460 ttggggctcttcttgtccgcggggtaca 487 || |||||||||| ||| || ||||||| Sbjct: 894 tttgggctcttctggtcagcagggtaca 867
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 93.7 bits (47), Expect = 5e-16 Identities = 65/71 (91%) Strand = Plus / Minus Query: 378 tttgccggtgaaagattggcctccggcttgctccatcaggaatgacatggggaaaacctc 437 |||||| |||||||| |||||||| || ||||||||||||||||||||||||||||| || Sbjct: 37515196 tttgcctgtgaaagactggcctccagcctgctccatcaggaatgacatggggaaaacttc 37515137 Query: 438 gtacagaacac 448 |||||||||| Sbjct: 37515136 atacagaacac 37515126
>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0505D12 Length = 146951 Score = 93.7 bits (47), Expect = 5e-16 Identities = 65/71 (91%) Strand = Plus / Minus Query: 378 tttgccggtgaaagattggcctccggcttgctccatcaggaatgacatggggaaaacctc 437 |||||| |||||||| |||||||| || ||||||||||||||||||||||||||||| || Sbjct: 109733 tttgcctgtgaaagactggcctccagcctgctccatcaggaatgacatggggaaaacttc 109674 Query: 438 gtacagaacac 448 |||||||||| Sbjct: 109673 atacagaacac 109663
>gb|AF378183.1|AF378183 Oryza sativa cultivar Milyang23 cytosolic fructose-1 mRNA, partial cds Length = 504 Score = 85.7 bits (43), Expect = 1e-13 Identities = 70/79 (88%) Strand = Plus / Minus Query: 409 tccatcaggaatgacatggggaaaacctcgtacagaacacgaagctttccgttggggctc 468 ||||| |||||||||||||||||||| || ||||||||||| || ||||| || |||||| Sbjct: 500 tccattaggaatgacatggggaaaacttcatacagaacacggagttttccatttgggctc 441 Query: 469 ttcttgtccgcggggtaca 487 |||||||| || ||||||| Sbjct: 440 ttcttgtctgcagggtaca 422
>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0042J17, complete sequence Length = 124139 Score = 83.8 bits (42), Expect = 5e-13 Identities = 69/78 (88%) Strand = Plus / Plus Query: 371 cccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgacatgggga 430 |||| |||||||| ||||||| ||| ||||| ||||||||||||| ||||||||| |||| Sbjct: 67584 cccgttgtttgcctgtgaaagcttgtcctccagcttgctccatcaagaatgacattggga 67643 Query: 431 aaacctcgtacagaacac 448 | || ||||||||||||| Sbjct: 67644 acacttcgtacagaacac 67661
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 83.8 bits (42), Expect = 5e-13 Identities = 69/78 (88%) Strand = Plus / Plus Query: 371 cccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgacatgggga 430 |||| |||||||| ||||||| ||| ||||| ||||||||||||| ||||||||| |||| Sbjct: 21350262 cccgttgtttgcctgtgaaagcttgtcctccagcttgctccatcaagaatgacattggga 21350321 Query: 431 aaacctcgtacagaacac 448 | || ||||||||||||| Sbjct: 21350322 acacttcgtacagaacac 21350339
>emb|X61690.1|SOFBPY S.olearacea Scytfbpy gene for fructose-1,6-bisphosphatase Length = 1585 Score = 67.9 bits (34), Expect = 3e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423 ||||| ||||| ||||||||||| |||| ||| || || ||||| ||||| | ||| ||| Sbjct: 1189 tcaagtgcccgttgtttgccggtaaaagcttgtccgccagcttgttccattaagaaggac 1130 Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttctt 473 || || || |||||||| ||||| | || |||||||||||||||||||| Sbjct: 1129 attggaaagacctcgtagagaactcttagttttccgttggggctcttctt 1080
>gb|AY093594.1| Pisum sativum cytoplasmic fructose-1,6-bisphosphatase mRNA, complete cds Length = 1062 Score = 67.9 bits (34), Expect = 3e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423 ||||| ||||| ||||||||||| |||| ||| || || ||||| ||||| | ||| ||| Sbjct: 920 tcaagtgcccgttgtttgccggtaaaagcttgtccgccagcttgttccattaagaaggac 861 Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttctt 473 || || || |||||||| ||||| | || |||||||||||||||||||| Sbjct: 860 attggaaagacctcgtagagaactcttagttttccgttggggctcttctt 811
>gb|M80597.1|BEUF16BPP Beta vulgaris cytosolic fructose-1,6-bisphosphatase mRNA, complete cds Length = 1278 Score = 67.9 bits (34), Expect = 3e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423 ||||| ||||| |||| ||| || |||| ||| || || ||||||||||| | ||||||| Sbjct: 961 tcaagtgcccgttgttcgccagtaaaagcttgtccacctgcttgctccattaagaatgac 902 Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttctt 473 ||||| || ||||| || ||||| || || |||||||| ||||||||||| Sbjct: 901 atgggaaagacctcataaagaactcgtagttttccgttagggctcttctt 852
