| Clone Name | rbaet95g11 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AB029935.1| Triticum aestivum mRNA for chitinase 2, complete cds Length = 1163 Score = 268 bits (135), Expect = 1e-68 Identities = 183/199 (91%) Strand = Plus / Minus Query: 224 atctcactgcaccgcgagcccgatgttgaacgacaattggttagagcagtcgaggttatt 283 ||||||||| |||||||||| | |||||||||||||||||| |||||||||||||||| Sbjct: 983 atctcactgtgccgcgagcccaacgttgaacgacaattggttgtagcagtcgaggttatt 924 Query: 284 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccac 343 |||||||||||||||||| |||||||| ||||||||||||||||||||||| || ||||| Sbjct: 923 cccgtagccgatgccgaaaatgtcacaatagcgcttgtagaacccgatccgatccgccac 864 Query: 344 cttgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgcc 403 |||||||||||||||| ||||||||||||||||||| ||||||||||||||||| || || Sbjct: 863 cttgtcgttctgccccatgccgcattcgatcccgccgttgatgacgttggtgatgacacc 804 Query: 404 gtatccgggtacccgtccg 422 || ||||||||||||||| Sbjct: 803 atacccgggtacccgtccg 785 Score = 83.8 bits (42), Expect = 4e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 113 aggtctggacatccatttatttggtcataaaatacttaccaagattatttattt 166 |||||||| |||||||||||||||||||||| ||||| |||||||||||||||| Sbjct: 1085 aggtctggtcatccatttatttggtcataaagtacttcccaagattatttattt 1032
>gb|AF000966.1|AF000966 Poa pratensis chitinase (Chi2) gene, complete cds Length = 1080 Score = 131 bits (66), Expect = 2e-27 Identities = 129/150 (86%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||| ||||| || ||||||| || ||||| || ||| ||||||||||||||||||| Sbjct: 964 agcagtccaggttgtttccgtagctgacgccgaggaggtcgcagtagcgcttgtagaacc 905 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||||||||| || || || || |||||| |||||||| |||| |||||||||||||| Sbjct: 904 cgatccggtctgcgacgcggttgtcctgccctttgccgcactcgagcccgccattgatga 845 Query: 388 cgttggtgatcacgccgtatccgggtaccc 417 |||||||||||||||||| ||||| |||| Sbjct: 844 tgttggtgatcacgccgtacccgggcaccc 815
>gb|AF000965.1|AF000965 Poa pratensis chitinase (Chi3) pseudogene sequence Length = 1173 Score = 123 bits (62), Expect = 5e-25 Identities = 128/150 (85%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||| ||||| | |||||||| || ||||| || ||| ||||||||||||||||||| Sbjct: 1127 agcagtccaggttgtccccgtagctgacgccgaggaggtcgcagtagcgcttgtagaacc 1068 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||||| |||||| || || || ||||||||||||||| |||| |||||| ||||||| Sbjct: 1067 cgatcctgtcggcgacgcggttgtcctgccccttgccgcactcgagcccgccgttgatga 1008 Query: 388 cgttggtgatcacgccgtatccgggtaccc 417 ||| |||||||||||||| ||||| |||| Sbjct: 1007 tgttagtgatcacgccgtacccgggcaccc 978
>emb|X54367.1|OSCHIT Oryza sativa (rice) gene for endochitinase Length = 1237 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 303 atgtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 351 ||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1038 atgtcgcagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 990
>emb|X15349.1|HVENDCHT Barley (H.vulgare) mRNA for endochitinase Length = 556 Score = 89.7 bits (45), Expect = 7e-15 Identities = 116/137 (84%), Gaps = 2/137 (1%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| || |||||||| | ||||| |||||| |||||||||||||| |||| Sbjct: 514 agcagtcgaggttgttgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaaacc 455 Query: 328 cgatccggtcggccaccttgtc-gttctgccccttgccgcattcgatcccgccattgatg 386 ||||||| ||||| | || | | || |||||| | ||||| ||||||||||| |||| | Sbjct: 454 cgatccgatcggcga-ctcgactgtcctgcccatgcccgcactcgatcccgccgttgacg 396 Query: 387 acgttggtgatcacgcc 403 | ||||||||||||||| Sbjct: 395 atgttggtgatcacgcc 379
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 303 atgtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 351 ||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 30372289 atgtcgcagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 30372241 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 30375916 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 30375861
>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017G10 Length = 166700 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 303 atgtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 351 ||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9650 atgtcgcagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 9602 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 13277 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 13222
>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0548E04 Length = 138037 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 303 atgtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 351 ||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 118884 atgtcgcagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 118836 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 122511 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 122456
>dbj|AK061280.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-F06, full insert sequence Length = 1169 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 303 atgtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 351 ||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 976 atgtcgcagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 928
>dbj|D16223.1|RICCHT3 Oryza sativa (japonica cultivar-group) Cht-3 gene for endochitinase, complete cds Length = 2808 Score = 89.7 bits (45), Expect = 7e-15 Identities = 48/49 (97%) Strand = Plus / Minus Query: 303 atgtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 351 ||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2731 atgtcgcagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 2683
>gb|L34210.1|BLYCHI26A Hordeum vulgare chitinase (CHI26) gene, complete cds Length = 3169 Score = 89.7 bits (45), Expect = 7e-15 Identities = 111/133 (83%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 |||| |||||||| || |||||||| | ||||| ||||||||||||||||||||| |||| Sbjct: 2475 agcaatcgaggttgttgccgtagccaacgccgaggatgtcacagtagcgcttgtaaaacc 2416 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||| || ||||| || | || |||||| | ||||| ||||||||||| ||||||| Sbjct: 2415 cgattcgatcggcgacgcggctgtcctgcccgtgaccgcactcgatcccgccgttgatga 2356 Query: 388 cgttggtgatcac 400 |||||||||||| Sbjct: 2355 tgttggtgatcac 2343
>gb|M62904.1|BLYCHI H.vulgare L. 26kD chitinase mRNA, complete cds Length = 998 Score = 89.7 bits (45), Expect = 7e-15 Identities = 111/133 (83%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 |||| |||||||| || |||||||| | ||||| ||||||||||||||||||||| |||| Sbjct: 838 agcaatcgaggttgttgccgtagccaacgccgaggatgtcacagtagcgcttgtaaaacc 779 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||| || ||||| || | || |||||| | ||||| ||||||||||| ||||||| Sbjct: 778 cgattcgatcggcgacgcggctgtcctgcccgtgaccgcactcgatcccgccgttgatga 719 Query: 388 cgttggtgatcac 400 |||||||||||| Sbjct: 718 tgttggtgatcac 706
>gb|U02287.1|HVU02287 Hordeum vulgare cultivar NK1558 chitinase gene, complete cds Length = 1684 Score = 89.7 bits (45), Expect = 7e-15 Identities = 116/137 (84%), Gaps = 2/137 (1%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| || |||||||| | ||||| |||||| |||||||||||||| |||| Sbjct: 1533 agcagtcgaggttgttgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaaacc 1474 Query: 328 cgatccggtcggccaccttgtc-gttctgccccttgccgcattcgatcccgccattgatg 386 ||||||| ||||| | || | | || |||||| | ||||| ||||||||||| |||| | Sbjct: 1473 cgatccgatcggcga-ctcgactgtcctgcccatgcccgcactcgatcccgccgttgacg 1415 Query: 387 acgttggtgatcacgcc 403 | ||||||||||||||| Sbjct: 1414 atgttggtgatcacgcc 1398
>emb|Z29962.1|OSCHITIB O.sativa (PCH6) mRNA for chitinase class I Length = 1100 Score = 85.7 bits (43), Expect = 1e-13 Identities = 43/43 (100%) Strand = Plus / Minus Query: 309 cagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 351 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 902 cagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 860
