ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet79f04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_481582.1| Oryza sativa (japonica cultivar-group), mRNA 62 1e-06
2ref|XM_507190.1| PREDICTED Oryza sativa (japonica cultivar-group... 62 1e-06
3dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 62 1e-06
4dbj|AP004554.3| Oryza sativa (japonica cultivar-group) genomic D... 62 1e-06
5dbj|AP004661.3| Oryza sativa (japonica cultivar-group) genomic D... 62 1e-06
6dbj|AK119591.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 1e-06
7dbj|AK119590.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 1e-06
8dbj|AK104404.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 1e-06
9dbj|AK068096.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 1e-06
10gb|AC169371.2| Sorghum bicolor clone SB_BBc0127F08, complete seq... 52 0.001
11gb|AY105746.1| Zea mays PCO099975 mRNA sequence 50 0.004
12ref|XM_712839.1| Candida albicans SC5314 hypothetical protein (C... 48 0.016
13ref|XM_712773.1| Candida albicans SC5314 hypothetical protein (C... 48 0.016
14ref|XM_695273.1| PREDICTED: Danio rerio similar to OMA1 homolog,... 44 0.25
15gb|AC158990.2| Mus musculus BAC clone RP23-416E18 from chromosom... 42 1.0
16emb|CT009717.9| Mouse DNA sequence from clone RP23-216H9 on chro... 42 1.0
17gb|AC152718.6| Mus musculus BAC clone RP24-432B3 from chromosome... 42 1.0
18emb|AL672195.9| Mouse DNA sequence from clone RP23-468E16 on chr... 42 1.0
19emb|AL844204.3| Mouse DNA sequence from clone RP23-189N15 on chr... 42 1.0
20gb|AC164094.5| Mus musculus BAC clone RP23-133F10 from chromosom... 40 4.0
21gb|AC159431.1| Trypanosoma brucei chromosome 8 clone RPCI93-28F1... 40 4.0
22gb|AC119406.6| Trypanosoma brucei chromosome 8 clone RPCI93-28L1... 40 4.0
23gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence 40 4.0
24gb|AC150635.4| Bos taurus BAC CH240-448P19 (Children's Hospital... 40 4.0
25gb|AC121889.3| Mus musculus BAC clone RP24-146D9 from chromosome... 40 4.0
26gb|AY232206.1| Drosophila yakuba clone yak-ad_CG10472 mRNA sequence 40 4.0
27gb|AC164408.4| Mus musculus chromosome 3, clone RP23-384A11, com... 40 4.0
28emb|AL590395.4| Human DNA sequence from clone RP11-390H11 on chr... 40 4.0
29emb|AL118523.18|HSJ1031J8 Human DNA sequence from clone RP5-1031... 40 4.0
30emb|AL096708.34|HS1179L24 Human DNA sequence from clone RP5-1179... 40 4.0
31gb|AC161207.4| Mus musculus chromosome 1, clone RP23-66G23, comp... 40 4.0
32gb|AC155332.10| Mus musculus 6 BAC RP24-140J8 (Roswell Park Canc... 40 4.0
33gb|AC119840.12| Mus musculus chromosome 3, clone RP24-112E5, com... 40 4.0
34gb|AC161237.8| Mus musculus chromosome 3, clone RP23-307M9, comp... 40 4.0
35gb|AF407166.1| Homo sapiens PKC-potentiated PP1 inhibitory prote... 40 4.0
36gb|AC158672.6| Mus musculus 6 BAC RP23-64J23 (Roswell Park Cance... 40 4.0
37gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 4.0
38gb|AC156284.8| Mus musculus 6 BAC RP24-392D13 (Roswell Park Canc... 40 4.0
39gb|AC093884.4| Homo sapiens BAC clone RP11-660K21 from 2, comple... 40 4.0
40gb|AC140334.3| Mus musculus BAC clone RP23-244J7 from chromosome... 40 4.0
41gb|AC114558.18| Mus musculus chromosome 8, clone RP23-47G19, com... 40 4.0
42gb|AC153855.4| Mus musculus 6 BAC RP23-175B24 (Roswell Park Canc... 40 4.0
43gb|U34198.1|HVU34198 Hordeum vulgare high affinity nitrate trans... 40 4.0
44emb|BX255949.3| Zebrafish DNA sequence from clone DKEY-76F5 in l... 40 4.0
45gb|AC132606.3| Mus musculus BAC clone RP23-434H18 from 8, comple... 40 4.0
46emb|AL607129.16| Mouse DNA sequence from clone RP23-120H2 on chr... 40 4.0