>gb|AF317553.1|AF317553 Beta vulgaris cytosolic fructose-1,6-bisphosphatase mRNA, complete cds Length = 1279 Score = 67.9 bits (34), Expect = 3e-08 Identities = 91/110 (82%) Strand = Plus / Minus Query: 364 tcaagggcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgac 423 ||||| ||||| |||| ||| || |||| ||| || || ||||||||||| | ||||||| Sbjct: 962 tcaagtgcccgttgttcgccagtaaaagcttgtccacctgcttgctccattaagaatgac 903 Query: 424 atggggaaaacctcgtacagaacacgaagctttccgttggggctcttctt 473 ||||| || ||||| || ||||| || || |||||||| ||||||||||| Sbjct: 902 atgggaaagacctcataaagaactcgtagttttccgttagggctcttctt 853
>emb|AJ243392.1|PSA243392 Pisum sativum mRNA for cytosolic fructose-1,6-bisphosphatase Length = 990 Score = 65.9 bits (33), Expect = 1e-07 Identities = 90/109 (82%) Strand = Plus / Minus Query: 379 ttgccggtgaaagattggcctccggcttgctccatcaggaatgacatggggaaaacctcg 438 |||||||||||||| || |||||||| || ||||||| ||| ||||| ||||| || || Sbjct: 869 ttgccggtgaaagactgtcctccggcctgttccatcaagaaggacattgggaagacttca 810 Query: 439 tacagaacacgaagctttccgttggggctcttcttgtccgcggggtaca 487 |||| |||||||| ||||| || || ||||| ||||| || ||||||| Sbjct: 809 tacaatacacgaagttttccatttggactctttttgtcagcagggtaca 761
>ref|NM_103492.3| Arabidopsis thaliana fructose-bisphosphatase/ phosphoric ester hydrolase AT1G43670 mRNA, complete cds Length = 1253 Score = 61.9 bits (31), Expect = 2e-06 Identities = 76/91 (83%) Strand = Plus / Minus Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456 ||||||||||||||||||| || ||||| |||||||| || |||| ||||| | ||| Sbjct: 964 cctccggcttgctccatcaaaaacgacatcgggaaaacttcatacaagacacgcaatttt 905 Query: 457 ccgttggggctcttcttgtccgcggggtaca 487 || |||||||| |||||||| || ||||||| Sbjct: 904 ccattggggcttttcttgtcagccgggtaca 874 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 291 tttaatctcctccacatcatcgtagctcccgaggaatatcggaga 335 ||||||||| || |||||||||||||| || || ||||||||||| Sbjct: 1070 tttaatctcttctacatcatcgtagctaccaagaaatatcggaga 1026
>ref|XM_364050.1| Magnaporthe grisea 70-15 hypothetical protein (MG08895.4) partial cds Length = 1035 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 435 ctcgtacagaacacgaagctttccgttggggctcttcttgtccgcggggta 485 |||||||| || ||||||||| || ||||||||||||||||| |||||||| Sbjct: 873 ctcgtacaaaatacgaagcttgcccttggggctcttcttgtcggcggggta 823
>gb|BT000470.1| Arabidopsis thaliana fructose 1,6-bisphosphatase, putative (At1g43670) mRNA, complete cds Length = 1200 Score = 61.9 bits (31), Expect = 2e-06 Identities = 76/91 (83%) Strand = Plus / Minus Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456 ||||||||||||||||||| || ||||| |||||||| || |||| ||||| | ||| Sbjct: 934 cctccggcttgctccatcaaaaacgacatcgggaaaacttcatacaagacacgcaatttt 875 Query: 457 ccgttggggctcttcttgtccgcggggtaca 487 || |||||||| |||||||| || ||||||| Sbjct: 874 ccattggggcttttcttgtcagccgggtaca 844 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 291 tttaatctcctccacatcatcgtagctcccgaggaatatcggaga 335 ||||||||| || |||||||||||||| || || ||||||||||| Sbjct: 1040 tttaatctcttctacatcatcgtagctaccaagaaatatcggaga 996
>gb|BT008732.1| Arabidopsis thaliana At1g43670 gene, complete cds Length = 1026 Score = 61.9 bits (31), Expect = 2e-06 Identities = 76/91 (83%) Strand = Plus / Minus Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456 ||||||||||||||||||| || ||||| |||||||| || |||| ||||| | ||| Sbjct: 887 cctccggcttgctccatcaaaaacgacatcgggaaaacttcatacaagacacgcaatttt 828 Query: 457 ccgttggggctcttcttgtccgcggggtaca 487 || |||||||| |||||||| || ||||||| Sbjct: 827 ccattggggcttttcttgtcagccgggtaca 797 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 291 tttaatctcctccacatcatcgtagctcccgaggaatatcggaga 335 ||||||||| || |||||||||||||| || || ||||||||||| Sbjct: 993 tttaatctcttctacatcatcgtagctaccaagaaatatcggaga 949