>gb|AF000964.1|AF000964 Poa pratensis chitinase (Chi1) gene, complete cds Length = 1252 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 353 ctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccggg 412 |||||| |||||||| |||| |||||||||||||| |||||||||||||||||| ||||| Sbjct: 879 ctgccctttgccgcactcgagcccgccattgatgatgttggtgatcacgccgtacccggg 820 Query: 413 taccc 417 |||| Sbjct: 819 caccc 815 Score = 67.9 bits (34), Expect = 3e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||| ||||| | ||||||| || ||||| || ||| ||||||||||||||||||| Sbjct: 970 agcagtccaggttgtctccgtagctgacgccgaggaggtcgcagtagcgcttgtagaacc 911 Query: 328 cgatccggtc 337 |||||||||| Sbjct: 910 cgatccggtc 901
>gb|AC132492.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0605G01, complete sequence Length = 146303 Score = 77.8 bits (39), Expect = 3e-11 Identities = 114/139 (82%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| |||||||||||||||||| | ||| |||||||||| |||||| | Sbjct: 96281 agcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctggtagaagc 96222 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 ||||||||| |||||| ||||| | || ||||| || | |||||| ||||||| Sbjct: 96221 cgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccgttgatga 96162 Query: 388 cgttggtgatcacgccgta 406 |||||||||||||||||| Sbjct: 96161 tgttggtgatcacgccgta 96143 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 284 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 107042 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 106986 Score = 46.1 bits (23), Expect = 0.092 Identities = 41/47 (87%) Strand = Plus / Minus Query: 290 gccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggt 336 |||||||||||| | |||||||||||| |||||| |||||||||| Sbjct: 87347 gccgatgccgaacgcgccacagtagcgctggtagaagccgatccggt 87301 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 374 cccgccattgatgacgttggtgatcacgccgta 406 |||||| |||| || |||||||||||||||||| Sbjct: 87263 cccgccgttgacgatgttggtgatcacgccgta 87231
>gb|AY444342.1| Oryza sativa chitinase gene, complete cds Length = 1101 Score = 77.8 bits (39), Expect = 3e-11 Identities = 114/139 (82%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| |||||||||||||||||| | ||| |||||||||| |||||| | Sbjct: 1057 agcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctggtagaagc 998 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 ||||||||| |||||| ||||| | || ||||| || | |||||| ||||||| Sbjct: 997 cgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccgttgatga 938 Query: 388 cgttggtgatcacgccgta 406 |||||||||||||||||| Sbjct: 937 tgttggtgatcacgccgta 919
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 77.8 bits (39), Expect = 3e-11 Identities = 114/139 (82%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| |||||||||||||||||| | ||| |||||||||| |||||| | Sbjct: 19292206 agcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctggtagaagc 19292147 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 ||||||||| |||||| ||||| | || ||||| || | |||||| ||||||| Sbjct: 19292146 cgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccgttgatga 19292087 Query: 388 cgttggtgatcacgccgta 406 |||||||||||||||||| Sbjct: 19292086 tgttggtgatcacgccgta 19292068 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 284 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 19302967 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 19302911 Score = 46.1 bits (23), Expect = 0.092 Identities = 41/47 (87%) Strand = Plus / Minus Query: 290 gccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggt 336 |||||||||||| | |||||||||||| |||||| |||||||||| Sbjct: 19283272 gccgatgccgaacgcgccacagtagcgctggtagaagccgatccggt 19283226 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 374 cccgccattgatgacgttggtgatcacgccgta 406 |||||| |||| || |||||||||||||||||| Sbjct: 19283188 cccgccgttgacgatgttggtgatcacgccgta 19283156
>gb|L37289.1|RICCHITA Oryza sativa chitinase mRNA, complete cds Length = 1291 Score = 77.8 bits (39), Expect = 3e-11 Identities = 114/139 (82%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| |||||||||||||||||| | ||| |||||||||| |||||| | Sbjct: 1000 agcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctggtagaagc 941 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 ||||||||| |||||| ||||| | || ||||| || | |||||| ||||||| Sbjct: 940 cgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccgttgatga 881 Query: 388 cgttggtgatcacgccgta 406 |||||||||||||||||| Sbjct: 880 tgttggtgatcacgccgta 862
>gb|AY997529.2| Musa x paradisiaca chitinase (Chi-1) mRNA, complete cds Length = 1082 Score = 75.8 bits (38), Expect = 1e-10 Identities = 101/122 (82%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacc 344 ||||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 981 ccgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacg 922 Query: 345 ttgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccg 404 |||| || || | |||||| || | |||||| ||||||| ||||||||| |||||| Sbjct: 921 cgatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccg 862 Query: 405 ta 406 || Sbjct: 861 ta 860
>dbj|AB051579.1| Secale cereale rscc mRNA for seed chitinase-c, complete cds Length = 1018 Score = 75.8 bits (38), Expect = 1e-10 Identities = 107/130 (82%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| | |||||||| | ||||| |||||| |||||||||||||| |||| Sbjct: 832 agcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaaacc 773 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 ||||||| ||||| || | || |||||| | ||||| |||| ||| |||||||||| Sbjct: 772 cgatccgatcggcaacgcggctgtcctgcccgtgcccgcactcgagcccaccattgatga 713 Query: 388 cgttggtgat 397 ||||||||| Sbjct: 712 tgttggtgat 703
>gb|L34211.1|BLYCHI33A Hordeum vulgare chitinase (CHI33) gene, complete cds Length = 1779 Score = 75.8 bits (38), Expect = 1e-10 Identities = 122/150 (81%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| ||||||||||| ||| | ||||| |||||||||| |||||| | Sbjct: 1627 agcagtcgaggttgcccccgtagccgacgccaaggatgttgcagtagcgctggtagaagc 1568 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 ||||||||||||| || | || | |||| | ||||| |||| |||||| ||||||| Sbjct: 1567 cgatccggtcggcaacacggctgtccgcccccctaccgcactcgagcccgccgttgatga 1508 Query: 388 cgttggtgatcacgccgtatccgggtaccc 417 ||||||||| |||||||| ||||| |||| Sbjct: 1507 tgttggtgatgacgccgtagccgggcaccc 1478
>ref|XM_468715.1| Oryza sativa (japonica cultivar-group), mRNA Length = 981 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 286 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 345 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 937 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 878 Query: 346 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 405 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 877 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 818 Query: 406 a 406 | Sbjct: 817 a 817
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 286 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 345 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 17204043 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 17203984 Query: 346 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 405 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 17203983 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 17203924 Query: 406 a 406 | Sbjct: 17203923 a 17203923
>gb|AC145386.1| Oryza sativa chromosome 3 BAC OSJNBb0028K20 genomic sequence, complete sequence Length = 115326 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 286 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 345 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 36787 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 36728 Query: 346 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 405 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 36727 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 36668 Query: 406 a 406 | Sbjct: 36667 a 36667
>emb|Z78202.1|PACHI1 Persea americana mRNA for endochitinase Length = 1120 Score = 73.8 bits (37), Expect = 4e-10 Identities = 79/93 (84%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgttctgccccttgcc 364 ||||||||| | ||||||||| || || ||||| ||||||||||| || |||||||| Sbjct: 922 gtcacagtacctcttgtagaagccaatgcggtctgccaccttgtcattgaatcccttgcc 863 Query: 365 gcattcgatcccgccattgatgacgttggtgat 397 |||||||||||| || ||||||| ||||||||| Sbjct: 862 gcattcgatcccaccgttgatgatgttggtgat 830
>gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genomic sequence, complete sequence Length = 153247 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 286 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 345 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 95436 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 95377 Query: 346 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 405 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 95376 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 95317 Query: 406 a 406 | Sbjct: 95316 a 95316
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 286 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 345 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 17197612 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 17197553 Query: 346 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 405 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 17197552 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 17197493 Query: 406 a 406 | Sbjct: 17197492 a 17197492
>gb|AF013580.1|AF013580 Oryza sativa clone RGCH8 chitinase gene, complete cds Length = 2730 Score = 73.8 bits (37), Expect = 4e-10 Identities = 118/145 (81%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| |||||||||| |||||| ||||| ||||||||||||||| | | Sbjct: 2289 agcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttgtagtagc 2230 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||| |||||| | ||||||||| || |||||| ||||| ||||| ||||||| Sbjct: 2229 cgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccgttgatga 2170 Query: 388 cgttggtgatcacgccgtatccggg 412 ||||||||| |||||||| ||||| Sbjct: 2169 tgttggtgatgacgccgtacccggg 2145
>gb|AF001500.1|OSAF001500 Oryza sativa clone MIRCH1 chitinase mRNA, partial cds Length = 913 Score = 73.8 bits (37), Expect = 4e-10 Identities = 118/145 (81%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| |||||||||| |||||| ||||| ||||||||||||||| | | Sbjct: 749 agcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttgtagtagc 690 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||| |||||| | ||||||||| || |||||| ||||| ||||| ||||||| Sbjct: 689 cgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccgttgatga 630 Query: 388 cgttggtgatcacgccgtatccggg 412 ||||||||| |||||||| ||||| Sbjct: 629 tgttggtgatgacgccgtacccggg 605
>gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete sequence Length = 104879 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Plus Query: 363 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccg 418 |||||||||| |||||| ||||| | |||||||||||||||||||||||| ||||| Sbjct: 29219 ccgcattcgagcccgccgttgattatgttggtgatcacgccgtatccggggacccg 29274 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Plus Query: 363 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccg 422 |||||||||| ||| || ||||| | |||||||||||||||||||||||| ||||||||| Sbjct: 25093 ccgcattcgagcccaccgttgattatgttggtgatcacgccgtatccggggacccgtccg 25152 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 374 cccgccattgatgacgttggtgatcacgccgtatccgggtaccc 417 |||||| ||||| | ||||||||||||||| ||||||||||||| Sbjct: 14909 cccgccgttgattatgttggtgatcacgccatatccgggtaccc 14952
>gb|AF280437.1|AF280437 Secale cereale 31.7 kDa class I endochitinase-antifreeze protein precursor, mRNA, complete cds Length = 1192 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||||| || ||||||||||||||||||||||||||| |||||||| Sbjct: 965 ccgtagctgacgccgaggaggtcacagtagcgcttgtagaacccgattcggtcggc 910 Score = 48.1 bits (24), Expect = 0.023 Identities = 39/44 (88%) Strand = Plus / Minus Query: 363 ccgcattcgatcccgccattgatgacgttggtgatcacgccgta 406 ||||| |||| ||| || ||||||| |||||||||||||||||| Sbjct: 887 ccgcactcgagcccaccgttgatgatgttggtgatcacgccgta 844
>gb|AF167323.1|AF167323 Medicago truncatula clone T130002g putative chitinase gene, partial cds Length = 260 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 363 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccg 422 |||||||||| ||| || ||||| | |||||||||||||||||||||||| ||||||||| Sbjct: 177 ccgcattcgagcccaccgttgattatgttggtgatcacgccgtatccggggacccgtccg 118
>gb|AY106654.1| Zea mays PCO078819 mRNA sequence Length = 574 Score = 71.9 bits (36), Expect = 2e-09 Identities = 102/124 (82%) Strand = Plus / Plus Query: 283 tcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggcca 342 ||||||||||||||| ||||| || ||||||||||||||||| || |||||||||| | Sbjct: 229 tcccgtagccgatgcggaagacatcgcagtagcgcttgtagaagccaatccggtcggtga 288 Query: 343 ccttgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgc 402 || | || | ||| | ||||| |||||||| || ||||||| |||||||||||||| Sbjct: 289 cccgggggtccgtcccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgc 348 Query: 403 cgta 406 |||| Sbjct: 349 cgta 352
>gb|L40337.1|RICRCH1 Oryza sativa chitinase (Rcht1) mRNA, complete cds Length = 1204 Score = 69.9 bits (35), Expect = 6e-09 Identities = 113/139 (81%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| |||||||||||||||||| | || |||||||||| |||||| | Sbjct: 964 agcagtcgaggttgctcccgtagccgatgccgagcacgttgcagtagcgctggtagaagc 905 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 ||||||||| |||||| ||||| | || ||||| || | |||||| ||||||| Sbjct: 904 cgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccgttgatga 845 Query: 388 cgttggtgatcacgccgta 406 |||||||||||||||||| Sbjct: 844 tgttggtgatcacgccgta 826
>gb|AY973230.1| Triticum aestivum cultivar Sumai 3 class II chitinase gene, complete cds Length = 811 Score = 69.9 bits (35), Expect = 6e-09 Identities = 59/67 (88%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| | |||||||| | ||||| |||||| |||||||||||||| |||| Sbjct: 778 agcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaaacc 719 Query: 328 cgatccg 334 ||||||| Sbjct: 718 cgatccg 712
>gb|AY973229.1| Triticum aestivum cultivar Gamenya class II chitinase gene, complete cds Length = 891 Score = 69.9 bits (35), Expect = 6e-09 Identities = 59/67 (88%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| | |||||||| | ||||| |||||| |||||||||||||| |||| Sbjct: 778 agcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaaacc 719 Query: 328 cgatccg 334 ||||||| Sbjct: 718 cgatccg 712
>gb|AY437443.1| Triticum aestivum cultivar Ning 7840 class I chitinase mRNA, complete cds Length = 1121 Score = 69.9 bits (35), Expect = 6e-09 Identities = 113/139 (81%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||| ||||| | ||||||| || ||||| | ||| ||||||||||||||||||| Sbjct: 1002 agcagtccaggttgtcgccgtagctgacgccgagtaggtcgcagtagcgcttgtagaacc 943 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 ||||||||||||| || | ||| |||||| ||||| |||| ||| || ||||||| Sbjct: 942 cgatccggtcggcaacacgggcgtcctgcccgcgcccgcactcgagcccaccgttgatga 883 Query: 388 cgttggtgatcacgccgta 406 |||||||||||| ||||| Sbjct: 882 tgttggtgatcacaccgta 864
>dbj|AB029936.1| Triticum aestivum Chi 3 mRNA for chitinase 3, complete cds Length = 1148 Score = 69.9 bits (35), Expect = 6e-09 Identities = 113/139 (81%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||| ||||| | ||||||| || ||| | || ||| ||||||||||||||||||| Sbjct: 988 agcagtccaggttgtcaccgtagctgacgccaaggaggtcgcagtagcgcttgtagaacc 929 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 ||||||||||||| || | ||| |||||| ||||| |||| ||| || ||||||| Sbjct: 928 cgatccggtcggcgacacggccgtcctgcccgcgcccgcactcgagcccaccgttgatga 869 Query: 388 cgttggtgatcacgccgta 406 |||||||||||| ||||| Sbjct: 868 tgttggtgatcacaccgta 850
>dbj|AB051578.1| Secale cereale rsca mRNA for seed chitinase-a, complete cds Length = 1191 Score = 67.9 bits (34), Expect = 3e-08 Identities = 85/102 (83%) Strand = Plus / Minus Query: 302 gatgtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgttctgcccctt 361 |||||| |||||||||||||| |||||||| || ||||| || | || |||||| | Sbjct: 966 gatgtcgcagtagcgcttgtaaaacccgattcgatcggcgactcggctgtcctgcccatg 907 Query: 362 gccgcattcgatcccgccattgatgacgttggtgatcacgcc 403 ||||| |||||||||||||||| || ||||||||||||||| Sbjct: 906 cccgcactcgatcccgccattgacgatgttggtgatcacgcc 865
>emb|X63899.1|PSCHITIN P.sativum mRNA for chitinase Length = 1143 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 362 gccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccg 418 ||||||||| |||||||||||||| | |||||||||||| || |||||||| ||||| Sbjct: 879 gccgcattcaatcccgccattgattatgttggtgatcacaccatatccggggacccg 823
