ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet91a10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.009
2dbj|AP002537.2| Oryza sativa (japonica cultivar-group) genomic D... 48 0.009
3dbj|AP003417.2| Oryza sativa (japonica cultivar-group) genomic D... 48 0.009
4gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 44 0.14
5gb|AC140949.1| Pan troglodytes BAC clone RP43-168N2 from 7, comp... 42 0.56
6gb|AF373870.1| Wolbachia endosymbiont of Brugia malayi clone 03K... 42 0.56
7emb|AL935049.19| Zebrafish DNA sequence from clone CH211-185K2 i... 42 0.56
8emb|AL928716.15| Zebrafish DNA sequence from clone DKEY-23K6 in ... 42 0.56
9gb|AE017321.1| Wolbachia endosymbiont strain TRS of Brugia malay... 42 0.56
10emb|BX571866.1| Photorhabdus luminescens subsp. laumondii TTO1 c... 40 2.2
11emb|BX649484.12| Zebrafish DNA sequence from clone CH211-197H24 ... 40 2.2
12gb|AC023263.4|AC023263 Homo sapiens, clone RP11-590E14, complete... 40 2.2
13gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chr... 40 2.2
14emb|BX005158.8| Zebrafish DNA sequence from clone DKEY-222N6 in ... 40 2.2
15gb|AE015927.1| Clostridium tetani E88, complete genome 40 2.2
16gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F... 40 2.2
17emb|BX323564.11| Zebrafish DNA sequence from clone DKEYP-1A11, c... 40 2.2
18ref|NM_001016277.2| Xenopus tropicalis hypothetical protein LOC5... 38 8.8
19gb|AC157610.2| Mus musculus chromosome 15, clone RP23-77H12, com... 38 8.8
20ref|NM_001040419.1| Macaca mulatta elongation of very long chain... 38 8.8
21gb|AC132577.3| Mus musculus BAC clone RP24-445H14 from chromosom... 38 8.8
22gb|AC145296.3| Mus musculus BAC clone RP24-404G7 from chromosome... 38 8.8
23gb|AC122408.4| Mus musculus BAC clone RP24-137E16 from chromosom... 38 8.8
24gb|AC134552.4| Mus musculus BAC clone RP24-279K10 from chromosom... 38 8.8
25gb|AC131781.3| Mus musculus BAC clone RP24-344J9 from chromosome... 38 8.8
26gb|AC145577.2| Mus musculus BAC clone RP24-382J15 from chromosom... 38 8.8
27gb|AC147549.4| Mus musculus BAC clone RP24-571D15 from chromosom... 38 8.8
28gb|DQ147003.1|DQ147002S2 Macaca mulatta elongation of very long ... 38 8.8
29gb|AC182424.4| Mus musculus BAC clone RP24-364J10 from chromosom... 38 8.8
30gb|AC185965.1| Mus musculus chromosome Y clone RP24-73D21, compl... 38 8.8
31gb|AC140203.2| Mus musculus BAC clone RP24-334J15 from chromosom... 38 8.8
32gb|AC134852.4| Mus musculus BAC clone RP24-248B6 from chromosome... 38 8.8
33gb|AC142255.3| Mus musculus BAC clone RP24-511N9 from chromosome... 38 8.8
34gb|AC132384.2| Mus musculus BAC clone RP23-438F16 from chromosom... 38 8.8
35emb|BX890603.17| Zebrafish DNA sequence from clone DKEYP-19G9 in... 38 8.8
36emb|CR376741.14| Zebrafish DNA sequence from clone DKEY-114B16 i... 38 8.8
37gb|AC151904.6| Mus musculus BAC clone RP23-233K6 from chromosome... 38 8.8
38emb|AL604028.15| Human DNA sequence from clone RP11-767N6 on chr... 38 8.8
39gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1... 38 8.8
40emb|AL356000.13| Human DNA sequence from clone RP11-296P7 on chr... 38 8.8
41gb|AC158495.2| Capitella capitata clone JGIAUTO-1A8, complete se... 38 8.8
42emb|BX511125.7| Zebrafish DNA sequence from clone DKEY-88H6 in l... 38 8.8
43emb|BX571838.9| Zebrafish DNA sequence from clone DKEY-205N7 in ... 38 8.8
44emb|AL807378.5| Zebrafish DNA sequence from clone CH211-215A18 i... 38 8.8
45emb|BX569799.6| Zebrafish DNA sequence from clone DKEY-10C21 in ... 38 8.8
46emb|BX294117.17| Zebrafish DNA sequence from clone CH211-270F13 ... 38 8.8