>gb|BC012927.1| Homo sapiens fructose-1,6-bisphosphatase 1, mRNA (cDNA clone MGC:21278 IMAGE:4517633), complete cds Length = 1513 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||||| |||||||||||||||| |||||||||||||| Sbjct: 1024 agctttccattggggctcttcttgttagcggggtacagaaa 984
>ref|NM_000507.2| Homo sapiens fructose-1,6-bisphosphatase 1 (FBP1), mRNA Length = 1527 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||||| |||||||||||||||| |||||||||||||| Sbjct: 1038 agctttccattggggctcttcttgttagcggggtacagaaa 998
>gb|AF378182.1|AF378182 Oryza sativa cultivar Stejaree45 cytosolic fructose-1 mRNA, partial cds Length = 461 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 439 tacagaacacgaagctttccgttggggctcttcttgtccgcggggtaca 487 |||||||||||||| |||||||| |||||||||| ||||| ||||||| Sbjct: 461 tacagaacacgaagttttccgtttgggctcttctgatccgcagggtaca 413
>dbj|AK223395.1| Homo sapiens mRNA for fructose-1,6-bisphosphatase 1 variant, clone: FCC107D09 Length = 1557 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||||| |||||||||||||||| |||||||||||||| Sbjct: 1102 agctttccattggggctcttcttgttagcggggtacagaaa 1062
>gb|AF073475.1|AF073475 Homo sapiens fructose-1,6-bisphosphatase (FBP1) mRNA, partial cds Length = 1011 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||||| |||||||||||||||| |||||||||||||| Sbjct: 824 agctttccattggggctcttcttgttagcggggtacagaaa 784
>dbj|D26054.1|HUMF16B1 Homo sapiens mRNA for fructose-1,6-bisphosphatase, complete cds Length = 1051 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||||| |||||||||||||||| |||||||||||||| Sbjct: 833 agctttccattggggctcttcttgttagcggggtacagaaa 793
>gb|AY544122.1| Homo sapiens growth-inhibiting protein 17 mRNA, complete cds Length = 1145 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||||| |||||||||||||||| |||||||||||||| Sbjct: 914 agctttccattggggctcttcttgttagcggggtacagaaa 874
>gb|L10320.1|HUMF16BPA Human fructose-1,6-bisphosphatase homotetramer gene, complete cds Length = 1401 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||||| |||||||||||||||| |||||||||||||| Sbjct: 969 agctttccattggggctcttcttgttagcggggtacagaaa 929
>gb|M19922.1|HUMALD Human fructose 1,6-bisphosphatase mRNA, complete cds Length = 1382 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||||| |||||||||||||||| |||||||||||||| Sbjct: 1025 agctttccattggggctcttcttgttagcggggtacagaaa 985
>dbj|D26056.1|HUMF16B3 Human mRNA for fructose-1,6-bisphosphatase, complete cds Length = 1051 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||||| |||||||||||||||| |||||||||||||| Sbjct: 833 agctttccattggggctcttcttgttagcggggtacagaaa 793
>dbj|D26055.1|HUMF16B2 Human mRNA for fructose-1,6-bisphosphatase, complete cds Length = 1051 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||||| |||||||||||||||| |||||||||||||| Sbjct: 833 agctttccattggggctcttcttgttagcggggtacagaaa 793
>ref|XM_520717.1| PREDICTED: Pan troglodytes similar to Fructose-1,6-bisphosphatase (D-fructose-1,6-bisphosphate 1-phosphohydrolase) (FBPase) (LOC465260), mRNA Length = 2142 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 452 gctttccgttggggctcttcttgtccgcggggtacagaaa 491 ||||||| |||||||||||||||| |||||||||||||| Sbjct: 1830 gctttccattggggctcttcttgttagcggggtacagaaa 1791
>ref|XM_324153.1| Neurospora crassa OR74A hypothetical protein (NCU04797.1) partial mRNA Length = 1053 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 435 ctcgtacagaacacgaagctttccgttggggctcttcttgtccgcggggtac 486 ||||||||||| ||| ||||| || ||||||||||||||||| || |||||| Sbjct: 885 ctcgtacagaatacgcagcttgcccttggggctcttcttgtctgccgggtac 834
>ref|XM_955330.1| Neurospora crassa OR74A hypothetical protein (NCU04797.1) partial mRNA Length = 1053 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 435 ctcgtacagaacacgaagctttccgttggggctcttcttgtccgcggggtac 486 ||||||||||| ||| ||||| || ||||||||||||||||| || |||||| Sbjct: 885 ctcgtacagaatacgcagcttgcccttggggctcttcttgtctgccgggtac 834
