| Clone Name | rbaet92d09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC158208.2| Physcomitrella patens clone JGIASYB-1A9, complete sequence Length = 38977 Score = 44.1 bits (22), Expect = 0.16 Identities = 22/22 (100%) Strand = Plus / Plus Query: 36 tgataagcaacatcaattgaaa 57 |||||||||||||||||||||| Sbjct: 3753 tgataagcaacatcaattgaaa 3774
>gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome 19, complete sequence Length = 221043 Score = 44.1 bits (22), Expect = 0.16 Identities = 22/22 (100%) Strand = Plus / Plus Query: 164 cacatctttacatacattccat 185 |||||||||||||||||||||| Sbjct: 220427 cacatctttacatacattccat 220448
>gb|AC132402.3| Mus musculus BAC clone RP23-404I24 from chromosome 19, complete sequence Length = 217490 Score = 44.1 bits (22), Expect = 0.16 Identities = 22/22 (100%) Strand = Plus / Plus Query: 164 cacatctttacatacattccat 185 |||||||||||||||||||||| Sbjct: 107281 cacatctttacatacattccat 107302
>gb|BC054759.1| Mus musculus Cd200 antigen, mRNA (cDNA clone MGC:64783 IMAGE:6413363), complete cds Length = 2296 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 gagtagttcacatctttaca 175 |||||||||||||||||||| Sbjct: 1740 gagtagttcacatctttaca 1759
>gb|BC051984.1| Mus musculus Cd200 antigen, mRNA (cDNA clone MGC:62285 IMAGE:5707683), complete cds Length = 2235 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 gagtagttcacatctttaca 175 |||||||||||||||||||| Sbjct: 1725 gagtagttcacatctttaca 1744
>gb|AC117783.9| Mus musculus chromosome 16, clone RP24-544H3, complete sequence Length = 164296 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 gagtagttcacatctttaca 175 |||||||||||||||||||| Sbjct: 85433 gagtagttcacatctttaca 85414
>gb|AC117686.10| Mus musculus chromosome 16, clone RP23-440B15, complete sequence Length = 210851 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 gagtagttcacatctttaca 175 |||||||||||||||||||| Sbjct: 204296 gagtagttcacatctttaca 204277
>gb|AC102114.9| Mus musculus chromosome 10, clone RP23-139F20, complete sequence Length = 232173 Score = 40.1 bits (20), Expect = 2.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 94 acaaccacagctagaatcatcctc 117 |||||||||||||||||| ||||| Sbjct: 71465 acaaccacagctagaatcttcctc 71442
>dbj|AK148308.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched library, clone:G370085J18 product:antigen identified by monoclonal antibody MRC OX-2, full insert sequence Length = 2292 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 gagtagttcacatctttaca 175 |||||||||||||||||||| Sbjct: 1780 gagtagttcacatctttaca 1799
>gb|AC154441.3| Mus musculus BAC clone RP24-176O5 from chromosome 13, complete sequence Length = 169507 Score = 40.1 bits (20), Expect = 2.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 168 tctttacatacattccatcgcatt 191 |||||||||||||||||| ||||| Sbjct: 9823 tctttacatacattccatggcatt 9846
>gb|AF004023.1|AF004023 Mus musculus cell surface molecule OX-2 mRNA, complete cds Length = 2203 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 gagtagttcacatctttaca 175 |||||||||||||||||||| Sbjct: 1640 gagtagttcacatctttaca 1659
>ref|NM_010818.2| Mus musculus Cd200 antigen (Cd200), mRNA Length = 2203 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 gagtagttcacatctttaca 175 |||||||||||||||||||| Sbjct: 1640 gagtagttcacatctttaca 1659
>gb|AF029216.1|AF029216 Mus musculus MRC OX-2 antigen homolog mRNA, 3' UTR Length = 1356 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 gagtagttcacatctttaca 175 |||||||||||||||||||| Sbjct: 784 gagtagttcacatctttaca 803
>gb|AC153695.2| Mus musculus 10 BAC RP23-184L5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse 10 BAC Library) complete sequence Length = 209875 Score = 40.1 bits (20), Expect = 2.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 94 acaaccacagctagaatcatcctc 117 |||||||||||||||||| ||||| Sbjct: 91918 acaaccacagctagaatcttcctc 91941 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,334,186 Number of Sequences: 3902068 Number of extensions: 1334186 Number of successful extensions: 85905 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 85885 Number of HSP's gapped (non-prelim): 20 length of query: 201 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 179 effective length of database: 17,147,199,772 effective search space: 3069348759188 effective search space used: 3069348759188 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)