>gb|AY378172.1| Oryza sativa (japonica cultivar-group) OsmChiI-34 mRNA, partial cds Length = 894 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 866 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 811
>emb|Z29961.1|OSCHITIA O.sativa (PCH16) mRNA for chitinase class I Length = 1159 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 1049 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 994
>emb|X87109.1|OSDNARC24 O.sativa RC24 gene Length = 2048 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 1982 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 1927
>emb|X78672.1|HVCHT2B H.vulgare mRNA for chitinase 2b Length = 1013 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 347 gtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgta 406 ||||||||| ||| ||||||| |||| |||||| ||||||| |||||||| |||||||| Sbjct: 709 gtcgttctggcccatgccgcactcgagcccgccgttgatgatattggtgattacgccgta 650 Query: 407 tccgggtacccg 418 ||| || ||||| Sbjct: 649 tccaggcacccg 638
>emb|X76041.1|TACHIG T.aestivum (Chinese spring) chi gene for endochitinase Length = 1985 Score = 63.9 bits (32), Expect = 4e-07 Identities = 32/32 (100%) Strand = Plus / Minus Query: 309 cagtagcgcttgtagaacccgatccggtcggc 340 |||||||||||||||||||||||||||||||| Sbjct: 1531 cagtagcgcttgtagaacccgatccggtcggc 1500
>emb|X56063.1|OSENDO O.sativa mRNA for endochitinase Length = 1160 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 881 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 826
>emb|AJ276226.1|HVU276226 Hordeum vulgare mRNA for chitinase II (pathogenesis-related protein 3) (cht2 gene) Length = 890 Score = 63.9 bits (32), Expect = 4e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 347 gtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgta 406 ||||||||| ||| ||||||| |||| |||||| ||||||| |||||||| |||||||| Sbjct: 715 gtcgttctggcccatgccgcactcgagcccgccgttgatgatattggtgattacgccgta 656 Query: 407 tccgggtacccg 418 ||| || ||||| Sbjct: 655 tccaggcacccg 644
>dbj|AK105798.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A08, full insert sequence Length = 1141 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 986 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 931
>dbj|AK104020.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-C04, full insert sequence Length = 1136 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 981 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 926
>dbj|AK099339.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028I21, full insert sequence Length = 1174 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 962 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 907
>dbj|AK061042.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-D05, full insert sequence Length = 1217 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 984 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 929
>dbj|D16221.1|RICCHT1 Oryza sativa (japonica cultivar-group) Cht-1 gene for endochitinase, complete cds Length = 2739 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 285 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||| || ||| || ||||| |||||||||||||||||||| ||||||||||| Sbjct: 2246 ccgtagctgacgcccaacatgtcgcagtagcgcttgtagaacccaatccggtcggc 2191
>gb|L40336.1|RICCHITB Oryza sativa chitinase (Rcht2) gene, complete cds Length = 5595 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| |||||||||| |||||| ||||| ||||||||||||||| | | Sbjct: 4839 agcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttgtagtagc 4780 Query: 328 cgatccggtcg 338 |||| |||||| Sbjct: 4779 cgatgcggtcg 4769
>gb|L40338.1|RICRCH0 Oryza sativa (clone RCH08) chitinase (Rcht2) mRNA, 3' end of cds Length = 652 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| |||||||||| |||||| ||||| ||||||||||||||| | | Sbjct: 502 agcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttgtagtagc 443 Query: 328 cgatccggtcg 338 |||| |||||| Sbjct: 442 cgatgcggtcg 432
>dbj|AB029934.1| Triticum aestivum Chi 1 mRNA for chitinase 1, complete cds Length = 979 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 363 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtaccc 417 ||||| |||| |||||| ||||||| ||||||||||| |||||||||||||||| Sbjct: 726 ccgcactcgagcccgccgttgatgatattggtgatcactccgtatccgggtaccc 672
>gb|AC135418.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0035J16, complete sequence Length = 170233 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 284 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 6316 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 6260
>dbj|AK071196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086B11, full insert sequence Length = 1305 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 284 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1029 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 973
>dbj|AB096139.1| Oryza sativa (japonica cultivar-group) Chia1d mRNA for chitinase, complete cds Length = 1285 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 284 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1016 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 960
>dbj|AB012855.1| Oryza sativa mRNA for chitinase, complete cds Length = 1300 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 284 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1031 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 975
>dbj|AB018248.1| Oryza sativa (indica cultivar-group) mRNA for chitinase, complete cds Length = 1280 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 284 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1005 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 949
>gb|AY453406.1| Bambusa oldhamii chitinase mRNA, complete cds Length = 1232 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 363 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccg 418 ||||| |||| |||||||||||||| ||| ||||| |||||||| ||||| ||||| Sbjct: 881 ccgcactcgagcccgccattgatgatgttcgtgatgacgccgtacccgggaacccg 826
>ref|NM_197596.1| Oryza sativa (japonica cultivar-group) chitinase (OSJNBb0015I11.14), mRNA Length = 924 Score = 50.1 bits (25), Expect = 0.006 Identities = 115/145 (79%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| | |||||||| ||||| ||||| ||||||||||||||| | | Sbjct: 760 agcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttgtagtagc 701 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||| |||||| | ||||||||| || |||||| ||||| ||||| ||||||| Sbjct: 700 cgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccgttgatga 641 Query: 388 cgttggtgatcacgccgtatccggg 412 ||||||||| ||||| || ||||| Sbjct: 640 tgttggtgatgacgccatacccggg 616
>gb|AY253986.1| Galega orientalis class Ib chitinase mRNA, complete cds Length = 1149 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 389 gttggtgatcacgccgtatccgggtacccgtcc 421 |||||||||||||||||| ||||| |||||||| Sbjct: 855 gttggtgatcacgccgtagccgggaacccgtcc 823
>gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 genomic sequence, complete sequence Length = 138824 Score = 50.1 bits (25), Expect = 0.006 Identities = 115/145 (79%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| | |||||||| ||||| ||||| ||||||||||||||| | | Sbjct: 89601 agcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttgtagtagc 89542 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||| |||||| | ||||||||| || |||||| ||||| ||||| ||||||| Sbjct: 89541 cgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccgttgatga 89482 Query: 388 cgttggtgatcacgccgtatccggg 412 ||||||||| ||||| || ||||| Sbjct: 89481 tgttggtgatgacgccatacccggg 89457 Score = 40.1 bits (20), Expect = 5.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 303 atgtcacagtagcgcttgtagaacccgatccggtcg 338 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 104292 atgtcgcagtagcgcttgtagtagccgatgcggtcg 104257
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 50.1 bits (25), Expect = 0.006 Identities = 115/145 (79%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| | |||||||| ||||| ||||| ||||||||||||||| | | Sbjct: 20688149 agcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttgtagtagc 20688090 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||| |||||| | ||||||||| || |||||| ||||| ||||| ||||||| Sbjct: 20688089 cgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccgttgatga 20688030 Query: 388 cgttggtgatcacgccgtatccggg 412 ||||||||| ||||| || ||||| Sbjct: 20688029 tgttggtgatgacgccatacccggg 20688005 Score = 40.1 bits (20), Expect = 5.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 303 atgtcacagtagcgcttgtagaacccgatccggtcg 338 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 20702840 atgtcgcagtagcgcttgtagtagccgatgcggtcg 20702805