>gb|AY866483.1| Homo sapiens fructose-1,6-bisphosphatase 1 (FBP1) gene, complete cds Length = 40644 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 453 ctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||| |||||||||||||||| |||||||||||||| Sbjct: 36326 ctttccattggggctcttcttgttagcggggtacagaaa 36288
>gb|BT012957.1| Lycopersicon esculentum clone 114145F, mRNA sequence Length = 1463 Score = 54.0 bits (27), Expect = 4e-04 Identities = 75/91 (82%) Strand = Plus / Minus Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456 ||||| ||||| |||||||| ||||||||||| || || || || ||||| | ||||| Sbjct: 905 cctcctgcttgttccatcagaaatgacatgggaaatacttcatagagaaccctcagcttc 846 Query: 457 ccgttggggctcttcttgtccgcggggtaca 487 ||||||||||| ||||| || ||||||||| Sbjct: 845 ccgttggggcttttcttatctccggggtaca 815
>gb|BT013377.1| Lycopersicon esculentum clone 135407F, mRNA sequence Length = 641 Score = 54.0 bits (27), Expect = 4e-04 Identities = 75/91 (82%) Strand = Plus / Minus Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456 ||||| ||||| |||||||| ||||||||||| || || || || ||||| || ||||| Sbjct: 297 cctcctgcttgttccatcagaaatgacatgggaaatacttcatagagaacccgtagcttc 238 Query: 457 ccgttggggctcttcttgtccgcggggtaca 487 || |||||||| ||||| || || ||||||| Sbjct: 237 ccattggggcttttcttatcagctgggtaca 207 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 295 atctcctccacatcatcgtagctcccgaggaatat 329 |||||||||||||||||||| || || |||||||| Sbjct: 399 atctcctccacatcatcgtaactaccaaggaatat 365
>emb|AL161728.25| Human DNA sequence from clone RP11-342C23 on chromosome 9 Contains the FBP1 gene for Fructose-1,6-bisphosphatase 1, a novel gene, the FBP2 gene for Fructose-1,6-bisphosphatase 2, a gene for a putative novel protein and one CpG island, complete sequence Length = 170532 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 453 ctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||| |||||||||||||||| |||||||||||||| Sbjct: 85908 ctttccattggggctcttcttgttagcggggtacagaaa 85870
>emb|X76946.1|STCYF1 S.tuberosum cy-F1 mRNA for cytosolic fructose-1,6-biphosphatase Length = 1487 Score = 54.0 bits (27), Expect = 4e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 393 ttggcctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaag 452 ||||||||| ||||| |||||||| ||||||||||| || || || || ||||| | || Sbjct: 1089 ttggcctcctgcttgttccatcagaaatgacatgggaaatacttcatagagaaccctcag 1030 Query: 453 ctttccgttggggctcttcttgtccgcggggtaca 487 || ||||||||||| ||||| || ||||||||| Sbjct: 1029 tttcccgttggggcttttcttatctccggggtaca 995
>gb|AY035554.1| Oryza sativa cytosolic fructose-1,6-bisphosphatase mRNA, partial cds Length = 459 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 441 cagaacacgaagctttccgttggggctcttcttgtccgcggggtaca 487 |||||||||||| |||||||| |||||||||| ||||| ||||||| Sbjct: 459 cagaacacgaagttttccgtttgggctcttctgatccgcagggtaca 413
>gb|U21930.1|HSLFBPS6 Human fructose-1,6-biphosphatase (FBP1) gene, exon 6 Length = 1314 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 453 ctttccgttggggctcttcttgtccgcggggtacagaaa 491 |||||| |||||||||||||||| |||||||||||||| Sbjct: 1014 ctttccattggggctcttcttgttagcggggtacagaaa 976
>gb|AC009526.4|AC009526 Arabidopsis thaliana chromosome I BAC F2J6 genomic sequence, complete sequence Length = 108061 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 291 tttaatctcctccacatcatcgtagctcccgaggaatatcggaga 335 ||||||||| || |||||||||||||| || || ||||||||||| Sbjct: 28726 tttaatctcttctacatcatcgtagctaccaagaaatatcggaga 28682 Score = 44.1 bits (22), Expect = 0.43 Identities = 34/38 (89%) Strand = Plus / Minus Query: 397 cctccggcttgctccatcaggaatgacatggggaaaac 434 ||||||||||||||||||| || ||||| |||||||| Sbjct: 28534 cctccggcttgctccatcaaaaacgacatcgggaaaac 28497