47gb|AC010248.7| Homo sapiens chromosome 5 clone CTC-406D13, compl... 38 8.8
48gb|AC109463.2| Homo sapiens chromosome 5 clone RP11-273E10, comp... 38 8.8
49gb|AC113418.2| Homo sapiens chromosome 5 clone RP11-574H6, compl... 38 8.8
50gb|AC069302.4| Homo sapiens BAC clone RP11-322J23 from 4, comple... 38 8.8
51gb|AC026427.4| Homo sapiens chromosome 5 clone CTD-2193P3, compl... 38 8.8
52emb|BX323854.9| Zebrafish DNA sequence from clone CH211-286C5 in... 38 8.8
53emb|BX649490.11| Zebrafish DNA sequence from clone DKEY-103K4 in... 38 8.8
54emb|BX537342.6| Zebrafish DNA sequence from clone CH211-198P11 i... 38 8.8
55gb|AC140922.3| Mus musculus BAC clone RP24-471B22 from chromosom... 38 8.8
56gb|AC174234.4| Mus musculus BAC clone RP24-50H9 from chromosome ... 38 8.8
57gb|AC020901.8|AC020901 Homo sapiens chromosome 5 clone CTC-527N1... 38 8.8
58emb|BX120015.12| Zebrafish DNA sequence from clone RP71-3A8 in l... 38 8.8
59gb|BC077495.1| Xenopus laevis general transcription factor IIB, ... 38 8.8
60gb|AC016757.10| Homo sapiens BAC clone RP11-526L8 from 2, comple... 38 8.8
61dbj|AB063100.1| Macaca fascicularis brain cDNA clone:QtrA-14469,... 38 8.8
62gb|AC151901.3| Mus musculus BAC clone RP23-271E15 from chromosom... 38 8.8
63gb|AC152453.4| Mus musculus BAC clone RP24-238B3 from chromosome... 38 8.8
64gb|AC116100.2| Dictyostelium discoideum chromosome 2 map 6163571... 38 8.8
65gb|AF077190.1|AF077190 Papilio glaucus rhodopsin (PglRh2) mRNA, ... 38 8.8
66gb|AC011737.10| Homo sapiens BAC clone RP11-33N4 from 2, complet... 38 8.8
67gb|AF461184.1|AF461183S2 Macaca fascicularis ELOVL4 (ELOVL4) gen... 38 8.8
68gb|AF461182.1| Macaca fascicularis ELOVL4 mRNA, complete cds 38 8.8
69gb|AC141474.4| Mus musculus BAC clone RP24-192L11 from chromosom... 38 8.8
70dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome 38 8.8
71emb|BX323038.3| Zebrafish DNA sequence from clone DKEYP-57D7 in ... 38 8.8
72emb|AL954387.17| Zebrafish DNA sequence from clone CH211-288B20 ... 38 8.8
73emb|AL929434.3| Zebrafish DNA sequence from clone CH211-127L15, ... 38 8.8
74emb|AL844186.7| Zebrafish DNA sequence from clone DKEY-265G24, c... 38 8.8
75emb|BX957275.7| Zebrafish DNA sequence from clone DKEY-220E22 in... 38 8.8
76emb|CR318631.5| Zebrafish DNA sequence from clone DKEY-207D5 in ... 38 8.8
77emb|BX649507.3| Zebrafish DNA sequence from clone CH211-154H20 i... 38 8.8
78emb|BX469928.8| Zebrafish DNA sequence from clone DKEYP-47C5 in ... 38 8.8
79emb|BX000347.7| Zebrafish DNA sequence from clone DKEY-66C4 in l... 38 8.8
80emb|CR931726.9| Zebrafish DNA sequence from clone DKEYP-38E8 in ... 38 8.8
81emb|AL591401.5| Zebrafish DNA sequence from clone BUSM1-175P12 i... 38 8.8
82emb|CT009559.20| Mouse DNA sequence from clone RP23-66A24 on chr... 38 8.8
83emb|CR761615.2| Xenopus tropicalis finished cDNA, clone TGas068f17 38 8.8
84emb|BX510915.23| Zebrafish DNA sequence from clone DKEY-24M12 in... 38 8.8
85emb|BX000465.12| Zebrafish DNA sequence from clone DKEY-30A6 in ... 38 8.8
86emb|AL929224.16| Zebrafish DNA sequence from clone CH211-232P9 i... 38 8.8
87gb|AC134865.3| Mus musculus BAC clone RP24-158I3 from Y, complet... 38 8.8
88gb|AC144854.3| Mus musculus BAC clone RP24-216J19 from Y, comple... 38 8.8
89emb|AL691469.9| Mouse DNA sequence from clone RP23-248F18 on chr... 38 8.8 
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 84      aatccccaaattgtacttgcacta 107
               ||||||||||||||||||||||||
Sbjct: 5130701 aatccccaaattgtacttgcacta 5130724
to top
>dbj|AP002537.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0001B06
          Length = 140304