>dbj|AK070067.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042L15, full insert sequence Length = 1073 Score = 50.1 bits (25), Expect = 0.006 Identities = 115/145 (79%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| | |||||||| ||||| ||||| ||||||||||||||| | | Sbjct: 786 agcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttgtagtagc 727 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||| |||||| | ||||||||| || |||||| ||||| ||||| ||||||| Sbjct: 726 cgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccgttgatga 667 Query: 388 cgttggtgatcacgccgtatccggg 412 ||||||||| ||||| || ||||| Sbjct: 666 tgttggtgatgacgccatacccggg 642
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 50.1 bits (25), Expect = 0.006 Identities = 115/145 (79%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| | |||||||| ||||| ||||| ||||||||||||||| | | Sbjct: 20699421 agcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttgtagtagc 20699362 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||| |||||| | ||||||||| || |||||| ||||| ||||| ||||||| Sbjct: 20699361 cgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccgttgatga 20699302 Query: 388 cgttggtgatcacgccgtatccggg 412 ||||||||| ||||| || ||||| Sbjct: 20699301 tgttggtgatgacgccatacccggg 20699277 Score = 40.1 bits (20), Expect = 5.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 303 atgtcacagtagcgcttgtagaacccgatccggtcg 338 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 20714112 atgtcgcagtagcgcttgtagtagccgatgcggtcg 20714077
>dbj|AB016497.1| Oryza sativa mRNA for chitinase, complete cds Length = 923 Score = 50.1 bits (25), Expect = 0.006 Identities = 115/145 (79%) Strand = Plus / Minus Query: 268 agcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacc 327 ||||||||||||| | |||||||| ||||| ||||| ||||||||||||||| | | Sbjct: 766 agcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttgtagtagc 707 Query: 328 cgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattgatga 387 |||| |||||| | ||||||||| || |||||| ||||| ||||| ||||||| Sbjct: 706 cgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccgttgatga 647 Query: 388 cgttggtgatcacgccgtatccggg 412 ||||||||| ||||| || ||||| Sbjct: 646 tgttggtgatgacgccatacccggg 622
>gb|AY532766.1| Zea diploperennis isolate d8 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532765.1| Zea diploperennis isolate d7 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532764.1| Zea diploperennis isolate d6 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532763.1| Zea diploperennis isolate d5 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532762.1| Zea diploperennis isolate d5b chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532761.1| Zea diploperennis isolate d4 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532760.1| Zea diploperennis isolate d3 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532759.1| Zea diploperennis isolate d2 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532758.1| Zea diploperennis isolate d1 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532757.1| Zea mays subsp. parviglumis isolate p15 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532756.1| Zea mays subsp. parviglumis isolate p14b chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532755.1| Zea mays subsp. parviglumis isolate p14 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532754.1| Zea mays subsp. parviglumis isolate p13b chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532753.1| Zea mays subsp. parviglumis isolate p13 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532752.1| Zea mays subsp. parviglumis isolate p12 chitinase (chiI) gene, complete cds Length = 1082 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532751.1| Zea mays subsp. parviglumis isolate p11 chitinase (chiI) gene, complete cds Length = 1081 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|AY532750.1| Zea mays subsp. parviglumis isolate p9 chitinase (chiI) gene, complete cds Length = 1084 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 909 gtcacagtatcgtttgtagaagccgatccggtcggc 874
>gb|AY532749.1| Zea mays subsp. parviglumis isolate p8 chitinase (chiI) gene, complete cds Length = 1081 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|AY532748.1| Zea mays subsp. parviglumis isolate p6 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532747.1| Zea mays subsp. parviglumis isolate p5 chitinase (chiI) gene, complete cds Length = 1089 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|AY532746.1| Zea mays subsp. parviglumis isolate p4 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532745.1| Zea mays subsp. parviglumis isolate p3 chitinase (chiI) gene, complete cds Length = 1078 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532744.1| Zea mays subsp. parviglumis isolate p2 chitinase (chiI) gene, complete cds Length = 1087 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532743.1| Zea mays subsp. parviglumis isolate p1 chitinase (chiI) gene, complete cds Length = 1081 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|DQ078282.1| Ulmus pumila chitinase (CHT) mRNA, complete cds Length = 954 Score = 48.1 bits (24), Expect = 0.023 Identities = 39/44 (88%) Strand = Plus / Minus Query: 363 ccgcattcgatcccgccattgatgacgttggtgatcacgccgta 406 |||||||| ||||| || ||||||| ||||||||||| |||||| Sbjct: 812 ccgcattctatcccaccgttgatgatgttggtgatcatgccgta 769
>gb|L00973.1|MZECHITC Zea mays acidic class I chitinase mRNA, complete cds Length = 1128 Score = 48.1 bits (24), Expect = 0.023 Identities = 33/36 (91%) Strand = Plus / Minus Query: 305 gtcacagtagcgcttgtagaacccgatccggtcggc 340 ||||||||| || |||||||| |||||||||||||| Sbjct: 921 gtcacagtatcgtttgtagaagccgatccggtcggc 886
>gb|AY643483.1| Drosera spathulata CHIT1 (chit1) gene, partial cds Length = 911 Score = 46.1 bits (23), Expect = 0.092 Identities = 41/47 (87%) Strand = Plus / Minus Query: 375 ccgccattgatgacgttggtgatcacgccgtatccgggtacccgtcc 421 ||||| ||||||| |||||||||||| ||||| || ||||| ||||| Sbjct: 907 ccgccgttgatgatgttggtgatcaccccgtagcctggtactcgtcc 861
>gb|AC146189.3| Pan troglodytes BAC clone CH251-490L21 from Y, complete sequence Length = 180597 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 179 cacatccacacacgcacatgcat 201 ||||||||||||||||||||||| Sbjct: 119650 cacatccacacacgcacatgcat 119628
>gb|AC140850.20| Medicago truncatula clone mth2-11i23, complete sequence Length = 138846 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Minus Query: 174 atcatcacatccacacacgcacatgca 200 |||||||||||| |||||||||||||| Sbjct: 130057 atcatcacatccccacacgcacatgca 130031
>gb|AC167968.5| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940121D9, complete sequence Length = 108830 Score = 46.1 bits (23), Expect = 0.092 Identities = 29/31 (93%) Strand = Plus / Plus Query: 362 gccgcattcgatcccgccattgatgacgttg 392 |||||| ||||| |||||||||||||||||| Sbjct: 73169 gccgcactcgatgccgccattgatgacgttg 73199
>emb|X56787.1|OSLMRNAC O.sativa L. mRNA for endochitinase Length = 1186 Score = 46.1 bits (23), Expect = 0.092 Identities = 41/47 (87%) Strand = Plus / Minus Query: 290 gccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggt 336 |||||||||||| | |||||||||||| |||||| |||||||||| Sbjct: 957 gccgatgccgaacgcgccacagtagcgctggtagaagccgatccggt 911 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 374 cccgccattgatgacgttggtgatcacgccgta 406 |||||| |||| || |||||||||||||||||| Sbjct: 873 cccgccgttgacgatgttggtgatcacgccgta 841
>dbj|BS000612.1| Pan troglodytes chromosome Y clone:PTBY-009O17, complete sequences Length = 80000 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 179 cacatccacacacgcacatgcat 201 ||||||||||||||||||||||| Sbjct: 64086 cacatccacacacgcacatgcat 64108
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 179 cacatccacacacgcacatgcat 201 ||||||||||||||||||||||| Sbjct: 23891747 cacatccacacacgcacatgcat 23891725