>ref|XM_481582.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1684

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 71   cattgaccactatcattacaaaatgatcatcacaa 105
            ||||||||||||||||||||||||||||| |||||
Sbjct: 1662 cattgaccactatcattacaaaatgatcaccacaa 1628



to top

>ref|XM_507190.1| PREDICTED Oryza sativa (japonica cultivar-group), P0005C02.108 mRNA
          Length = 1759

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 71   cattgaccactatcattacaaaatgatcatcacaa 105
            ||||||||||||||||||||||||||||| |||||
Sbjct: 1705 cattgaccactatcattacaaaatgatcaccacaa 1671



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                   
Query: 71       cattgaccactatcattacaaaatgatcatcacaa 105
                ||||||||||||||||||||||||||||| |||||
Sbjct: 13977938 cattgaccactatcattacaaaatgatcaccacaa 13977972



to top

>dbj|AP004554.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0005C02
          Length = 62423

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                
Query: 71    cattgaccactatcattacaaaatgatcatcacaa 105
             ||||||||||||||||||||||||||||| |||||
Sbjct: 32261 cattgaccactatcattacaaaatgatcaccacaa 32295



to top

>dbj|AP004661.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
            clone:P0048E12
          Length = 152543

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                               
Query: 71   cattgaccactatcattacaaaatgatcatcacaa 105
            ||||||||||||||||||||||||||||| |||||
Sbjct: 9829 cattgaccactatcattacaaaatgatcaccacaa 9863



to top

>dbj|AK119591.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-D04, full
            insert sequence
          Length = 1666

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 71   cattgaccactatcattacaaaatgatcatcacaa 105
            ||||||||||||||||||||||||||||| |||||
Sbjct: 1644 cattgaccactatcattacaaaatgatcaccacaa 1610



to top

>dbj|AK119590.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-D03, full
            insert sequence
          Length = 1725

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 71   cattgaccactatcattacaaaatgatcatcacaa 105
            ||||||||||||||||||||||||||||| |||||
Sbjct: 1667 cattgaccactatcattacaaaatgatcaccacaa 1633



to top

>dbj|AK104404.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C07, full
            insert sequence
          Length = 1682

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 71   cattgaccactatcattacaaaatgatcatcacaa 105
            ||||||||||||||||||||||||||||| |||||
Sbjct: 1660 cattgaccactatcattacaaaatgatcaccacaa 1626



to top

>dbj|AK068096.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013134F13, full
            insert sequence
          Length = 1759

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 71   cattgaccactatcattacaaaatgatcatcacaa 105
            ||||||||||||||||||||||||||||| |||||
Sbjct: 1705 cattgaccactatcattacaaaatgatcaccacaa 1671



to top

>gb|AC169371.2| Sorghum bicolor clone SB_BBc0127F08, complete sequence
          Length = 70712

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                               
Query: 72    attgaccactatcattacaaaatgatcatcacaa 105
             |||| ||||||||||||||||||||||| |||||
Sbjct: 28962 attggccactatcattacaaaatgatcaccacaa 28929



to top

>gb|AY105746.1| Zea mays PCO099975 mRNA sequence
          Length = 1421

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 70   ccattgaccactatcattacaaaatgatcatcacaac 106
            |||||| |||||| |||||||||||||||| ||||||
Sbjct: 1303 ccattggccactaccattacaaaatgatcaccacaac 1267



to top

>ref|XM_712839.1| Candida albicans SC5314 hypothetical protein (CaO19_3241), mRNA
          Length = 4254

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 250  cctgttcacacaccttatcaagct 273
            ||||||||||||||||||||||||
Sbjct: 3292 cctgttcacacaccttatcaagct 3315



to top

>ref|XM_712773.1| Candida albicans SC5314 hypothetical protein (CaO19_10751), mRNA
          Length = 4254

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 250  cctgttcacacaccttatcaagct 273
            ||||||||||||||||||||||||
Sbjct: 3292 cctgttcacacaccttatcaagct 3315



to top

>ref|XM_695273.1| PREDICTED: Danio rerio similar to OMA1 homolog, zinc
           metallopeptidase (LOC571665), partial mRNA
          Length = 1048

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 277 agtgccagcgccgacgccacggccac 302
           ||||||||||||||||||||| ||||
Sbjct: 358 agtgccagcgccgacgccacgaccac 333



to top

>gb|AC158990.2| Mus musculus BAC clone RP23-416E18 from chromosome 13, complete sequence
          Length = 191036

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 120    ttcctgtcttttcccttcttt 140
              |||||||||||||||||||||
Sbjct: 122740 ttcctgtcttttcccttcttt 122760



to top

>emb|CT009717.9| Mouse DNA sequence from clone RP23-216H9 on chromosome 13, complete
              sequence
          Length = 220233