>gb|DQ165552.1| Brassica rapa subsp. pekinensis fructose 1,6-bisphosphatase mRNA, complete cds Length = 1377 Score = 48.1 bits (24), Expect = 0.027 Identities = 75/92 (81%) Strand = Plus / Minus Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456 ||||| ||||||||||||| ||| | ||| ||||| || || ||||| ||||| | || Sbjct: 1110 cctccagcttgctccatcaagaacgccattgggaagacttcatacaggacacgcaatttc 1051 Query: 457 ccgttggggctcttcttgtccgcggggtacag 488 || |||||||| |||||||| || |||||||| Sbjct: 1050 ccattggggcttttcttgtcagccgggtacag 1019
>ref|XM_533503.2| PREDICTED: Canis familiaris similar to fructose-1,6-bisphosphatase 1, transcript variant 1 (LOC476299), mRNA Length = 1174 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 453 ctttccgttggggctcttcttgtccgcggggtacag 488 |||||| |||||||||||||||| ||| |||||||| Sbjct: 745 ctttcccttggggctcttcttgttcgctgggtacag 710
>ref|XM_850754.1| PREDICTED: Canis familiaris similar to fructose-1,6-bisphosphatase 1, transcript variant 4 (LOC476299), mRNA Length = 1259 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 453 ctttccgttggggctcttcttgtccgcggggtacag 488 |||||| |||||||||||||||| ||| |||||||| Sbjct: 832 ctttcccttggggctcttcttgttcgctgggtacag 797
>ref|XM_843213.1| PREDICTED: Canis familiaris similar to fructose-1,6-bisphosphatase 1, transcript variant 3 (LOC476299), mRNA Length = 1492 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 453 ctttccgttggggctcttcttgtccgcggggtacag 488 |||||| |||||||||||||||| ||| |||||||| Sbjct: 1063 ctttcccttggggctcttcttgttcgctgggtacag 1028
>gb|AF130251.1|AF130251 Musa acuminata cytosolic fructose-1,6-bisphosphatase (FBPban1) mRNA, complete cds Length = 1237 Score = 48.1 bits (24), Expect = 0.027 Identities = 93/116 (80%) Strand = Plus / Minus Query: 370 gcccgctgtttgccggtgaaagattggcctccggcttgctccatcaggaatgacatgggg 429 ||||| || ||||| || |||| ||| || || ||||| ||||||||||||||||| || Sbjct: 973 gcccgttgcttgccagtaaaagcttgaccccctgcttgttccatcaggaatgacattgga 914 Query: 430 aaaacctcgtacagaacacgaagctttccgttggggctcttcttgtccgcggggta 485 || || || || |||||||| || || || || || |||||||| ||||| ||||| Sbjct: 913 aatacttcatatagaacacgtagtttcccatttggactcttcttatccgcagggta 858
>gb|U20179.1|BNU20179 Brassica napus fructose 1,6-bisphosphatase mRNA, complete cds Length = 1132 Score = 48.1 bits (24), Expect = 0.027 Identities = 75/92 (81%) Strand = Plus / Minus Query: 397 cctccggcttgctccatcaggaatgacatggggaaaacctcgtacagaacacgaagcttt 456 ||||| ||||||||||||| ||| | ||| ||||| || || ||||| ||||| | || Sbjct: 918 cctccagcttgctccatcaagaacgccattgggaagacttcatacaggacacgcaatttc 859 Query: 457 ccgttggggctcttcttgtccgcggggtacag 488 || |||||||| |||||||| || |||||||| Sbjct: 858 ccattggggcttttcttgtcagccgggtacag 827
>gb|AY692816.1| Saccharomyces cerevisiae clone FLH113339.01X YLR377C gene, complete cds Length = 1047 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 454 tttccgttggggctcttcttgtc 476 ||||||||||||||||||||||| Sbjct: 857 tttccgttggggctcttcttgtc 835
>ref|XM_389456.1| Gibberella zeae PH-1 chromosome 4 conserved hypothetical protein (FG09280.1) partial mRNA Length = 1029 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggta 485 ||||| || ||||||||||||||||| |||||||| Sbjct: 851 agcttgcccttggggctcttcttgtcggcggggta 817
>emb|Y00754.1|SCFBP1 Yeast FBP1 gene for fructose-1.6-bisphosphatase (EC 3.1.3.11) Length = 1869 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 454 tttccgttggggctcttcttgtc 476 ||||||||||||||||||||||| Sbjct: 1175 tttccgttggggctcttcttgtc 1153
>gb|U19103.1|YSCL8039 Saccharomyces cerevisiae chromosome XII cosmid 8039 Length = 31806 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 454 tttccgttggggctcttcttgtc 476 ||||||||||||||||||||||| Sbjct: 29703 tttccgttggggctcttcttgtc 29725
>gb|J03207.1|YSCFBPA S.cerevisiae fructose-1,6-bisphosphatase (FBP) gene, complete cds Length = 2202 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 454 tttccgttggggctcttcttgtc 476 ||||||||||||||||||||||| Sbjct: 1498 tttccgttggggctcttcttgtc 1476
>emb|AL115150.1|CNS01C6U Botrytis cinerea strain T4 cDNA library Length = 540 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 460 ttggggctcttcttgtccgcggggta 485 ||||||||||| |||||||||||||| Sbjct: 283 ttggggctctttttgtccgcggggta 258
