| Clone Name | rbart14b11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY430222.1| Regalecus glesne recombination activating protein 1 (RAG1) gene, partial cds Length = 1469 Score = 40.1 bits (20), Expect = 0.85 Identities = 20/20 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatcg 71 |||||||||||||||||||| Sbjct: 333 tgacatcccccatgccatcg 314
>gb|AY380535.1| Salvelinus malma recombination-activating protein 1 (RAG1) gene, partial cds Length = 1556 Score = 40.1 bits (20), Expect = 0.85 Identities = 20/20 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatcg 71 |||||||||||||||||||| Sbjct: 366 tgacatcccccatgccatcg 347
>gb|AY552034.1| Hypancistrus sp. CAC-2004 RAG1 gene, exon 3 and partial cds Length = 938 Score = 40.1 bits (20), Expect = 0.85 Identities = 20/20 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatcg 71 |||||||||||||||||||| Sbjct: 366 tgacatcccccatgccatcg 347
>gb|AY308790.1| Rhinecanthus aculeatus recombinase activating gene-1 (RAG1) gene, partial cds Length = 1447 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 316 tgacatcccccatgccatc 298
>gb|AY308783.1| Mugil curema recombinase activating gene-1 (RAG1) gene, partial cds Length = 1455 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 316 tgacatcccccatgccatc 298
>gb|AY308771.1| Scomberesox saurus recombinase activating gene-1 (RAG1) gene, partial cds Length = 1455 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 316 tgacatcccccatgccatc 298
>gb|AY359225.1| Gymnotus cf. maculosus specimen-voucher STRI-1470 RAG-1 (RAG-1) gene, partial cds Length = 1171 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 346 tgacatcccccatgccatc 328
>gb|AF043698.2| Caenorhabditis elegans cosmid C54G6, complete sequence Length = 27396 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 20 tcatttttccccgagcaac 38 ||||||||||||||||||| Sbjct: 16595 tcatttttccccgagcaac 16577
>ref|XM_694775.1| PREDICTED: Danio rerio similar to Kinetochore-associated protein 1 (Rough deal homolog) (hRod) (HsROD) (Rod) (LOC571206), partial mRNA Length = 606 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2 ctctagctaacactcgctt 20 ||||||||||||||||||| Sbjct: 479 ctctagctaacactcgctt 497
>gb|AY700320.1| Balistoides viridescens isolate BA16 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1392 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 289 tgacatcccccatgccatc 271
>gb|AY700318.1| Abalistes stellatus isolate BA14 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1392 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 289 tgacatcccccatgccatc 271
>gb|AY700316.1| Xanthichthys auromarginatus isolate BA12 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1379 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 276 tgacatcccccatgccatc 258
>gb|AY700315.1| Rhinecanthus assasi isolate BA11 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1392 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 289 tgacatcccccatgccatc 271
>gb|AY700314.1| Pseudobalistes fuscus isolate BA09 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1392 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 289 tgacatcccccatgccatc 271
>gb|AY700313.1| Melichthys niger isolate BA07 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1392 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 289 tgacatcccccatgccatc 271
>gb|AY700312.1| Canthidermis maculatus isolate BA06 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1377 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 289 tgacatcccccatgccatc 271
>gb|AY700311.1| Balistoides conspicillum isolate BA05 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1392 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 289 tgacatcccccatgccatc 271
>gb|AY700310.1| Balistes vetula isolate BA03 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1392 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 289 tgacatcccccatgccatc 271
>gb|AY700309.1| Balistes polylepis isolate BA02 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1392 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 289 tgacatcccccatgccatc 271
>gb|AY700308.1| Balistes capriscus isolate BA01 recombinase activating gene 1 (RAG1) gene, partial cds Length = 1392 Score = 38.2 bits (19), Expect = 3.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 tgacatcccccatgccatc 70 ||||||||||||||||||| Sbjct: 289 tgacatcccccatgccatc 271 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 481,524 Number of Sequences: 3902068 Number of extensions: 481524 Number of successful extensions: 27921 Number of sequences better than 10.0: 20 Number of HSP's better than 10.0 without gapping: 20 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 27901 Number of HSP's gapped (non-prelim): 20 length of query: 81 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 60 effective length of database: 17,151,101,840 effective search space: 1029066110400 effective search space used: 1029066110400 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)