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 84     aatccccaaattgtacttgcacta 107
              ||||||||||||||||||||||||
Sbjct: 124139 aatccccaaattgtacttgcacta 124162
to top
>dbj|AP003417.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0498B01
          Length = 146812

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 84    aatccccaaattgtacttgcacta 107
             ||||||||||||||||||||||||
Sbjct: 62732 aatccccaaattgtacttgcacta 62755
to top
>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 74      taagcaaaacaatccccaaatt 95
               ||||||||||||||||||||||
Sbjct: 1194103 taagcaaaacaatccccaaatt 1194124
to top
>gb|AC140949.1| Pan troglodytes BAC clone RP43-168N2 from 7, complete sequence
          Length = 193777

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 66     tacaaagttaagcaaaacaat 86
              |||||||||||||||||||||
Sbjct: 117996 tacaaagttaagcaaaacaat 117976
to top
>gb|AF373870.1| Wolbachia endosymbiont of Brugia malayi clone 03K15 sequence
          Length = 63116

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 152   ggaaaaaatattaaccaaata 172
             |||||||||||||||||||||
Sbjct: 22826 ggaaaaaatattaaccaaata 22846
to top
>emb|AL935049.19| Zebrafish DNA sequence from clone CH211-185K2 in linkage group 20,
              complete sequence
          Length = 148715

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 73     ttaagcaaaacaatccccaaa 93
              |||||||||||||||||||||
Sbjct: 102695 ttaagcaaaacaatccccaaa 102675
to top
>emb|AL928716.15| Zebrafish DNA sequence from clone DKEY-23K6 in linkage group 20, complete
              sequence
          Length = 246647

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 73     ttaagcaaaacaatccccaaa 93
              |||||||||||||||||||||
Sbjct: 110432 ttaagcaaaacaatccccaaa 110452
to top
>gb|AE017321.1| Wolbachia endosymbiont strain TRS of Brugia malayi, complete genome
          Length = 1080084

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 152    ggaaaaaatattaaccaaata 172
              |||||||||||||||||||||
Sbjct: 479754 ggaaaaaatattaaccaaata 479734
to top
>emb|BX571866.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
              8/17
          Length = 349652

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 143    agaaaatagggaaaaaatat 162
              ||||||||||||||||||||
Sbjct: 239591 agaaaatagggaaaaaatat 239610
to top
>emb|BX649484.12| Zebrafish DNA sequence from clone CH211-197H24 in linkage group 16,
              complete sequence
          Length = 196058

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 141    gtagaaaatagggaaaaaatatta 164
              |||||| |||||||||||||||||
Sbjct: 169607 gtagaatatagggaaaaaatatta 169584
to top
>gb|AC023263.4|AC023263 Homo sapiens, clone RP11-590E14, complete sequence
          Length = 174176

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 156    aaaatattaaccaaatagta 175
              ||||||||||||||||||||
Sbjct: 120075 aaaatattaaccaaatagta 120094
to top
>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete
              sequence
          Length = 4332241

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 66     tacaaagttaagcaaaacaa 85
              ||||||||||||||||||||
Sbjct: 388725 tacaaagttaagcaaaacaa 388706
to top
>emb|BX005158.8| Zebrafish DNA sequence from clone DKEY-222N6 in linkage group 8,
             complete sequence
          Length = 74638

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 143   agaaaatagggaaaaaatat 162
             ||||||||||||||||||||
Sbjct: 48176 agaaaatagggaaaaaatat 48157
to top
>gb|AE015927.1| Clostridium tetani E88, complete genome
          Length = 2799251

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    aaaatagggaaaaaatatta 164
              ||||||||||||||||||||
Sbjct: 156798 aaaatagggaaaaaatatta 156817
to top
>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130,
              chromosome I, complete sequence
          Length = 4277185

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 66     tacaaagttaagcaaaacaa 85
              ||||||||||||||||||||
Sbjct: 387644 tacaaagttaagcaaaacaa 387625
to top
>emb|BX323564.11| Zebrafish DNA sequence from clone DKEYP-1A11, complete sequence
          Length = 160017