>emb|AL113555.1|CNS01AYJ Botrytis cinerea strain T4 cDNA library Length = 708 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 460 ttggggctcttcttgtccgcggggta 485 ||||||||||| |||||||||||||| Sbjct: 429 ttggggctctttttgtccgcggggta 404
>ref|XM_977287.1| PREDICTED: Mus musculus hypothetical protein LOC621809 (LOC621809), mRNA Length = 923 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 134 ggtgaatgttttctaaacatcaccc 158 |||||||| |||||||||||||||| Sbjct: 148 ggtgaatggtttctaaacatcaccc 124
>ref|XM_988157.1| PREDICTED: Mus musculus hypothetical protein LOC621809 (LOC621809), mRNA Length = 923 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 134 ggtgaatgttttctaaacatcaccc 158 |||||||| |||||||||||||||| Sbjct: 148 ggtgaatggtttctaaacatcaccc 124
>ref|XM_896651.2| PREDICTED: Mus musculus hypothetical protein LOC621809 (LOC621809), mRNA Length = 923 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 134 ggtgaatgttttctaaacatcaccc 158 |||||||| |||||||||||||||| Sbjct: 148 ggtgaatggtttctaaacatcaccc 124
>emb|CR731123.2|CNS0GR2W Tetraodon nigroviridis full-length cDNA Length = 1218 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 875 agctttcccttggggctcttctcgttggcggggtaca 839
>emb|CR729935.2|CNS0GQ5X Tetraodon nigroviridis full-length cDNA Length = 1216 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 872 agctttcccttggggctcttctcgttggcggggtaca 836
>emb|CR729491.2|CNS0GPTL Tetraodon nigroviridis full-length cDNA Length = 1283 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 940 agctttcccttggggctcttctcgttggcggggtaca 904
>emb|CR727752.2|CNS0GOHA Tetraodon nigroviridis full-length cDNA Length = 1280 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 936 agctttcccttggggctcttctcgttggcggggtaca 900
>emb|CR727289.2|CNS0GO4F Tetraodon nigroviridis full-length cDNA Length = 1217 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
>emb|CR726696.1|CNS0GNNY Tetraodon nigroviridis full-length cDNA Length = 1270 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 933 agctttcccttggggctcttctcgttggcggggtaca 897
>emb|CR723913.2|CNS0GLIN Tetraodon nigroviridis full-length cDNA Length = 1224 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 877 agctttcccttggggctcttctcgttggcggggtaca 841
>emb|CR701043.2|CNS0G3VJ Tetraodon nigroviridis full-length cDNA Length = 1214 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 875 agctttcccttggggctcttctcgttggcggggtaca 839
>emb|CR688453.2|CNS0FU5T Tetraodon nigroviridis full-length cDNA Length = 1214 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
>emb|CR689786.1|CNS0FV6U Tetraodon nigroviridis full-length cDNA Length = 1185 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 863 agctttcccttggggctcttctcgttggcggggtaca 827
>emb|CR688620.2|CNS0FUAG Tetraodon nigroviridis full-length cDNA Length = 1199 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 866 agctttcccttggggctcttctcgttggcggggtaca 830
>emb|CR681314.1|CNS0FONI Tetraodon nigroviridis full-length cDNA Length = 1191 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 865 agctttcccttggggctcttctcgttggcggggtaca 829
>emb|CR679766.2|CNS0FNGI Tetraodon nigroviridis full-length cDNA Length = 1183 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 858 agctttcccttggggctcttctcgttggcggggtaca 822
>emb|CR679267.2|CNS0FN2N Tetraodon nigroviridis full-length cDNA Length = 1213 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 875 agctttcccttggggctcttctcgttggcggggtaca 839
>emb|CR678962.2|CNS0FMU6 Tetraodon nigroviridis full-length cDNA Length = 1213 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
>emb|CR679150.1|CNS0FMZE Tetraodon nigroviridis full-length cDNA Length = 1200 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 863 agctttcccttggggctcttctcgttggcggggtaca 827
>emb|CR677858.1|CNS0FLZU Tetraodon nigroviridis full-length cDNA Length = 1199 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 863 agctttcccttggggctcttctcgttggcggggtaca 827