>dbj|AK108949.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-C03, full insert sequence Length = 979 Score = 46.1 bits (23), Expect = 0.092 Identities = 41/47 (87%) Strand = Plus / Minus Query: 290 gccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggt 336 |||||||||||| | |||||||||||| |||||| |||||||||| Sbjct: 622 gccgatgccgaacgcgccacagtagcgctggtagaagccgatccggt 576 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 374 cccgccattgatgacgttggtgatcacgccgta 406 |||||| |||| || |||||||||||||||||| Sbjct: 538 cccgccgttgacgatgttggtgatcacgccgta 506
>dbj|D16222.1|RICCHT2 Oryza sativa (japonica cultivar-group) Cht-2 gene for endochitinase, complete cds Length = 2986 Score = 46.1 bits (23), Expect = 0.092 Identities = 41/47 (87%) Strand = Plus / Minus Query: 290 gccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggt 336 |||||||||||| | |||||||||||| |||||| |||||||||| Sbjct: 2392 gccgatgccgaacgcgccacagtagcgctggtagaagccgatccggt 2346 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 374 cccgccattgatgacgttggtgatcacgccgta 406 |||||| |||| || |||||||||||||||||| Sbjct: 2308 cccgccgttgacgatgttggtgatcacgccgta 2276
>gb|AC154093.1| Homo sapiens chromosome 13 clone fa0790, complete sequence Length = 37001 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 179 cacatccacacacgcacatgca 200 |||||||||||||||||||||| Sbjct: 36335 cacatccacacacgcacatgca 36356
>gb|AC124684.3| Mus musculus BAC clone RP24-375D13 from chromosome 1, complete sequence Length = 167927 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 180 acatccacacacgcacatgcat 201 |||||||||||||||||||||| Sbjct: 115354 acatccacacacgcacatgcat 115375
>emb|CR733892.2|CNS0GT1V Tetraodon nigroviridis full-length cDNA Length = 1579 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 371 gatcccgccattgatgacgttg 392 |||||||||||||||||||||| Sbjct: 553 gatcccgccattgatgacgttg 532
>emb|AL359649.8| Human DNA sequence from clone RP11-65D24 on chromosome 13 Contains 2 novel genes, complete sequence Length = 144792 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 179 cacatccacacacgcacatgca 200 |||||||||||||||||||||| Sbjct: 109684 cacatccacacacgcacatgca 109663
>gb|AC153149.4| Mus musculus BAC clone RP23-176O2 from chromosome 3, complete sequence Length = 206540 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 179 cacatccacacacgcacatgca 200 |||||||||||||||||||||| Sbjct: 146384 cacatccacacacgcacatgca 146405
>gb|AC084760.2| Gallus gallus clone WAG-65N20, complete sequence Length = 109569 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 130 tatttggtcataaaatacttac 151 |||||||||||||||||||||| Sbjct: 23660 tatttggtcataaaatacttac 23639
>gb|AC019306.10| Homo sapiens chromosome 18, clone RP11-326M20, complete sequence Length = 175840 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 179 cacatccacacacgcacatgcataaa 204 ||||| |||||||||||||||||||| Sbjct: 137699 cacatacacacacgcacatgcataaa 137724
>gb|AC153644.3| Mus musculus BAC clone RP24-531A1 from 1, complete sequence Length = 166988 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 180 acatccacacacgcacatgcat 201 |||||||||||||||||||||| Sbjct: 15411 acatccacacacgcacatgcat 15432
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome Length = 7215267 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Minus Query: 362 gccgcattcgatcccgccattgatga 387 |||||||||||| ||||||||||||| Sbjct: 1140779 gccgcattcgatgccgccattgatga 1140754
>emb|AL591393.10| Human DNA sequence from clone RP11-224J22 on chromosome 9 Contains a novel gene (FLJ33868) and 2 CpG islands, complete sequence Length = 174911 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 142 aaatacttaccaagattatttattt 166 |||||||||||||| |||||||||| Sbjct: 80594 aaatacttaccaagtttatttattt 80570
>emb|BX322565.11| Zebrafish DNA sequence from clone CH211-262K18 in linkage group 24, complete sequence Length = 158981 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 178 tcacatccacacacgcacatgcata 202 |||||| |||||||||||||||||| Sbjct: 125189 tcacatacacacacgcacatgcata 125165
>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24, complete sequence Length = 152545 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 tcacatccacacacgcacatgcata 202 |||||| |||||||||||||||||| Sbjct: 66156 tcacatacacacacgcacatgcata 66180
>gb|AF494397.1| Malus x domestica class II chitinase (CHT-3) mRNA, partial cds Length = 667 Score = 42.1 bits (21), Expect = 1.4 Identities = 36/41 (87%) Strand = Plus / Minus Query: 360 ttgccgcattcgatcccgccattgatgacgttggtgatcac 400 ||||||||||| | || |||||||||| |||||||||||| Sbjct: 431 ttgccgcattcaagacctccattgatgatgttggtgatcac 391
>emb|BX294095.13| Zebrafish DNA sequence from clone CH211-248L17 in linkage group 24, complete sequence Length = 147604 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 178 tcacatccacacacgcacatgcata 202 |||||| |||||||||||||||||| Sbjct: 105496 tcacatacacacacgcacatgcata 105472
>gb|U02286.1|OSU02286 Oryza sativa IR58 chitinase mRNA, complete cds Length = 1051 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 374 cccgccattgatgacgttggtgatcacgccgta 406 |||||| |||| || |||||||||||||||||| Sbjct: 862 cccgccgttgacgatgttggtgatcacgccgta 830
>ref|NM_197598.1| Oryza sativa (japonica cultivar-group) putative chitinase (OSJNBb0015I11.16), mRNA Length = 891 Score = 40.1 bits (20), Expect = 5.7 Identities = 32/36 (88%) Strand = Plus / Minus Query: 303 atgtcacagtagcgcttgtagaacccgatccggtcg 338 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 821 atgtcgcagtagcgcttgtagtagccgatgcggtcg 786
>gb|AC166486.5| Mus musculus chromosome 1, clone RP23-187M9, complete sequence Length = 187098 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 125 ccatttatttggtcataaaa 144 |||||||||||||||||||| Sbjct: 13104 ccatttatttggtcataaaa 13085
>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence Length = 203437 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 179 cacatccacacacgcacatgcata 202 ||||| |||||||||||||||||| Sbjct: 10245 cacatacacacacgcacatgcata 10268
>gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome 5, complete sequence Length = 181395 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 179 cacatccacacacgcacatgcata 202 ||||| |||||||||||||||||| Sbjct: 177006 cacatacacacacgcacatgcata 176983
>gb|AC069288.7| Homo sapiens BAC clone RP11-416J17 from 7, complete sequence Length = 145709 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 179 cacatccacacacgcacatg 198 |||||||||||||||||||| Sbjct: 136461 cacatccacacacgcacatg 136480
>gb|AC113021.10| Mus musculus chromosome 6, clone RP23-186F2, complete sequence Length = 198397 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 151 ccaagattatttatttgggg 170 |||||||||||||||||||| Sbjct: 82945 ccaagattatttatttgggg 82964
>emb|BX901895.15| Zebrafish DNA sequence from clone CH211-218C11 in linkage group 7, complete sequence Length = 208436 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 aatatgtttataataaaagg 43 |||||||||||||||||||| Sbjct: 125720 aatatgtttataataaaagg 125739
>emb|CR931785.6| Zebrafish DNA sequence from clone DKEY-230N5 in linkage group 7, complete sequence Length = 196531 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 aatatgtttataataaaagg 43 |||||||||||||||||||| Sbjct: 145929 aatatgtttataataaaagg 145948
>emb|CR735059.2|CNS0GTYA Tetraodon nigroviridis full-length cDNA Length = 1566 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>gb|AC121591.4| Mus musculus BAC clone RP23-289H3 from 1, complete sequence Length = 195393 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 125 ccatttatttggtcataaaa 144 |||||||||||||||||||| Sbjct: 12989 ccatttatttggtcataaaa 13008
>emb|CR933541.6| Mouse DNA sequence from clone DN-97M20 on chromosome 11, complete sequence Length = 176646 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 179 cacatccacacacgcacatgcata 202 ||||| |||||||||||||||||| Sbjct: 66957 cacatgcacacacgcacatgcata 66934
>emb|CR735005.2|CNS0GTWS Tetraodon nigroviridis full-length cDNA Length = 1561 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR734871.2|CNS0GTT2 Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 544 tcccgccattgatgacgttg 525
