ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet94b11 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_467386.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1020 Score = 73.8 bits (37), Expect = 4e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 308 gagttgacgaaggcgaggaacctcccgagctggcggttgtaggcgcaggggcgctccagg 367 ||||||||| | | |||||||||| ||||||||||||||| ||||| || ||||| | | Sbjct: 983 gagttgacgtacgagaggaacctctggagctggcggttgtacgcgcacggccgctcgacg 924 Query: 368 tggagcaggtgcccggccttggggatgcc 396 || ||||| || ||||||||||||||||| Sbjct: 923 tgcagcagatggccggccttggggatgcc 895
>gb|AF480496.1| Oryza sativa clone BAC 49D11, complete sequence Length = 158050 Score = 73.8 bits (37), Expect = 4e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 308 gagttgacgaaggcgaggaacctcccgagctggcggttgtaggcgcaggggcgctccagg 367 ||||||||| | | |||||||||| ||||||||||||||| ||||| || ||||| | | Sbjct: 119883 gagttgacgtacgagaggaacctctggagctggcggttgtacgcgcacggccgctcgacg 119824 Query: 368 tggagcaggtgcccggccttggggatgcc 396 || ||||| || ||||||||||||||||| Sbjct: 119823 tgcagcagatggccggccttggggatgcc 119795
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 73.8 bits (37), Expect = 4e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 308 gagttgacgaaggcgaggaacctcccgagctggcggttgtaggcgcaggggcgctccagg 367 ||||||||| | | |||||||||| ||||||||||||||| ||||| || ||||| | | Sbjct: 29242748 gagttgacgtacgagaggaacctctggagctggcggttgtacgcgcacggccgctcgacg 29242807 Query: 368 tggagcaggtgcccggccttggggatgcc 396 || ||||| || ||||||||||||||||| Sbjct: 29242808 tgcagcagatggccggccttggggatgcc 29242836
>dbj|AP005844.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0060O16 Length = 164373 Score = 73.8 bits (37), Expect = 4e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 308 gagttgacgaaggcgaggaacctcccgagctggcggttgtaggcgcaggggcgctccagg 367 ||||||||| | | |||||||||| ||||||||||||||| ||||| || ||||| | | Sbjct: 40093 gagttgacgtacgagaggaacctctggagctggcggttgtacgcgcacggccgctcgacg 40152 Query: 368 tggagcaggtgcccggccttggggatgcc 396 || ||||| || ||||||||||||||||| Sbjct: 40153 tgcagcagatggccggccttggggatgcc 40181
>dbj|AP005323.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0680A05 Length = 168092 Score = 73.8 bits (37), Expect = 4e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 308 gagttgacgaaggcgaggaacctcccgagctggcggttgtaggcgcaggggcgctccagg 367 ||||||||| | | |||||||||| ||||||||||||||| ||||| || ||||| | | Sbjct: 132716 gagttgacgtacgagaggaacctctggagctggcggttgtacgcgcacggccgctcgacg 132775 Query: 368 tggagcaggtgcccggccttggggatgcc 396 || ||||| || ||||||||||||||||| Sbjct: 132776 tgcagcagatggccggccttggggatgcc 132804
>dbj|AK059034.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-C07, full insert sequence Length = 1798 Score = 73.8 bits (37), Expect = 4e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 308 gagttgacgaaggcgaggaacctcccgagctggcggttgtaggcgcaggggcgctccagg 367 ||||||||| | | |||||||||| ||||||||||||||| ||||| || ||||| | | Sbjct: 1416 gagttgacgtacgagaggaacctctggagctggcggttgtacgcgcacggccgctcgacg 1357 Query: 368 tggagcaggtgcccggccttggggatgcc 396 || ||||| || ||||||||||||||||| Sbjct: 1356 tgcagcagatggccggccttggggatgcc 1328
>gb|AC011455.6|AC011455 Homo sapiens chromosome 19 clone CTC-360G5, complete sequence Length = 148876 Score = 48.1 bits (24), Expect = 0.022 Identities = 24/24 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 |||||||||||||||||||||||| Sbjct: 47251 gctttgctttgcttttcttttttg 47274
>emb|AJ505014.1|HSA505014 Homo sapiens mRNA for sirtuin type 2 (SIRT2 gene), transcript variant 3 Length = 2550 Score = 48.1 bits (24), Expect = 0.022 Identities = 24/24 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttttttg 209 |||||||||||||||||||||||| Sbjct: 319 gctttgctttgcttttcttttttg 296
>gb|AC161808.8| Mus musculus chromosome 5, clone RP24-386J15, complete sequence Length = 184815 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttctttttt 208 ||||||||||||||||||||||| Sbjct: 121644 gctttgctttgcttttctttttt 121666
>gb|AC127027.13| Mus musculus chromosome 5, clone RP23-236G19, complete sequence Length = 195654 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttctttttt 208 ||||||||||||||||||||||| Sbjct: 17808 gctttgctttgcttttctttttt 17830
>emb|CR932808.1| Mus musculus chromosome 2, clone RPCI-21-370D12 strain 129/Sv, complete sequence Length = 163435 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttctttttt 208 ||||||||||||||||||||||| Sbjct: 25344 gctttgctttgcttttctttttt 25366
>emb|CR932798.1| Mus musculus chromosome 2, clone RPCI-21-15D06 strain 129/Sv, complete sequence Length = 165525 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttctttttt 208 ||||||||||||||||||||||| Sbjct: 108023 gctttgctttgcttttctttttt 108045
>gb|AC124744.3| Mus musculus BAC clone RP23-223E16 from 13, complete sequence Length = 199767 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Plus Query: 184 cagctttgctttgcttttctttt 206 ||||||||||||||||||||||| Sbjct: 54032 cagctttgctttgcttttctttt 54054
>emb|AL844538.9| Mouse DNA sequence from clone RP23-289K19 on chromosome 2, complete sequence Length = 180252 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttctttttt 208 ||||||||||||||||||||||| Sbjct: 96591 gctttgctttgcttttctttttt 96569
>gb|AY147543.1| Muscari comosum photosystem II CP47 protein (psbB) gene, partial cds; photosystem II subunit T (psbT) and photosystem II subunit N (psbN) genes, complete cds; and photosystem II subunit H (psbH) gene, partial cds; chloroplast genes for chloroplast products Length = 2178 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttttg 209 |||||||||||||||||||||| Sbjct: 1343 tttgctttgcttttcttttttg 1364