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 136   gaaccgtagaaaatagggaaaaaa 159
             |||||||| |||||||||||||||
Sbjct: 57197 gaaccgtataaaatagggaaaaaa 57220
to top
>ref|NM_001016277.2| Xenopus tropicalis hypothetical protein LOC549031 (LOC549031), mRNA
          Length = 1740

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   tacaaagttaagcaaaaca 84
            |||||||||||||||||||
Sbjct: 1607 tacaaagttaagcaaaaca 1589
to top
>gb|AC157610.2| Mus musculus chromosome 15, clone RP23-77H12, complete sequence
          Length = 164913

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 154    aaaaaatattaaccaaata 172
              |||||||||||||||||||
Sbjct: 112919 aaaaaatattaaccaaata 112937
to top
>ref|NM_001040419.1| Macaca mulatta elongation of very long chain fatty acids-like 4
           (ELOVL4), mRNA
          Length = 2958

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 69  aaagttaagcaaaacaatccccaaatt 95
           ||||||||||||||| ||||| |||||
Sbjct: 529 aaagttaagcaaaaccatcccaaaatt 503
to top
>gb|AC132577.3| Mus musculus BAC clone RP24-445H14 from chromosome Y, complete sequence
          Length = 175639

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 154   aaaaaatattaaccaaata 172
             |||||||||||||||||||
Sbjct: 89028 aaaaaatattaaccaaata 89046
to top
>gb|AC145296.3| Mus musculus BAC clone RP24-404G7 from chromosome Y, complete sequence
          Length = 183159

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 154    aaaaaatattaaccaaata 172
              |||||||||||||||||||
Sbjct: 132019 aaaaaatattaaccaaata 132037
to top
>gb|AC122408.4| Mus musculus BAC clone RP24-137E16 from chromosome 10, complete
             sequence
          Length = 131580

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 67    acaaagttaagcaaaacaa 85
             |||||||||||||||||||
Sbjct: 87622 acaaagttaagcaaaacaa 87604



 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 67    acaaagttaagcaaaacaa 85
             |||||||||||||||||||
Sbjct: 29004 acaaagttaagcaaaacaa 29022
to top
>gb|AC134552.4| Mus musculus BAC clone RP24-279K10 from chromosome 8, complete sequence
          Length = 154774

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 150   agggaaaaaatattaaccaaata 172
             ||||||||||||||||| |||||
Sbjct: 68371 agggaaaaaatattaacaaaata 68349
to top
>gb|AC131781.3| Mus musculus BAC clone RP24-344J9 from chromosome 15, complete sequence
          Length = 139338

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 154    aaaaaatattaaccaaata 172
              |||||||||||||||||||
Sbjct: 128060 aaaaaatattaaccaaata 128078
to top
>gb|AC145577.2| Mus musculus BAC clone RP24-382J15 from chromosome Y, complete sequence
          Length = 223903

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 154   aaaaaatattaaccaaata 172
             |||||||||||||||||||
Sbjct: 59341 aaaaaatattaaccaaata 59359
to top
>gb|AC147549.4| Mus musculus BAC clone RP24-571D15 from chromosome Y, complete sequence
          Length = 165378

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 154   aaaaaatattaaccaaata 172
             |||||||||||||||||||
Sbjct: 51887 aaaaaatattaaccaaata 51869
to top
>gb|DQ147003.1|DQ147002S2 Macaca mulatta elongation of very long chain fatty acids 4 protein
           (ELOVL4) gene, exon 2
          Length = 393

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 69  aaagttaagcaaaacaatccccaaatt 95
           ||||||||||||||| ||||| |||||
Sbjct: 325 aaagttaagcaaaaccatcccaaaatt 299
to top
>gb|AC182424.4| Mus musculus BAC clone RP24-364J10 from chromosome y, complete sequence
          Length = 153116

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 154   aaaaaatattaaccaaata 172
             |||||||||||||||||||
Sbjct: 59681 aaaaaatattaaccaaata 59663
to top
>gb|AC185965.1| Mus musculus chromosome Y clone RP24-73D21, complete sequence
          Length = 188373

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 154    aaaaaatattaaccaaata 172
              |||||||||||||||||||
Sbjct: 145080 aaaaaatattaaccaaata 145098
to top
>gb|AC140203.2| Mus musculus BAC clone RP24-334J15 from chromosome Y, complete sequence
          Length = 159604