>emb|CR677925.2|CNS0FM1P Tetraodon nigroviridis full-length cDNA Length = 1440 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
>emb|CR676053.2|CNS0FKM3 Tetraodon nigroviridis full-length cDNA Length = 1212 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
>emb|CR675016.2|CNS0FJTA Tetraodon nigroviridis full-length cDNA Length = 1219 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 875 agctttcccttggggctcttctcgttggcggggtaca 839
>emb|CR674539.2|CNS0FJG1 Tetraodon nigroviridis full-length cDNA Length = 1218 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
>emb|CR674763.1|CNS0FJM9 Tetraodon nigroviridis full-length cDNA Length = 1199 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
>emb|CR674395.2|CNS0FJC1 Tetraodon nigroviridis full-length cDNA Length = 1239 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 898 agctttcccttggggctcttctcgttggcggggtaca 862
>emb|CR673987.2|CNS0FJ0P Tetraodon nigroviridis full-length cDNA Length = 1216 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 875 agctttcccttggggctcttctcgttggcggggtaca 839
>emb|CR673697.2|CNS0FISN Tetraodon nigroviridis full-length cDNA Length = 1217 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
>emb|CR672580.2|CNS0FHXM Tetraodon nigroviridis full-length cDNA Length = 1218 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 921 agctttcccttggggctcttctcgttggcggggtaca 885
>emb|CR672777.1|CNS0FI33 Tetraodon nigroviridis full-length cDNA Length = 1521 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 871 agctttcccttggggctcttctcgttggcggggtaca 835
>emb|CR671973.2|CNS0FHGR Tetraodon nigroviridis full-length cDNA Length = 1210 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
>emb|CR671920.2|CNS0FHFA Tetraodon nigroviridis full-length cDNA Length = 1280 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 937 agctttcccttggggctcttctcgttggcggggtaca 901
>emb|CR670679.2|CNS0FGGT Tetraodon nigroviridis full-length cDNA Length = 1215 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 896 agctttcccttggggctcttctcgttggcggggtaca 860
>emb|CR670270.2|CNS0FG5G Tetraodon nigroviridis full-length cDNA Length = 1199 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 868 agctttcccttggggctcttctcgttggcggggtaca 832
>emb|CR666565.2|CNS0FDAJ Tetraodon nigroviridis full-length cDNA Length = 1222 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 897 agctttcccttggggctcttctcgttggcggggtaca 861
>emb|CR666528.2|CNS0FD9I Tetraodon nigroviridis full-length cDNA Length = 1210 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
>emb|CR664928.2|CNS0FC12 Tetraodon nigroviridis full-length cDNA Length = 1210 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 873 agctttcccttggggctcttctcgttggcggggtaca 837
>emb|CR664903.2|CNS0FC0D Tetraodon nigroviridis full-length cDNA Length = 1205 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 874 agctttcccttggggctcttctcgttggcggggtaca 838
>emb|CR663156.2|CNS0FANU Tetraodon nigroviridis full-length cDNA Length = 1239 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 900 agctttcccttggggctcttctcgttggcggggtaca 864
>emb|CR662062.2|CNS0F9TG Tetraodon nigroviridis full-length cDNA Length = 1190 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 848 agctttcccttggggctcttctcgttggcggggtaca 812
>emb|CR661920.2|CNS0F9PI Tetraodon nigroviridis full-length cDNA Length = 1158 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 860 agctttcccttggggctcttctcgttggcggggtaca 824
>emb|CR661599.2|CNS0F9GL Tetraodon nigroviridis full-length cDNA Length = 1207 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 870 agctttcccttggggctcttctcgttggcggggtaca 834
>emb|CR660832.2|CNS0F8VA Tetraodon nigroviridis full-length cDNA Length = 1561 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 876 agctttcccttggggctcttctcgttggcggggtaca 840