>gb|AY147536.1| Allium textile photosystem II CP47 protein (psbB) gene, partial cds; photosystem II subunit T (psbT) and photosystem II subunit N (psbN) genes, complete cds; and photosystem II subunit H (psbH) gene, partial cds; chloroplast genes for chloroplast products Length = 2224 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttttg 209 |||||||||||||||||||||| Sbjct: 1342 tttgctttgcttttcttttttg 1363
>gb|AC126941.3| Mus musculus BAC clone RP23-133N24 from chromosome 7, complete sequence Length = 196621 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttt 207 |||||||||||||||||||||| Sbjct: 51625 gctttgctttgcttttcttttt 51646
>emb|AL161896.16| Human DNA sequence from clone RP11-261P24 on chromosome 13 Contains part of the FARP1 gene for (chondrocyte-derived) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 and a novel gene, complete sequence Length = 96183 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 188 tttgctttgcttttcttttttg 209 |||||||||||||||||||||| Sbjct: 95393 tttgctttgcttttcttttttg 95372
>emb|AL137249.29| Human DNA sequence from clone RP11-111L24 on chromosome 13q31.3-32.3 Contains the 3' end of the FARP1 gene for (chondrocyte-derived) FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1, a novel gene and the 3' end of the STK24 gene for serine/threonine kinase 24, complete sequence Length = 106578 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Minus Query: 188 tttgctttgcttttcttttttg 209 |||||||||||||||||||||| Sbjct: 1210 tttgctttgcttttcttttttg 1189
>gb|AY007469.1| Sagittaria latifolia photosystem II CP47 protein (psbB) gene, partial cds; PsbT (psbT) and PsbN (psbN) genes, complete cds; and PsbH (psbH) gene, partial cds; chloroplast genes for chloroplast products Length = 2204 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttttg 209 |||||||||||||||||||||| Sbjct: 1343 tttgctttgcttttcttttttg 1364
>ref|NM_006546.3| Homo sapiens insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), mRNA Length = 8769 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 3835 tttgctttgcttttctttttt 3815
>gb|AC147673.3| Pan troglodytes BAC clone CH251-13F15 from Y, complete sequence Length = 164583 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 33264 tttgctttgcttttctttttt 33284
>gb|DQ478408.1| Homo sapiens neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; neighbor of BRCA1 gene 2 (NBR2) gene, complete cds; and early onset breast cancer 1 (BRCA1) gene, partial cds Length = 150505 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 65777 ctttgctttgcttttcttttt 65757
>ref|NM_032501.2| Homo sapiens acyl-CoA synthetase short-chain family member 1 (ACSS1), nuclear gene encoding mitochondrial protein, mRNA Length = 4488 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 4372 aatggcttagctttccatgttgctg 4396
>gb|DQ190457.1| Homo sapiens clone mck41_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; hypothetical protein LOC10230 (NBR2) gene, complete cds; and breast cancer 1 early onset (BRCA1) gene, partial cds Length = 147576 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 62845 ctttgctttgcttttcttttt 62825
>gb|DQ190456.1| Homo sapiens clone mck578_U neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 150669 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 62881 ctttgctttgcttttcttttt 62861
>gb|DQ190455.1| Homo sapiens clone mck554_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 155470 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 65450 ctttgctttgcttttcttttt 65430
>gb|DQ190454.1| Homo sapiens clone mck43_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 150582 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 58302 ctttgctttgcttttcttttt 58282
>gb|DQ190453.1| Homo sapiens clone mck55_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 156879 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 64150 ctttgctttgcttttcttttt 64130
>gb|DQ190452.1| Homo sapiens clone mck94_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 156121 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 61787 ctttgctttgcttttcttttt 61767
>gb|DQ190451.1| Homo sapiens clone mck47_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 161765 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 61860 ctttgctttgcttttcttttt 61840
>gb|DQ190450.1| Homo sapiens clone mck432_A neighbor of BRCA1 gene 1 (NBR1) gene, partial cds; and hypothetical protein LOC10230 (NBR2) and breast cancer 1 early onset (BRCA1) genes, complete cds Length = 167910 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 62731 ctttgctttgcttttcttttt 62711
>gb|BC055008.1| Homo sapiens acyl-CoA synthetase short-chain family member 1, mRNA (cDNA clone MGC:57361 IMAGE:4838976), complete cds Length = 3624 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 3493 aatggcttagctttccatgttgctg 3517
>gb|BC044588.1| Homo sapiens acyl-CoA synthetase short-chain family member 1, mRNA (cDNA clone MGC:57208 IMAGE:5260496), complete cds Length = 3626 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 3493 aatggcttagctttccatgttgctg 3517
>gb|BC039261.1| Homo sapiens acyl-CoA synthetase short-chain family member 1, mRNA (cDNA clone MGC:33843 IMAGE:5298849), complete cds Length = 3649 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 3533 aatggcttagctttccatgttgctg 3557
>gb|BC032076.1| Homo sapiens acyl-CoA synthetase short-chain family member 1, mRNA (cDNA clone IMAGE:4474490) Length = 2394 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 2262 aatggcttagctttccatgttgctg 2286
>gb|AC121314.7| Mus musculus chromosome 1, clone RP24-429M15, complete sequence Length = 175976 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttctttt 206 ||||||||||||||||||||| Sbjct: 107556 gctttgctttgcttttctttt 107536