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 154    aaaaaatattaaccaaata 172
              |||||||||||||||||||
Sbjct: 151834 aaaaaatattaaccaaata 151852
to top
>gb|AC134852.4| Mus musculus BAC clone RP24-248B6 from chromosome Y, complete sequence
          Length = 186637

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 154   aaaaaatattaaccaaata 172
             |||||||||||||||||||
Sbjct: 81277 aaaaaatattaaccaaata 81295
to top
>gb|AC142255.3| Mus musculus BAC clone RP24-511N9 from chromosome Y, complete sequence
          Length = 149721

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 154   aaaaaatattaaccaaata 172
             |||||||||||||||||||
Sbjct: 63472 aaaaaatattaaccaaata 63454
to top
>gb|AC132384.2| Mus musculus BAC clone RP23-438F16 from chromosome 10, complete sequence
          Length = 182097

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 67     acaaagttaagcaaaacaa 85
              |||||||||||||||||||
Sbjct: 138283 acaaagttaagcaaaacaa 138301
to top
>emb|BX890603.17| Zebrafish DNA sequence from clone DKEYP-19G9 in linkage group 23,
              complete sequence
          Length = 184711

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 143    agaaaatagggaaaaaata 161
              |||||||||||||||||||
Sbjct: 100037 agaaaatagggaaaaaata 100019
to top
>emb|CR376741.14| Zebrafish DNA sequence from clone DKEY-114B16 in linkage group 8,
             complete sequence
          Length = 166048

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 46098 agaaaatagggaaaaaata 46116
to top
>gb|AC151904.6| Mus musculus BAC clone RP23-233K6 from chromosome 10, complete sequence
          Length = 186667

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 67     acaaagttaagcaaaacaa 85
              |||||||||||||||||||
Sbjct: 165749 acaaagttaagcaaaacaa 165767
to top
>emb|AL604028.15| Human DNA sequence from clone RP11-767N6 on chromosome 1 Contains the
             gene for a novel protein (SP192) (DKFZp434H1428,
             FLJ21319), a ribosomal protein S15a (RPS15A) pseudogene, a
             ribosomal protein L7a (RPL7A) pseudogene, the gene for a
             novel protein (FLJ21029) and one CpG island, complete
             sequence
          Length = 82964

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 141   gtagaaaatagggaaaaaa 159
             |||||||||||||||||||
Sbjct: 55997 gtagaaaatagggaaaaaa 56015
to top
>gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1 of 8 of the complete
              sequence
          Length = 250743

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 154    aaaaaatattaaccaaata 172
              |||||||||||||||||||
Sbjct: 248461 aaaaaatattaaccaaata 248479
to top
>emb|AL356000.13| Human DNA sequence from clone RP11-296P7 on chromosome 9 Contains a
             proteasome (prosome, macropain) 26S subunit, ATPase, 3
             (PSMC3) (TBP1) pseudogene, the 3' end of a novel gene
             similar to mouse RIKEN cDNA 4930500O09 gene, the gene for 
             Ras-related GTP-binding protein (RAGA) (FIP-1), the 3' end
             of a novel gene (FLJ20060) (contains FLJ2902, KIAA1574)
             and a CpG island, complete sequence
          Length = 89177

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    agcaaaacaatccccaaat 94
             |||||||||||||||||||
Sbjct: 39295 agcaaaacaatccccaaat 39313
to top
>gb|AC158495.2| Capitella capitata clone JGIAUTO-1A8, complete sequence
          Length = 42314

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 83    caatccccaaattgtactt 101
             |||||||||||||||||||
Sbjct: 40528 caatccccaaattgtactt 40546
to top
>emb|BX511125.7| Zebrafish DNA sequence from clone DKEY-88H6 in linkage group 7,
             complete sequence
          Length = 86562

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 48841 agaaaatagggaaaaaata 48859
to top
>emb|BX571838.9| Zebrafish DNA sequence from clone DKEY-205N7 in linkage group 13,
              complete sequence
          Length = 124398

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 143    agaaaatagggaaaaaata 161
              |||||||||||||||||||
Sbjct: 114867 agaaaatagggaaaaaata 114885
to top
>emb|AL807378.5| Zebrafish DNA sequence from clone CH211-215A18 in linkage group 7
             Contains three CpG islands, complete sequence
          Length = 198700

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 147   aatagggaaaaaatattaa 165
             |||||||||||||||||||
Sbjct: 34846 aatagggaaaaaatattaa 34864
to top
>emb|BX569799.6| Zebrafish DNA sequence from clone DKEY-10C21 in linkage group 24,
             complete sequence
          Length = 56631