>emb|CR734832.2|CNS0GTRZ Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 550 tcccgccattgatgacgttg 531
>emb|CR734821.2|CNS0GTRO Tetraodon nigroviridis full-length cDNA Length = 1526 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR734784.2|CNS0GTQN Tetraodon nigroviridis full-length cDNA Length = 1557 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR734271.2|CNS0GTCE Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 542 tcccgccattgatgacgttg 523
>emb|CR734258.2|CNS0GTC1 Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR734222.2|CNS0GTB1 Tetraodon nigroviridis full-length cDNA Length = 1470 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 447 tcccgccattgatgacgttg 428
>emb|CR734221.2|CNS0GTB0 Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 543 tcccgccattgatgacgttg 524
>emb|CR734121.2|CNS0GT88 Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR660465.2|CNS0F8L3 Tetraodon nigroviridis full-length cDNA Length = 1549 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR734099.2|CNS0GT7M Tetraodon nigroviridis full-length cDNA Length = 1572 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 550 tcccgccattgatgacgttg 531
>emb|CR734078.2|CNS0GT71 Tetraodon nigroviridis full-length cDNA Length = 1472 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 450 tcccgccattgatgacgttg 431
>emb|CR734011.2|CNS0GT56 Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR733956.2|CNS0GT3N Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR733647.2|CNS0GSV2 Tetraodon nigroviridis full-length cDNA Length = 1578 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 556 tcccgccattgatgacgttg 537
>emb|CR733499.2|CNS0GSQY Tetraodon nigroviridis full-length cDNA Length = 1571 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR733422.2|CNS0GSOW Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733844.2|CNS0GT0J Tetraodon nigroviridis full-length cDNA Length = 1566 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR733835.2|CNS0GT0A Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733710.2|CNS0GSWT Tetraodon nigroviridis full-length cDNA Length = 1553 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR733648.2|CNS0GSV3 Tetraodon nigroviridis full-length cDNA Length = 1546 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 523 tcccgccattgatgacgttg 504
>emb|CR733358.2|CNS0GSNX Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733481.1|CNS0GSQG Tetraodon nigroviridis full-length cDNA Length = 1527 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 531 tcccgccattgatgacgttg 512
>emb|CR733235.2|CNS0GSM1 Tetraodon nigroviridis full-length cDNA Length = 1579 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR733200.2|CNS0GSLG Tetraodon nigroviridis full-length cDNA Length = 1522 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR732950.2|CNS0GSGO Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR732939.2|CNS0GSGE Tetraodon nigroviridis full-length cDNA Length = 1540 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR732821.2|CNS0GSDN Tetraodon nigroviridis full-length cDNA Length = 1563 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR733142.1|CNS0GSKK Tetraodon nigroviridis full-length cDNA Length = 1544 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 538 tcccgccattgatgacgttg 519
>emb|CR732987.1|CNS0GSHK Tetraodon nigroviridis full-length cDNA Length = 1547 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 549 tcccgccattgatgacgttg 530
>emb|CR732771.2|CNS0GSCH Tetraodon nigroviridis full-length cDNA Length = 1570 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR732486.2|CNS0GS4R Tetraodon nigroviridis full-length cDNA Length = 1569 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR732720.1|CNS0GSB8 Tetraodon nigroviridis full-length cDNA Length = 1547 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR732153.2|CNS0GRVI Tetraodon nigroviridis full-length cDNA Length = 1563 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR732143.2|CNS0GRV8 Tetraodon nigroviridis full-length cDNA Length = 1635 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 535 tcccgccattgatgacgttg 516
>emb|CR732095.2|CNS0GRTW Tetraodon nigroviridis full-length cDNA Length = 1572 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 549 tcccgccattgatgacgttg 530
>emb|CR731975.2|CNS0GRQK Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR731884.2|CNS0GRO1 Tetraodon nigroviridis full-length cDNA Length = 1376 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 452 tcccgccattgatgacgttg 433
>emb|CR731882.2|CNS0GRNZ Tetraodon nigroviridis full-length cDNA Length = 1560 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR731865.2|CNS0GRNI Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR731820.2|CNS0GRM9 Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 542 tcccgccattgatgacgttg 523
>emb|CR731792.2|CNS0GRLH Tetraodon nigroviridis full-length cDNA Length = 1566 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 537 tcccgccattgatgacgttg 518
>emb|CR731776.2|CNS0GRL1 Tetraodon nigroviridis full-length cDNA Length = 1497 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 517 tcccgccattgatgacgttg 498
>emb|CR731855.1|CNS0GRN8 Tetraodon nigroviridis full-length cDNA Length = 1538 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 528 tcccgccattgatgacgttg 509
>emb|CR731713.2|CNS0GRJA Tetraodon nigroviridis full-length cDNA Length = 1546 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR731699.2|CNS0GRIW Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR731639.2|CNS0GRH8 Tetraodon nigroviridis full-length cDNA Length = 1556 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 544 tcccgccattgatgacgttg 525
>emb|CR731638.2|CNS0GRH7 Tetraodon nigroviridis full-length cDNA Length = 1543 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 535 tcccgccattgatgacgttg 516
>emb|CR731604.2|CNS0GRG9 Tetraodon nigroviridis full-length cDNA Length = 1563 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR731584.2|CNS0GRFP Tetraodon nigroviridis full-length cDNA Length = 1531 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR731508.2|CNS0GRDL Tetraodon nigroviridis full-length cDNA Length = 1560 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 536 tcccgccattgatgacgttg 517
>emb|CR731430.2|CNS0GRBF Tetraodon nigroviridis full-length cDNA Length = 1584 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 559 tcccgccattgatgacgttg 540
>emb|CR731429.2|CNS0GRBE Tetraodon nigroviridis full-length cDNA Length = 1583 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 560 tcccgccattgatgacgttg 541
>emb|CR731340.2|CNS0GR8X Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR731328.2|CNS0GR8L Tetraodon nigroviridis full-length cDNA Length = 1550 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR731318.2|CNS0GR8B Tetraodon nigroviridis full-length cDNA Length = 1551 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 530 tcccgccattgatgacgttg 511
>emb|CR731270.2|CNS0GR6Z Tetraodon nigroviridis full-length cDNA Length = 1582 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 560 tcccgccattgatgacgttg 541
>emb|CR731093.2|CNS0GR22 Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR731045.2|CNS0GR0Q Tetraodon nigroviridis full-length cDNA Length = 1541 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 535 tcccgccattgatgacgttg 516
>emb|CR730981.2|CNS0GQYY Tetraodon nigroviridis full-length cDNA Length = 1547 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 536 tcccgccattgatgacgttg 517
>emb|CR730926.2|CNS0GQXF Tetraodon nigroviridis full-length cDNA Length = 1555 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR730776.1|CNS0GQT9 Tetraodon nigroviridis full-length cDNA Length = 1537 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR730498.2|CNS0GQLJ Tetraodon nigroviridis full-length cDNA Length = 1572 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 552 tcccgccattgatgacgttg 533
>emb|CR730495.2|CNS0GQLG Tetraodon nigroviridis full-length cDNA Length = 1575 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 556 tcccgccattgatgacgttg 537