>gb|AC004854.3| Homo sapiens PAC clone RP4-673M15 from 7, complete sequence Length = 98697 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 185 agctttgctttgcttttcttttttg 209 ||||||||||| ||||||||||||| Sbjct: 7042 agctttgcttttcttttcttttttg 7018
>gb|BC061893.1| Homo sapiens cDNA clone IMAGE:4358261, partial cds Length = 946 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 agctttgctttgcttttcttt 205 ||||||||||||||||||||| Sbjct: 583 agctttgctttgcttttcttt 603
>gb|AC115356.5| Mus musculus BAC clone RP23-47E9 from 15, complete sequence Length = 212177 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttctttt 206 ||||||||||||||||||||| Sbjct: 82064 gctttgctttgcttttctttt 82084
>gb|AC139192.1| Pan troglodytes BAC clone RP43-44N16 from Y, complete sequence Length = 149965 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 131327 tttgctttgcttttctttttt 131307
>gb|AC139194.1| Pan troglodytes BAC clone RP43-164C2 from Y, complete sequence Length = 182587 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 101129 tttgctttgcttttctttttt 101109
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3, complete sequence Length = 151563 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 agctttgctttgcttttcttt 205 ||||||||||||||||||||| Sbjct: 71827 agctttgctttgcttttcttt 71847
>emb|AL035661.16|HS568C11 Human DNA sequence from clone RP4-568C11 on chromosome 20p11.21-11.23 Contains the CST7 gene for cystatin F (leukocystatin)(cystatin 7, leukocystatin, cystatin-like metastasis-associated protein, CMAP), the gene C20ORF3 for chromosome 20 open reading frame 3, the 3' end of the ACAS2L gene for acetyl-Coenzyme A synthetase (AMP forming)-like and a CpG island, complete sequence Length = 103681 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 82244 aatggcttagctttccatgttgctg 82220
>emb|CR391929.9| Zebrafish DNA sequence from clone DKEYP-86B5, complete sequence Length = 223724 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttctttt 206 ||||||||||||||||||||| Sbjct: 214930 gctttgctttgcttttctttt 214910
>emb|AL833041.1|HSM804352 Homo sapiens mRNA; cDNA DKFZp666B209 (from clone DKFZp666B209) Length = 1940 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 1827 aatggcttagctttccatgttgctg 1851
>emb|AL832939.1|HSM804250 Homo sapiens mRNA; cDNA DKFZp666G0810 (from clone DKFZp666G0810) Length = 2755 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 2643 aatggcttagctttccatgttgctg 2667
>dbj|BS000627.2| Pan troglodytes chromosome Y clone: PTB-087E03, complete sequence Length = 203922 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 164282 tttgctttgcttttctttttt 164262
>dbj|BS000536.1| Pan troglodytes chromosome Y clone:PTB-100K06, complete sequences Length = 204391 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 186380 tttgctttgcttttctttttt 186400
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 21075379 tttgctttgcttttctttttt 21075399
>dbj|AK125923.1| Homo sapiens cDNA FLJ43935 fis, clone TESTI4013817, moderately similar to Acetyl-coenzyme A synthethase Length = 4765 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 4661 aatggcttagctttccatgttgctg 4685
>dbj|AK127566.1| Homo sapiens cDNA FLJ45659 fis, clone CTONG2020582, moderately similar to Acetyl-coenzyme A synthetase (EC 6.2.1.1) Length = 2376 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 2276 aatggcttagctttccatgttgctg 2300
>emb|CR624354.1| full-length cDNA clone CS0DI042YH08 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1171 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 1120 aatggcttagctttccatgttgctg 1144
>dbj|AK125058.1| Homo sapiens cDNA FLJ43068 fis, clone BRTHA3008778, moderately similar to Acetyl-coenzyme A synthetase (EC 6.2.1.1) Length = 4877 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 4777 aatggcttagctttccatgttgctg 4801
>emb|CR616020.1| full-length cDNA clone CS0DI065YL07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1658 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 1582 aatggcttagctttccatgttgctg 1606
>dbj|AK092295.1| Homo sapiens cDNA FLJ34976 fis, clone NTONG2005801, moderately similar to ACETYL-COENZYME A SYNTHETASE (EC 6.2.1.1) Length = 3051 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 2951 aatggcttagctttccatgttgctg 2975
>dbj|AK090851.1| Homo sapiens cDNA FLJ33532 fis, clone BRAMY2007287, weakly similar to ACETYL-COENZYME A SYNTHETASE (EC 6.2.1.1) Length = 2440 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 2334 aatggcttagctttccatgttgctg 2358
>dbj|AK027817.1| Homo sapiens cDNA FLJ14911 fis, clone PLACE1006469, weakly similar to ACETYL-COENZYME A SYNTHETASE (EC 6.2.1.1) Length = 2497 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 2397 aatggcttagctttccatgttgctg 2421
>emb|CR593620.1| full-length cDNA clone CS0DI007YD15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 896 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 795 aatggcttagctttccatgttgctg 819
>gb|AC107053.5| Homo sapiens BAC clone RP11-398H1 from 4, complete sequence Length = 57057 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 54531 tttgctttgcttttctttttt 54551
>gb|AC115811.12| Mus musculus chromosome 5, clone RP23-429M21, complete sequence Length = 180812 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttctttt 206 ||||||||||||||||||||| Sbjct: 78205 gctttgctttgcttttctttt 78185
>gb|AC148989.4| Mus musculus BAC clone RP24-445D7 from chromosome 7, complete sequence Length = 194576 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttctttt 206 ||||||||||||||||||||| Sbjct: 156303 gctttgctttgcttttctttt 156283