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 154   aaaaaatattaaccaaata 172
             |||||||||||||||||||
Sbjct: 14670 aaaaaatattaaccaaata 14688
to top
>emb|BX294117.17| Zebrafish DNA sequence from clone CH211-270F13 in linkage group 8,
              complete sequence
          Length = 114534

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 143    agaaaatagggaaaaaata 161
              |||||||||||||||||||
Sbjct: 100341 agaaaatagggaaaaaata 100323
to top
>gb|AC010248.7| Homo sapiens chromosome 5 clone CTC-406D13, complete sequence
          Length = 29501

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 147   aatagggaaaaaatattaa 165
             |||||||||||||||||||
Sbjct: 12355 aatagggaaaaaatattaa 12373
to top
>gb|AC109463.2| Homo sapiens chromosome 5 clone RP11-273E10, complete sequence
          Length = 23936

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 143 agaaaatagggaaaaaata 161
           |||||||||||||||||||
Sbjct: 862 agaaaatagggaaaaaata 880
to top
>gb|AC113418.2| Homo sapiens chromosome 5 clone RP11-574H6, complete sequence
          Length = 182740

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 143    agaaaatagggaaaaaata 161
              |||||||||||||||||||
Sbjct: 170711 agaaaatagggaaaaaata 170729
to top
>gb|AC069302.4| Homo sapiens BAC clone RP11-322J23 from 4, complete sequence
          Length = 178780

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     aaacaatccccaaattgta 98
              |||||||||||||||||||
Sbjct: 148800 aaacaatccccaaattgta 148782
to top
>gb|AC026427.4| Homo sapiens chromosome 5 clone CTD-2193P3, complete sequence
          Length = 175838

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 147   aatagggaaaaaatattaa 165
             |||||||||||||||||||
Sbjct: 69373 aatagggaaaaaatattaa 69391
to top
>emb|BX323854.9| Zebrafish DNA sequence from clone CH211-286C5 in linkage group 24,
             complete sequence
          Length = 161864

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 80846 agaaaatagggaaaaaata 80828
to top
>emb|BX649490.11| Zebrafish DNA sequence from clone DKEY-103K4 in linkage group 22,
             complete sequence
          Length = 150534

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 35679 agaaaatagggaaaaaata 35661
to top
>emb|BX537342.6| Zebrafish DNA sequence from clone CH211-198P11 in linkage group 3,
             complete sequence
          Length = 195436

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 78856 agaaaatagggaaaaaata 78874
to top
>gb|AC140922.3| Mus musculus BAC clone RP24-471B22 from chromosome y, complete
            sequence
          Length = 194152

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 154  aaaaaatattaaccaaata 172
            |||||||||||||||||||
Sbjct: 7980 aaaaaatattaaccaaata 7962
to top
>gb|AC174234.4| Mus musculus BAC clone RP24-50H9 from chromosome y, complete sequence
          Length = 200919

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 154    aaaaaatattaaccaaata 172
              |||||||||||||||||||
Sbjct: 103055 aaaaaatattaaccaaata 103073
to top
>gb|AC020901.8|AC020901 Homo sapiens chromosome 5 clone CTC-527N11, complete sequence
          Length = 180636

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 147    aatagggaaaaaatattaa 165
              |||||||||||||||||||
Sbjct: 177627 aatagggaaaaaatattaa 177645
to top
>emb|BX120015.12| Zebrafish DNA sequence from clone RP71-3A8 in linkage group 7, complete
             sequence
          Length = 156089

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 72862 agaaaatagggaaaaaata 72880
to top
>gb|BC077495.1| Xenopus laevis general transcription factor IIB, mRNA (cDNA clone
            MGC:82605 IMAGE:5047331), complete cds
          Length = 1682

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   tacaaagttaagcaaaaca 84
            |||||||||||||||||||
Sbjct: 1559 tacaaagttaagcaaaaca 1541
to top
>gb|AC016757.10| Homo sapiens BAC clone RP11-526L8 from 2, complete sequence
          Length = 158170

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 144  gaaaatagggaaaaaatat 162
            |||||||||||||||||||
Sbjct: 4318 gaaaatagggaaaaaatat 4336
to top
>dbj|AB063100.1| Macaca fascicularis brain cDNA clone:QtrA-14469, similar to human
           elongation of very long chain fatty acids (ELOVL4),
           mRNA, NM_022726.2
          Length = 3072