>emb|CR730296.2|CNS0GQFX Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR730281.2|CNS0GQFI Tetraodon nigroviridis full-length cDNA Length = 1539 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR730218.2|CNS0GQDS Tetraodon nigroviridis full-length cDNA Length = 1534 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR730207.2|CNS0GQDH Tetraodon nigroviridis full-length cDNA Length = 1461 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 512 tcccgccattgatgacgttg 493
>emb|CR730659.1|CNS0GQQ0 Tetraodon nigroviridis full-length cDNA Length = 1555 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 542 tcccgccattgatgacgttg 523
>emb|CR730347.1|CNS0GQHC Tetraodon nigroviridis full-length cDNA Length = 1549 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 540 tcccgccattgatgacgttg 521
>emb|CR730270.1|CNS0GQF7 Tetraodon nigroviridis full-length cDNA Length = 1538 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR730047.3|CNS0GQ91 Tetraodon nigroviridis full-length cDNA Length = 1262 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 261 tcccgccattgatgacgttg 242
>emb|CR730165.2|CNS0GQCB Tetraodon nigroviridis full-length cDNA Length = 1550 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 536 tcccgccattgatgacgttg 517
>emb|CR730154.2|CNS0GQC0 Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR730151.2|CNS0GQBX Tetraodon nigroviridis full-length cDNA Length = 1345 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 325 tcccgccattgatgacgttg 306
>emb|CR730122.2|CNS0GQB4 Tetraodon nigroviridis full-length cDNA Length = 1559 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 540 tcccgccattgatgacgttg 521
>emb|CR730115.2|CNS0GQAX Tetraodon nigroviridis full-length cDNA Length = 1406 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 385 tcccgccattgatgacgttg 366
>emb|CR729994.2|CNS0GQ7K Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR729808.2|CNS0GQ2E Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR730182.1|CNS0GQCS Tetraodon nigroviridis full-length cDNA Length = 1508 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 520 tcccgccattgatgacgttg 501
>emb|CR729680.2|CNS0GPYU Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR729602.2|CNS0GPWO Tetraodon nigroviridis full-length cDNA Length = 1542 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR729505.2|CNS0GPTZ Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR729481.2|CNS0GPTB Tetraodon nigroviridis full-length cDNA Length = 1546 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR729224.2|CNS0GPM6 Tetraodon nigroviridis full-length cDNA Length = 1565 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR729215.2|CNS0GPLX Tetraodon nigroviridis full-length cDNA Length = 1589 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 566 tcccgccattgatgacgttg 547
>emb|CR729213.2|CNS0GPLV Tetraodon nigroviridis full-length cDNA Length = 1561 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 548 tcccgccattgatgacgttg 529
>emb|CR729312.1|CNS0GPOM Tetraodon nigroviridis full-length cDNA Length = 1504 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 536 tcccgccattgatgacgttg 517
>emb|CR728931.2|CNS0GPE1 Tetraodon nigroviridis full-length cDNA Length = 1579 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR728875.2|CNS0GPCH Tetraodon nigroviridis full-length cDNA Length = 1407 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 386 tcccgccattgatgacgttg 367
>emb|CR728865.1|CNS0GPC7 Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR728444.2|CNS0GP0I Tetraodon nigroviridis full-length cDNA Length = 1563 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR728316.2|CNS0GOWY Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR728296.2|CNS0GOWE Tetraodon nigroviridis full-length cDNA Length = 1537 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 535 tcccgccattgatgacgttg 516
>emb|CR728226.2|CNS0GOUG Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR728206.2|CNS0GOTW Tetraodon nigroviridis full-length cDNA Length = 1559 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 541 tcccgccattgatgacgttg 522
>emb|CR728166.2|CNS0GOSS Tetraodon nigroviridis full-length cDNA Length = 1562 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 549 tcccgccattgatgacgttg 530
>emb|CR728150.2|CNS0GOSC Tetraodon nigroviridis full-length cDNA Length = 1575 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 557 tcccgccattgatgacgttg 538
>emb|CR728277.1|CNS0GOVV Tetraodon nigroviridis full-length cDNA Length = 1537 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 532 tcccgccattgatgacgttg 513
>emb|CR728134.2|CNS0GORW Tetraodon nigroviridis full-length cDNA Length = 1560 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 540 tcccgccattgatgacgttg 521
>emb|CR728039.2|CNS0GOP9 Tetraodon nigroviridis full-length cDNA Length = 1568 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR727992.2|CNS0GONY Tetraodon nigroviridis full-length cDNA Length = 1533 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 543 tcccgccattgatgacgttg 524
>emb|CR727983.2|CNS0GONP Tetraodon nigroviridis full-length cDNA Length = 1537 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR727776.2|CNS0GOHY Tetraodon nigroviridis full-length cDNA Length = 1577 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 555 tcccgccattgatgacgttg 536
>emb|CR727968.1|CNS0GONA Tetraodon nigroviridis full-length cDNA Length = 1554 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 552 tcccgccattgatgacgttg 533
>emb|CR727647.1|CNS0GOED Tetraodon nigroviridis full-length cDNA Length = 1533 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 533 tcccgccattgatgacgttg 514
>emb|CR727590.2|CNS0GOCS Tetraodon nigroviridis full-length cDNA Length = 1580 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 558 tcccgccattgatgacgttg 539
>emb|CR727582.2|CNS0GOCK Tetraodon nigroviridis full-length cDNA Length = 1566 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR727551.2|CNS0GOBP Tetraodon nigroviridis full-length cDNA Length = 1562 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 543 tcccgccattgatgacgttg 524
>emb|CR727543.2|CNS0GOBH Tetraodon nigroviridis full-length cDNA Length = 1523 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 534 tcccgccattgatgacgttg 515
>emb|CR727387.2|CNS0GO75 Tetraodon nigroviridis full-length cDNA Length = 1589 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 558 tcccgccattgatgacgttg 539
>emb|CR727251.2|CNS0GO3D Tetraodon nigroviridis full-length cDNA Length = 1571 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR727066.2|CNS0GNY8 Tetraodon nigroviridis full-length cDNA Length = 1520 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 547 tcccgccattgatgacgttg 528
>emb|CR727056.2|CNS0GNXY Tetraodon nigroviridis full-length cDNA Length = 1567 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR727043.2|CNS0GNXL Tetraodon nigroviridis full-length cDNA Length = 1570 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 550 tcccgccattgatgacgttg 531
>emb|CR727025.2|CNS0GNX3 Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 546 tcccgccattgatgacgttg 527
>emb|CR727019.2|CNS0GNWX Tetraodon nigroviridis full-length cDNA Length = 1564 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 543 tcccgccattgatgacgttg 524
>emb|CR726875.2|CNS0GNSX Tetraodon nigroviridis full-length cDNA Length = 1562 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 545 tcccgccattgatgacgttg 526
>emb|CR726842.1|CNS0GNS0 Tetraodon nigroviridis full-length cDNA Length = 1520 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 tcccgccattgatgacgttg 392 |||||||||||||||||||| Sbjct: 521 tcccgccattgatgacgttg 502 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,576,103 Number of Sequences: 3902068 Number of extensions: 3576103 Number of successful extensions: 74409 Number of sequences better than 10.0: 732 Number of HSP's better than 10.0 without gapping: 732 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 73354 Number of HSP's gapped (non-prelim): 1052 length of query: 422 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 400 effective length of database: 17,147,199,772 effective search space: 6858879908800 effective search space used: 6858879908800 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)