>gb|BC015435.1| Homo sapiens ring finger protein 187, mRNA (cDNA clone IMAGE:4415092), with apparent retained intron Length = 865 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 agctttgctttgcttttcttt 205 ||||||||||||||||||||| Sbjct: 494 agctttgctttgcttttcttt 514
>gb|BC039872.1| Homo sapiens ring finger protein 187, mRNA (cDNA clone IMAGE:4415091), with apparent retained intron Length = 864 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 agctttgctttgcttttcttt 205 ||||||||||||||||||||| Sbjct: 493 agctttgctttgcttttcttt 513
>gb|AC153935.2| Mus musculus 10 BAC RP24-273A2 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 169237 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttctttt 206 ||||||||||||||||||||| Sbjct: 154961 gctttgctttgcttttctttt 154941
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 5871795 tttgctttgcttttctttttt 5871815
>gb|AC060780.18| Homo sapiens chromosome 17, clone RP11-242D8, complete sequence Length = 110669 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 46264 ctttgctttgcttttcttttt 46284
>gb|AC133084.4| Mus musculus BAC clone RP24-358F13 from chromosome 5, complete sequence Length = 177485 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttctttt 206 ||||||||||||||||||||| Sbjct: 117668 gctttgctttgcttttctttt 117688
>gb|AC135721.4| Homo sapiens, clone CTD-3199J23, complete sequence Length = 150472 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 27644 ctttgctttgcttttcttttt 27624
>gb|AC175464.1| Mus musculus BAC clone RP23-129E4 from chromosome 16, complete sequence Length = 224605 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 176 caggctaccagctttgctttg 196 ||||||||||||||||||||| Sbjct: 186186 caggctaccagctttgctttg 186166
>dbj|AP006528.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0651G05 Length = 153258 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 63282 tttgctttgcttttctttttt 63302
>emb|AL163208.2|HS21C008 Homo sapiens chromosome 21 segment HS21C008 Length = 340000 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttt 207 ||||||||||||||||||||| Sbjct: 310748 ctttgctttgcttttcttttt 310728
>emb|AL935301.8| Mouse DNA sequence from clone RP23-132B12 on chromosome 2, complete sequence Length = 182314 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttttttgc 210 ||||||||||||||| ||||||||| Sbjct: 107751 gctttgctttgctttgcttttttgc 107727
>emb|AL928792.9| Mouse DNA sequence from clone RP23-88O15 on chromosome 2, complete sequence Length = 257463 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 cagctttgctttgcttttctt 204 ||||||||||||||||||||| Sbjct: 74408 cagctttgctttgcttttctt 74388
>gb|AC153936.3| Mus musculus 10 BAC RP24-114G19 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 170723 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttctttt 206 ||||||||||||||||||||| Sbjct: 95038 gctttgctttgcttttctttt 95018
>gb|AC105030.11| Homo sapiens chromosome 17, clone CTD-2244F11, complete sequence Length = 107848 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttctttttt 208 ||||||||||||||||||||| Sbjct: 70813 tttgctttgcttttctttttt 70833
>dbj|AB058749.1| Homo sapiens mRNA for KIAA1846 protein, partial cds Length = 2597 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 aatggcttagctttccatgctgctg 104 ||||||||||||||||||| ||||| Sbjct: 2491 aatggcttagctttccatgttgctg 2515
>gb|AY958086.1| Zygnema circumcarinatum chloroplast, complete genome Length = 165372 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||| |||||||||| Sbjct: 8576 gctttgctttgctattcttttttg 8599
>gb|AY147534.1| Xanthorrhoea resinosa photosystem II CP47 protein (psbB) gene, partial cds; photosystem II subunit T (psbT) and photosystem II subunit N (psbN) genes, complete cds; and photosystem II subunit H (psbH) gene, partial cds; chloroplast genes for chloroplast products Length = 2207 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 1343 tttgctttgcttttcttttt 1362
>gb|AY147532.1| Phormium tenax photosystem II CP47 protein (psbB) gene, partial cds; photosystem II subunit T (psbT) and photosystem II subunit N (psbN) genes, complete cds; and photosystem II subunit H (psbH) gene, partial cds; chloroplast genes for chloroplast products Length = 2225 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 1343 tttgctttgcttttcttttt 1362
>gb|AY147530.1| Lanaria lanata photosystem II CP47 protein (psbB) gene, partial cds; photosystem II subunit T (psbT) and photosystem II subunit N (psbN) genes, complete cds; and photosystem II subunit H (psbH) gene, partial cds; chloroplast genes for chloroplast products Length = 2201 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 1343 tttgctttgcttttcttttt 1362
>gb|AY147527.1| Hemerocallis littorea photosystem II CP47 protein (psbB) gene, partial cds; photosystem II subunit T (psbT) and photosystem II subunit N (psbN) genes, complete cds; and photosystem II subunit H (psbH) gene, partial cds; chloroplast genes for chloroplast products Length = 2204 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 1342 tttgctttgcttttcttttt 1361
>gb|AY147524.1| Curculigo capitulata photosystem II CP47 protein (psbB) gene, partial cds; photosystem II subunit T (psbT) and photosystem II subunit N (psbN) genes, complete cds; and photosystem II subunit H (psbH) gene, partial cds; chloroplast genes for chloroplast products Length = 2200 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 1343 tttgctttgcttttcttttt 1362
>gb|AY147501.1| Tofieldia glutinosa photosystem II CP47 protein (psbB) gene, partial cds; photosystem II subunit T (psbT) and photosystem II subunit N (psbN) genes, complete cds; and photosystem II subunit H (psbH) gene, partial cds; chloroplast genes for chloroplast products Length = 2101 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 1343 tttgctttgcttttcttttt 1362