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 69  aaagttaagcaaaacaatccccaaatt 95
           ||||||||||||||| ||||| |||||
Sbjct: 539 aaagttaagcaaaaccatcccaaaatt 513
to top
>gb|AC151901.3| Mus musculus BAC clone RP23-271E15 from chromosome 10, complete sequence
          Length = 182748

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 67     acaaagttaagcaaaacaa 85
              |||||||||||||||||||
Sbjct: 175622 acaaagttaagcaaaacaa 175604



 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 67     acaaagttaagcaaaacaa 85
              |||||||||||||||||||
Sbjct: 117004 acaaagttaagcaaaacaa 117022
to top
>gb|AC152453.4| Mus musculus BAC clone RP24-238B3 from chromosome 10, complete sequence
          Length = 182371

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 67     acaaagttaagcaaaacaa 85
              |||||||||||||||||||
Sbjct: 169111 acaaagttaagcaaaacaa 169093
to top
>gb|AC116100.2| Dictyostelium discoideum chromosome 2 map 6163571-6199719 strain AX4,
            complete sequence
          Length = 36148

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 154  aaaaaatattaaccaaata 172
            |||||||||||||||||||
Sbjct: 7892 aaaaaatattaaccaaata 7910
to top
>gb|AF077190.1|AF077190 Papilio glaucus rhodopsin (PglRh2) mRNA, complete cds
          Length = 1747

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 154  aaaaaatattaaccaaata 172
            |||||||||||||||||||
Sbjct: 1595 aaaaaatattaaccaaata 1613
to top
>gb|AC011737.10| Homo sapiens BAC clone RP11-33N4 from 2, complete sequence
          Length = 176709

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 157   aaatattaaccaaatagta 175
             |||||||||||||||||||
Sbjct: 98265 aaatattaaccaaatagta 98247
to top
>gb|AF461184.1|AF461183S2 Macaca fascicularis ELOVL4 (ELOVL4) gene, exons 2 and 3
          Length = 2018

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 69  aaagttaagcaaaacaatccccaaatt 95
           ||||||||||||||| ||||| |||||
Sbjct: 630 aaagttaagcaaaaccatcccaaaatt 604
to top
>gb|AF461182.1| Macaca fascicularis ELOVL4 mRNA, complete cds
          Length = 2871

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 69  aaagttaagcaaaacaatccccaaatt 95
           ||||||||||||||| ||||| |||||
Sbjct: 404 aaagttaagcaaaaccatcccaaaatt 378
to top
>gb|AC141474.4| Mus musculus BAC clone RP24-192L11 from chromosome y, complete sequence
          Length = 178464

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 154    aaaaaatattaaccaaata 172
              |||||||||||||||||||
Sbjct: 158529 aaaaaatattaaccaaata 158511
to top
>dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome
          Length = 1358633

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 155     aaaaatattaaccaaatag 173
               |||||||||||||||||||
Sbjct: 1299832 aaaaatattaaccaaatag 1299850



 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 155    aaaaatattaaccaaatag 173
              |||||||||||||||||||
Sbjct: 720023 aaaaatattaaccaaatag 720041



 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 155    aaaaatattaaccaaatag 173
              |||||||||||||||||||
Sbjct: 682455 aaaaatattaaccaaatag 682437



 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 155    aaaaatattaaccaaatag 173
              |||||||||||||||||||
Sbjct: 677334 aaaaatattaaccaaatag 677352



 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 155    aaaaatattaaccaaatag 173
              |||||||||||||||||||
Sbjct: 625720 aaaaatattaaccaaatag 625702



 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 155    aaaaatattaaccaaatag 173
              |||||||||||||||||||
Sbjct: 152103 aaaaatattaaccaaatag 152085
to top
>emb|BX323038.3| Zebrafish DNA sequence from clone DKEYP-57D7 in linkage group 1,
            complete sequence
          Length = 87548

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 141  gtagaaaatagggaaaaaa 159
            |||||||||||||||||||
Sbjct: 5378 gtagaaaatagggaaaaaa 5396
to top
>emb|AL954387.17| Zebrafish DNA sequence from clone CH211-288B20 in linkage group 18,
             complete sequence
          Length = 125744

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 61956 agaaaatagggaaaaaata 61938
to top
>emb|AL929434.3| Zebrafish DNA sequence from clone CH211-127L15, complete sequence
          Length = 178948

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 67216 agaaaatagggaaaaaata 67198
to top
>emb|AL844186.7| Zebrafish DNA sequence from clone DKEY-265G24, complete sequence
          Length = 221158