>emb|CR660718.2|CNS0F8S4 Tetraodon nigroviridis full-length cDNA Length = 1163 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 866 agctttcccttggggctcttctcgttggcggggtaca 830
>emb|CR659043.2|CNS0F7HL Tetraodon nigroviridis full-length cDNA Length = 1216 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 877 agctttcccttggggctcttctcgttggcggggtaca 841
>emb|CR659356.1|CNS0F7QA Tetraodon nigroviridis full-length cDNA Length = 1224 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 900 agctttcccttggggctcttctcgttggcggggtaca 864
>emb|CR658470.2|CNS0F71O Tetraodon nigroviridis full-length cDNA Length = 1220 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 876 agctttcccttggggctcttctcgttggcggggtaca 840
>emb|CR658127.2|CNS0F6S5 Tetraodon nigroviridis full-length cDNA Length = 1200 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 866 agctttcccttggggctcttctcgttggcggggtaca 830
>emb|CR657521.2|CNS0F6BB Tetraodon nigroviridis full-length cDNA Length = 1210 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 872 agctttcccttggggctcttctcgttggcggggtaca 836
>emb|CR657430.2|CNS0F68S Tetraodon nigroviridis full-length cDNA Length = 1203 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 865 agctttcccttggggctcttctcgttggcggggtaca 829
>emb|CR656919.1|CNS0F5UL Tetraodon nigroviridis full-length cDNA Length = 1200 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 868 agctttcccttggggctcttctcgttggcggggtaca 832
>emb|CR655445.2|CNS0F4PN Tetraodon nigroviridis full-length cDNA Length = 533 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgtccgcggggtaca 487 |||||||| ||||||||||||| || |||||||||| Sbjct: 194 agctttcccttggggctcttctcgttggcggggtaca 158
>ref|XM_777318.1| PREDICTED: Strongylocentrotus purpuratus similar to fructose-1,6-bisphosphatase 1, like (LOC577064), mRNA Length = 1100 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 451 agctttccgttggggctcttcttgt 475 |||||||| |||||||||||||||| Sbjct: 913 agctttcccttggggctcttcttgt 889
>dbj|AK043613.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830012D13 product:unclassifiable, full insert sequence Length = 925 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 134 ggtgaatgttttctaaacatcaccc 158 |||||||| |||||||||||||||| Sbjct: 150 ggtgaatggtttctaaacatcaccc 126
>gb|AC157819.5| Mus musculus chromosome 3, clone RP24-273H20, complete sequence Length = 151601 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 134 ggtgaatgttttctaaacatcaccc 158 |||||||| |||||||||||||||| Sbjct: 45664 ggtgaatggtttctaaacatcaccc 45640
>gb|AC103937.16| Mus musculus chromosome 3, clone RP23-229C5, complete sequence Length = 179805 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 134 ggtgaatgttttctaaacatcaccc 158 |||||||| |||||||||||||||| Sbjct: 118921 ggtgaatggtttctaaacatcaccc 118897
>gb|AC093267.2| Homo sapiens chromosome 5 clone RP11-280F11, complete sequence Length = 170999 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 tgaacataacttttcctttt 220 |||||||||||||||||||| Sbjct: 36201 tgaacataacttttcctttt 36182
>emb|CT010516.6| Mouse DNA sequence from clone RP23-276H24 on chromosome 14, complete sequence Length = 194815 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 453 ctttccgttggggctcttct 472 |||||||||||||||||||| Sbjct: 47339 ctttccgttggggctcttct 47358 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,193,951 Number of Sequences: 3902068 Number of extensions: 3193951 Number of successful extensions: 49772 Number of sequences better than 10.0: 114 Number of HSP's better than 10.0 without gapping: 114 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 49606 Number of HSP's gapped (non-prelim): 165 length of query: 491 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 469 effective length of database: 17,147,199,772 effective search space: 8042036693068 effective search space used: 8042036693068 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)