>gb|AC112970.18| Mus musculus chromosome 17, clone RP24-443D19, complete sequence Length = 172747 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 114378 gctttgctttgcttttcttt 114359
>gb|AC111067.9| Mus musculus chromosome 1, clone RP24-483O2, complete sequence Length = 130269 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 24941 gctttgctttgcttttcttt 24922
>gb|AC149230.2| Pan troglodytes BAC clone CH251-557H16 from 7, complete sequence Length = 157879 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 185 agctttgctttgcttttctttttt 208 |||||||||||||||| ||||||| Sbjct: 145383 agctttgctttgctttgctttttt 145406
>ref|XM_368272.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein (MG00972.4) partial mRNA Length = 699 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 336 gctggcggttgtaggcgcaggggc 359 |||||||||||||| ||||||||| Sbjct: 145 gctggcggttgtagtcgcaggggc 122
>gb|AC135568.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0078F08, complete sequence Length = 165440 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 192 ctttgcttttcttttttgcgagga 215 |||| ||||||||||||||||||| Sbjct: 138717 cttttcttttcttttttgcgagga 138740
>gb|AC145748.4| Mus musculus BAC clone RP23-31L10 from chromosome 5, complete sequence Length = 220208 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 385 cttggggatgccctgcaggt 404 |||||||||||||||||||| Sbjct: 86996 cttggggatgccctgcaggt 86977
>gb|BC059029.1| Mus musculus RIKEN cDNA A930017N06 gene, mRNA (cDNA clone MGC:69764 IMAGE:6811341), complete cds Length = 3586 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 385 cttggggatgccctgcaggt 404 |||||||||||||||||||| Sbjct: 2408 cttggggatgccctgcaggt 2389
>gb|AC131690.3| Mus musculus BAC clone RP23-386P10 from chromosome 10, complete sequence Length = 208306 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 195598 gctttgctttgctttgcttttttg 195621
>gb|AC131721.4| Mus musculus BAC clone RP23-142L24 from chromosome 15, complete sequence Length = 230892 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 368 tggagcaggtgcccggcctt 387 |||||||||||||||||||| Sbjct: 35850 tggagcaggtgcccggcctt 35831
>gb|AC163269.3| Mus musculus chromosome 15, clone RP24-276M6, complete sequence Length = 172683 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 183 ccagctttgctttgcttttctttt 206 ||||||||||||| |||||||||| Sbjct: 79506 ccagctttgcttttcttttctttt 79483
>gb|AC144736.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OSJNBa0008E07, complete sequence Length = 146679 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 185 agctttgctttgcttttctttttt 208 |||||| ||||||||||||||||| Sbjct: 3457 agcttttctttgcttttctttttt 3480
>gb|AC144452.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OSJNBa0025G07, complete sequence Length = 167136 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 185 agctttgctttgcttttctttttt 208 |||||| ||||||||||||||||| Sbjct: 113091 agcttttctttgcttttctttttt 113114
>gb|DQ069651.1| Nuphar advena photosystem II 47 kDa protein (psbB) gene, partial cds; chloroplast Length = 1524 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 1372 tttgctttgcttttcttttt 1391
>gb|AC165155.2| Mus musculus BAC clone RP23-293N22 from chromosome 14, complete sequence Length = 226292 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 32370 gctttgctttgcttttcttt 32351
>ref|NM_001032616.1| Takifugu rubripes CD45 (PTPRc), mRNA Length = 4300 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 235 taattaatcgattatcctcc 254 |||||||||||||||||||| Sbjct: 3932 taattaatcgattatcctcc 3913
>gb|L00035.1|MUSIGKJC2 Mus musculus immunoglobulin kappa precursor gene, partial sequence Length = 349 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 84 gctttgctttgctttgcttttttg 107
>gb|AC147066.2| Pan troglodytes BAC clone RP43-164F2 from 7, complete sequence Length = 149431 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 ctttgctttgcttttctttt 206 |||||||||||||||||||| Sbjct: 76349 ctttgctttgcttttctttt 76368
>emb|Y18000.1|HSAY18000 Homo sapiens NF2 gene Length = 126138 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 15177 gctttgctttgcttttcttt 15158
>gb|AC146512.2| Pan troglodytes BAC clone RP43-16E21 from 7, complete sequence Length = 178648 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttctttt 206 |||||||||||||||||||| Sbjct: 108151 ctttgctttgcttttctttt 108132
>gb|AC132474.3| Mus musculus BAC clone RP23-114G13 from chromosome 9, complete sequence Length = 220976 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 189 ttgctttgcttttctttttt 208 |||||||||||||||||||| Sbjct: 116264 ttgctttgcttttctttttt 116245
>gb|L00033.1|AH001950S5 Mus musculus immunglobulin kappa chain unproductively rearranged V-T2, 3' flanking sequence Length = 349 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 84 gctttgctttgctttgcttttttg 107
>gb|AC127301.3| Mus musculus BAC clone RP23-269N6 from 18, complete sequence Length = 166565 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 38308 gctttgctttgctttgcttttttg 38285
>gb|AC102635.8| Mus musculus chromosome 16, clone RP23-112K20, complete sequence Length = 204382 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 144262 gctttgctttgcttttcttt 144243
>gb|AF104822.1| Danio rerio Six3 gene, promoter region Length = 3302 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 gctttgcttttcttttttgc 210 |||||||||||||||||||| Sbjct: 2556 gctttgcttttcttttttgc 2537
>emb|CR533578.7| Zebrafish DNA sequence from clone CH211-216F21 in linkage group 16, complete sequence Length = 214872 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 cagctttgctttgcttttct 203 |||||||||||||||||||| Sbjct: 36267 cagctttgctttgcttttct 36248