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 152   ggaaaaaatattaaccaaa 170
             |||||||||||||||||||
Sbjct: 62198 ggaaaaaatattaaccaaa 62216
to top
>emb|BX957275.7| Zebrafish DNA sequence from clone DKEY-220E22 in linkage group 20,
             complete sequence
          Length = 57535

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 26566 agaaaatagggaaaaaata 26548
to top
>emb|CR318631.5| Zebrafish DNA sequence from clone DKEY-207D5 in linkage group 18,
              complete sequence
          Length = 189711

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 143    agaaaatagggaaaaaata 161
              |||||||||||||||||||
Sbjct: 126037 agaaaatagggaaaaaata 126055
to top
>emb|BX649507.3| Zebrafish DNA sequence from clone CH211-154H20 in linkage group 18,
             complete sequence
          Length = 166185

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 28915 agaaaatagggaaaaaata 28897
to top
>emb|BX469928.8| Zebrafish DNA sequence from clone DKEYP-47C5 in linkage group 22,
              complete sequence
          Length = 141594

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 143    agaaaatagggaaaaaata 161
              |||||||||||||||||||
Sbjct: 134305 agaaaatagggaaaaaata 134287
to top
>emb|BX000347.7| Zebrafish DNA sequence from clone DKEY-66C4 in linkage group 18,
             complete sequence
          Length = 155713

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 38964 agaaaatagggaaaaaata 38946
to top
>emb|CR931726.9| Zebrafish DNA sequence from clone DKEYP-38E8 in linkage group 11,
             complete sequence
          Length = 131097

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 76    agcaaaacaatccccaaat 94
             |||||||||||||||||||
Sbjct: 38193 agcaaaacaatccccaaat 38175
to top
>emb|AL591401.5| Zebrafish DNA sequence from clone BUSM1-175P12 in linkage group 7,
             complete sequence
          Length = 84068

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 41933 agaaaatagggaaaaaata 41951
to top
>emb|CT009559.20| Mouse DNA sequence from clone RP23-66A24 on chromosome 14, complete
             sequence
          Length = 78271

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 19593 agaaaatagggaaaaaata 19611
to top
>emb|CR761615.2| Xenopus tropicalis finished cDNA, clone TGas068f17
          Length = 1740

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   tacaaagttaagcaaaaca 84
            |||||||||||||||||||
Sbjct: 1607 tacaaagttaagcaaaaca 1589
to top
>emb|BX510915.23| Zebrafish DNA sequence from clone DKEY-24M12 in linkage group 21,
              complete sequence
          Length = 253718

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 143    agaaaatagggaaaaaata 161
              |||||||||||||||||||
Sbjct: 192141 agaaaatagggaaaaaata 192159
to top
>emb|BX000465.12| Zebrafish DNA sequence from clone DKEY-30A6 in linkage group 22,
             complete sequence
          Length = 214999

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 143   agaaaatagggaaaaaata 161
             |||||||||||||||||||
Sbjct: 26975 agaaaatagggaaaaaata 26957
to top
>emb|AL929224.16| Zebrafish DNA sequence from clone CH211-232P9 in linkage group 21,
              complete sequence
          Length = 176879

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 143    agaaaatagggaaaaaata 161
              |||||||||||||||||||
Sbjct: 175180 agaaaatagggaaaaaata 175162
to top
>gb|AC134865.3| Mus musculus BAC clone RP24-158I3 from Y, complete sequence
          Length = 159846

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 154   aaaaaatattaaccaaata 172
             |||||||||||||||||||
Sbjct: 78275 aaaaaatattaaccaaata 78257
to top
>gb|AC144854.3| Mus musculus BAC clone RP24-216J19 from Y, complete sequence
          Length = 144593

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 154   aaaaaatattaaccaaata 172
             |||||||||||||||||||
Sbjct: 80814 aaaaaatattaaccaaata 80832
to top
>emb|AL691469.9| Mouse DNA sequence from clone RP23-248F18 on chromosome 2, complete
              sequence
          Length = 191923

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 36     cagttacacattcaaatag 54
              |||||||||||||||||||
Sbjct: 137714 cagttacacattcaaatag 137732


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,504,337
Number of Sequences: 3902068
Number of extensions: 1504337
Number of successful extensions: 113079
Number of sequences better than 10.0: 89
Number of HSP's better than 10.0 without gapping: 89
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 112573
Number of HSP's gapped (non-prelim): 506
length of query: 179
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 157
effective length of database: 17,147,199,772
effective search space: 2692110364204
effective search space used: 2692110364204
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top