>emb|AL928734.9| Mouse DNA sequence from clone RP23-409P4 on chromosome 2, complete sequence Length = 113197 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 34034 gctttgctttgcttttcttt 34053
>gb|AC156398.13| Mus musculus 6 BAC RP24-279F16 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 170925 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 31830 gctttgctttgctttgcttttttg 31853
>emb|AL591916.8| Human DNA sequence from clone RP11-168B8 on chromosome 1 Contains the 5' end of a novel gene (FLJ36179), complete sequence Length = 159159 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 187 ctttgctttgcttttcttttttgc 210 ||||||||||||||||||| |||| Sbjct: 143450 ctttgctttgcttttctttcttgc 143427
>emb|AL139379.14| Human DNA sequence from clone RP11-358P11 on chromosome 13 Contains a CpG island, complete sequence Length = 166237 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 163194 gctttgctttgcttttcttt 163213
>gb|AC163009.2| Mus musculus chromosome 1, clone RP23-268A12, complete sequence Length = 147135 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 119678 gctttgctttgcttttcttt 119697
>emb|Z98056.2|SPAC5D6 S.pombe chromosome I cosmid c5D6 Length = 21852 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 ctttgctttgcttttctttt 206 |||||||||||||||||||| Sbjct: 5008 ctttgctttgcttttctttt 5027
>gb|AC094963.9| Rattus norvegicus X BAC CH230-6L20 (Children's Hospital Oakland Research Institute) complete sequence Length = 213440 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttctttt 206 |||||||||||||||||||| Sbjct: 108184 ctttgctttgcttttctttt 108165
>emb|AL607152.21| Mouse DNA sequence from clone RP23-198N14 on chromosome 11, complete sequence Length = 232408 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 185 agctttgctttgcttttctttttt 208 |||||||||||||||| ||||||| Sbjct: 42183 agctttgctttgctttgctttttt 42160
>gb|AC165272.2| Mus musculus BAC clone RP24-296O4 from chromosome 14, complete sequence Length = 178348 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 65294 gctttgctttgcttttcttt 65313
>gb|AC164663.5| Mus musculus 10 BAC RP23-44F24 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 192449 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 119847 gctttgctttgctttgcttttttg 119824
>emb|AJ627251.1| Nymphaea alba chloroplast, complete genome Length = 159930 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 79559 tttgctttgcttttcttttt 79578
>emb|AJ243430.1|FRU243430 Fugu rubripes PTPRc gene for CD45, exons 1-30 Length = 12293 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 235 taattaatcgattatcctcc 254 |||||||||||||||||||| Sbjct: 11925 taattaatcgattatcctcc 11906
>emb|AJ243429.1|FRU243429 Fugu rubripes mRNA for CD45 (PTPRc gene) Length = 4300 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 235 taattaatcgattatcctcc 254 |||||||||||||||||||| Sbjct: 3932 taattaatcgattatcctcc 3913
>emb|CR937268.1| Single read from an extremity of a cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAB2YI02AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 831 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 gctccaggtggagcaggtgc 379 |||||||||||||||||||| Sbjct: 593 gctccaggtggagcaggtgc 574
>gb|BC018064.1| Homo sapiens cDNA clone IMAGE:4816525 Length = 1377 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 198 ttttcttttttgcgaggaac 217 |||||||||||||||||||| Sbjct: 1262 ttttcttttttgcgaggaac 1281
>emb|CR859925.1| Pongo pygmaeus mRNA; cDNA DKFZp469J0814 (from clone DKFZp469J0814) Length = 4526 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 185 agctttgctttgcttttctttttt 208 ||||||||||| |||||||||||| Sbjct: 3667 agctttgcttttcttttctttttt 3690
>emb|BX571708.4| Zebrafish DNA sequence from clone DKEYP-74B2, complete sequence Length = 193197 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 gctttgcttttcttttttgc 210 |||||||||||||||||||| Sbjct: 70148 gctttgcttttcttttttgc 70167
>gb|AC010519.8| Homo sapiens chromosome 19 clone LLNLR-261D9, complete sequence Length = 46741 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 38235 gctttgctttgcttttcttt 38216
>emb|BX510923.8| Zebrafish DNA sequence from clone CH211-214J8 in linkage group 5, complete sequence Length = 165838 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 ctttgctttgcttttctttt 206 |||||||||||||||||||| Sbjct: 140869 ctttgctttgcttttctttt 140888
>gb|AC124968.36| Medicago truncatula clone mth2-15e21, complete sequence Length = 106968 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 agctttgctttgcttttctt 204 |||||||||||||||||||| Sbjct: 10992 agctttgctttgcttttctt 11011
>gb|AC008832.6| Homo sapiens chromosome 5 clone CTD-2146K22, complete sequence Length = 16078 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 427 tttgctttgcttttcttttt 408
>gb|AC100848.2| Homo sapiens chromosome 18, clone RP11-909B2, complete sequence Length = 209251 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 55374 gctttgctttgcttttcttt 55355
>gb|AF434766.1| Mus musculus fatty acid translocase (Cd36) gene, upstream promoter region and 5' UTR Length = 9466 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 3310 gctttgctttgcttttcttt 3329
>gb|AC089984.23| Homo sapiens 12q BAC RP11-2H8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 147638 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 |||||||||| ||||||||||||| Sbjct: 70454 gctttgcttttcttttcttttttg 70477
>gb|AC090971.3| Homo sapiens chromosome 15 clone RP11-56B16 map 15q21.3, complete sequence Length = 192464 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 61577 gctttgctttgcttttcttt 61558
>gb|AC099028.1| Drosophila melanogaster, chromosome 2R, region 55F-56X, BAC clone BACR08F09, complete sequence Length = 192358 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 20003 tttgctttgcttttcttttt 19984
>emb|BX510367.7| Zebrafish DNA sequence from clone DKEY-117M4 in linkage group 5, complete sequence Length = 107878 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 257 tggaacgaacaagatatata 276 |||||||||||||||||||| Sbjct: 102850 tggaacgaacaagatatata 102831
>gb|DP000040.1| Otolemur garnettii target 106 genomic scaffold Length = 277620 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 185 agctttgctttgcttttctttttt 208 ||||||||||||||||| |||||| Sbjct: 11197 agctttgctttgcttttttttttt 11220
>gb|AC111017.23| Mus musculus chromosome 13, clone RP23-62F4, complete sequence Length = 239344 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttttttg 209 |||||||||||||||| ||||||| Sbjct: 45827 gctttgctttgcttttgttttttg 45804
>gb|AC005694.3| Homo sapiens chromosome 22 clone bk294c2 map 22q12, complete sequence Length = 82101 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 39941 gctttgctttgcttttcttt 39922
>gb|AC005529.7| Homo sapiens chromosome 22 clone bk256d12 map 22q12, complete sequence Length = 318488 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 138580 gctttgctttgcttttcttt 138561
>gb|AC005527.3| Homo sapiens 22q11 BAC Clone 489d1 In MDR Region, complete sequence Length = 149308 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 138380 gctttgctttgcttttcttt 138361
>gb|AF188851.1|AF188851 Nymphaea odorata photosystem II CP47 protein (psbB) gene, partial cds; photosystem II subunit (psbT) and photosystem II subunit (psbN) genes, complete cds; and photosystem II subunit (psbH) gene, partial cds; chloroplast genes for chloroplast products Length = 2168 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 1343 tttgctttgcttttcttttt 1362
>dbj|AK044511.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library, clone:A930017N06 product:hypothetical RNI-like structure containing protein, full insert sequence Length = 3835 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 385 cttggggatgccctgcaggt 404 |||||||||||||||||||| Sbjct: 2677 cttggggatgccctgcaggt 2658
>dbj|AK044053.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830084J20 product:hypothetical protein, full insert sequence Length = 1859 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 385 cttggggatgccctgcaggt 404 |||||||||||||||||||| Sbjct: 717 cttggggatgccctgcaggt 698
>gb|AC160410.3| Mus musculus 10 BAC RP24-356L3 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 172562 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 138279 gctttgctttgctttgcttttttg 138302
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 192 ctttgcttttcttttttgcgagga 215 |||| ||||||||||||||||||| Sbjct: 18559402 cttttcttttcttttttgcgagga 18559425
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 27468850 tttgctttgcttttcttttt 27468869
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 185 agctttgctttgcttttctttttt 208 |||||| ||||||||||||||||| Sbjct: 12235979 agcttttctttgcttttctttttt 12236002
>gb|AC008245.6| Homo sapiens chromosome 18, clone RP11-146N18, complete sequence Length = 183749 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 182913 gctttgctttgcttttcttt 182894
>emb|V01561.1|MMDRF4 Mouse dispersed repetitive DNA sequences of the R-family and simple sequence DNA; member of the B1 family of mouse dispersed repetitive DNA sequences Length = 3446 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 1847 gctttgctttgctttgcttttttg 1870
>gb|AC154124.5| Mus musculus chromosome 5, clone RP24-63G13, complete sequence Length = 199573 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 91700 gctttgctttgcttttcttt 91719
>gb|AF123845.1|AF123845 Cabomba caroliniana photosystem II CP47 protein (psbB) gene, partial cds; photosystem II subunit (psbT) and photosystem II subunit (psbN) genes, complete cds; and photosystem II subunit (psbH) gene, chloroplast genes encoding chloroplast proteins, partial cds Length = 2161 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 1333 tttgctttgcttttcttttt 1352
>gb|AC007880.2| Homo sapiens BAC clone RP11-323F11 from 2, complete sequence Length = 122223 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 187 ctttgctttgcttttctttt 206 |||||||||||||||||||| Sbjct: 42817 ctttgctttgcttttctttt 42798
>ref|XM_221954.1| PREDICTED: Rattus norvegicus similar to slit homolog 1 (predicted) (LOC288512), mRNA Length = 2490 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 385 cttggggatgccctgcaggt 404 |||||||||||||||||||| Sbjct: 2327 cttggggatgccctgcaggt 2308
>ref|NM_175522.2| Mus musculus RIKEN cDNA A930017N06 gene (A930017N06Rik), mRNA Length = 3835 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 385 cttggggatgccctgcaggt 404 |||||||||||||||||||| Sbjct: 2677 cttggggatgccctgcaggt 2658
>gb|AC092573.2| Homo sapiens BAC clone RP11-1O7 from 2, complete sequence Length = 171265 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 189 ttgctttgcttttctttttt 208 |||||||||||||||||||| Sbjct: 7811 ttgctttgcttttctttttt 7792
>emb|BX537274.3| Zebrafish DNA sequence from clone DKEY-103L3 in linkage group 13, complete sequence Length = 151298 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 191 gctttgcttttcttttttgc 210 |||||||||||||||||||| Sbjct: 15041 gctttgcttttcttttttgc 15022
>dbj|AP005610.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0032M14 Length = 146636 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 38408 tttgctttgcttttcttttt 38427
>dbj|AP005192.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0485A07 Length = 166397 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 87919 tttgctttgcttttcttttt 87938
>gb|AC153612.6| Mus musculus 6 BAC RP23-435I4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 197401 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 148616 gctttgctttgctttgcttttttg 148639
>dbj|AB019228.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7 Length = 87090 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 gcttagctttccatgctgctgcat 107 |||||||||||| ||||||||||| Sbjct: 45850 gcttagctttccttgctgctgcat 45873
>emb|AL928707.5| Zebrafish DNA sequence from clone CH211-207M2 in linkage group 21, complete sequence Length = 206304 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 130426 gctttgctttgcttttcttt 130445
>gb|AE003798.3| Drosophila melanogaster chromosome 2R, section 52 of 73 of the complete sequence Length = 242365 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 16467 tttgctttgcttttcttttt 16448
>emb|AL355102.5|CNS05TCL Human chromosome 14 DNA sequence BAC R-404P21 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 201844 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 38152 gctttgctttgctttgcttttttg 38129
>gb|AC102250.10| Mus musculus chromosome 18, clone RP24-162I6, complete sequence Length = 185297 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 105286 gctttgctttgctttgcttttttg 105263
>gb|U22346.1|HSU22346 Human bradykinin B1 receptor (bradyb1) gene, complete cds Length = 4168 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 4059 gctttgctttgctttgcttttttg 4082
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 192 ctttgcttttcttttttgcgagga 215 |||| ||||||||||||||||||| Sbjct: 18718803 cttttcttttcttttttgcgagga 18718826
>gb|AC004429.1|AC004429 Drosophila melanogaster DNA sequence (P1 DS01552 (D182)), complete sequence Length = 51536 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 188 tttgctttgcttttcttttt 207 |||||||||||||||||||| Sbjct: 15042 tttgctttgcttttcttttt 15023
>emb|AL590442.1|CNS07EG9 chromosome II of strain GB-M1 of Encephalitozoon cuniculi (Microspora) Length = 197426 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 ctttgctttgcttttctttt 206 |||||||||||||||||||| Sbjct: 32096 ctttgctttgcttttctttt 32115
>emb|AL929038.13| Zebrafish DNA sequence from clone DKEY-34D20 in linkage group 20, complete sequence Length = 213980 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 157329 gctttgctttgcttttcttt 157310
>gb|AC131120.4| Mus musculus BAC clone RP24-547N4 from 10, complete sequence Length = 228657 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 79200 gctttgctttgctttgcttttttg 79223
>emb|CR974451.9| Mouse DNA sequence from clone RP24-180B11 on chromosome 17, complete sequence Length = 188873 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 159835 gctttgctttgcttttcttt 159854
>emb|AL732439.18| Mouse DNA sequence from clone RP23-361M1 on chromosome X, complete sequence Length = 140367 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 ctttgctttgcttttctttt 206 |||||||||||||||||||| Sbjct: 69508 ctttgctttgcttttctttt 69527
>gb|U48231.1|HSBDKRBI2 Human bradykinin B1 receptor gene (BDKRB1), gene, complete cds Length = 3332 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttttttg 209 ||||||||||||||| |||||||| Sbjct: 2790 gctttgctttgctttgcttttttg 2813
>gb|AC164564.3| Mus musculus BAC clone RP23-96N11 from chromosome 7, complete sequence Length = 247415 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttttttgcgag 213 ||||||||||||||| ||||||| |||| Sbjct: 144379 gctttgctttgctttgcttttttacgag 144352
>emb|AL611936.11| Mouse DNA sequence from clone RP23-40G2 on chromosome 4, complete sequence Length = 166167 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 274 atagtgatcaatttaattgg 293 |||||||||||||||||||| Sbjct: 58055 atagtgatcaatttaattgg 58074
>emb|AL627445.21| Mouse DNA sequence from clone RP23-81D2 on chromosome 11, complete sequence Length = 216303 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 185 agctttgctttgcttttctttttt 208 ||||||||||||||||| |||||| Sbjct: 62516 agctttgctttgcttttttttttt 62539
>emb|AL627214.15| Mouse DNA sequence from clone RP23-357K18 on chromosome 4, complete sequence Length = 182829 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 372 gcaggtgcccggccttgggg 391 |||||||||||||||||||| Sbjct: 137904 gcaggtgcccggccttgggg 137885
>gb|AC165139.11| Mus musculus chromosome 5, clone RP23-424H17, complete sequence Length = 176075 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 101555 gctttgctttgcttttcttt 101536
>gb|AC110196.9| Mus musculus chromosome 15, clone RP24-343E7, complete sequence Length = 154367 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 183 ccagctttgctttgcttttctttt 206 ||||||||||||| |||||||||| Sbjct: 16399 ccagctttgcttttcttttctttt 16376
>emb|AL606906.18| Mouse DNA sequence from clone RP23-121J14 on chromosome 4, complete sequence Length = 198772 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 gctttgctttgcttttcttt 205 |||||||||||||||||||| Sbjct: 184877 gctttgctttgcttttcttt 184896 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,220,383 Number of Sequences: 3902068 Number of extensions: 4220383 Number of successful extensions: 103503 Number of sequences better than 10.0: 181 Number of HSP's better than 10.0 without gapping: 181 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 102682 Number of HSP's gapped (non-prelim): 798 length of query: 405 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 383 effective length of database: 17,147,199,772 effective search space: 6567377512676 effective search space used: 6567377512676 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