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 120    ttcctgtcttttcccttcttt 140
              |||||||||||||||||||||
Sbjct: 186939 ttcctgtcttttcccttcttt 186919



to top

>gb|AC152718.6| Mus musculus BAC clone RP24-432B3 from chromosome 9, complete sequence
          Length = 174264

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 126   tcttttcccttctttttcctt 146
             |||||||||||||||||||||
Sbjct: 10726 tcttttcccttctttttcctt 10746



to top

>emb|AL672195.9| Mouse DNA sequence from clone RP23-468E16 on chromosome 9, complete
              sequence
          Length = 182503

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 126    tcttttcccttctttttcctt 146
              |||||||||||||||||||||
Sbjct: 101739 tcttttcccttctttttcctt 101719



to top

>emb|AL844204.3| Mouse DNA sequence from clone RP23-189N15 on chromosome 2, complete
             sequence
          Length = 162981

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 126   tcttttcccttctttttcctt 146
             |||||||||||||||||||||
Sbjct: 45502 tcttttcccttctttttcctt 45482



to top

>gb|AC164094.5| Mus musculus BAC clone RP23-133F10 from chromosome 6, complete sequence
          Length = 216271

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    cttttcccttctttttcctt 146
              ||||||||||||||||||||
Sbjct: 124450 cttttcccttctttttcctt 124469



 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   cttttcccttctttttcctt 146
             ||||||||||||||||||||
Sbjct: 17151 cttttcccttctttttcctt 17170



to top

>gb|AC159431.1| Trypanosoma brucei chromosome 8 clone RPCI93-28F14, complete sequence
          Length = 132418

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    cttttcccttctttttcctt 146
              ||||||||||||||||||||
Sbjct: 129069 cttttcccttctttttcctt 129050



to top

>gb|AC119406.6| Trypanosoma brucei chromosome 8 clone RPCI93-28L1, complete sequence
          Length = 134874

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   cttttcccttctttttcctt 146
             ||||||||||||||||||||
Sbjct: 23311 cttttcccttctttttcctt 23292



to top

>gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence
          Length = 2481190

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    cttttcccttctttttcctt 146
              ||||||||||||||||||||
Sbjct: 950318 cttttcccttctttttcctt 950299



to top

>gb|AC150635.4| Bos taurus  BAC CH240-448P19 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 151766

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 85     attacaaaatgatcatcacaacaa 108
              ||||||||||||||| ||||||||
Sbjct: 127137 attacaaaatgatcaccacaacaa 127160



to top

>gb|AC121889.3| Mus musculus BAC clone RP24-146D9 from chromosome 1, complete sequence
          Length = 160207

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 123    ctgtcttttcccttcttttt 142
              ||||||||||||||||||||
Sbjct: 120843 ctgtcttttcccttcttttt 120862



to top

>gb|AY232206.1| Drosophila yakuba clone yak-ad_CG10472 mRNA sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 263 cttatcaagctgccagtgcc 282
           ||||||||||||||||||||
Sbjct: 421 cttatcaagctgccagtgcc 440



to top

>gb|AC164408.4| Mus musculus chromosome 3, clone RP23-384A11, complete sequence
          Length = 202604

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    cttttcccttctttttcctt 146
              ||||||||||||||||||||
Sbjct: 118362 cttttcccttctttttcctt 118381



to top

>emb|AL590395.4| Human DNA sequence from clone RP11-390H11 on chromosome 6, complete
              sequence
          Length = 154747

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 84     cattacaaaatgatcatcac 103
              ||||||||||||||||||||
Sbjct: 100897 cattacaaaatgatcatcac 100916



to top

>emb|AL118523.18|HSJ1031J8 Human DNA sequence from clone RP5-1031J8 on chromosome 20 Contains a
              putative novel gene, STSs and GSSs, complete sequence
          Length = 155213

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    tcttttcccttctttttcct 145
              ||||||||||||||||||||
Sbjct: 142520 tcttttcccttctttttcct 142501



to top

>emb|AL096708.34|HS1179L24 Human DNA sequence from clone RP5-1179L24 on chromosome 6q24.3-25.3
             Contains the PPP1R14C gene for protein phosphatase 1
             regulatory (inhibitor) subunit 14C (KEPI NY-BR-81
             CPI17-like), complete sequence
          Length = 107104

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   ttcctgtcttttcccttctt 139
             ||||||||||||||||||||
Sbjct: 37619 ttcctgtcttttcccttctt 37638



to top

>gb|AC161207.4| Mus musculus chromosome 1, clone RP23-66G23, complete sequence
          Length = 197037

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 123    ctgtcttttcccttcttttt 142
              ||||||||||||||||||||
Sbjct: 136128 ctgtcttttcccttcttttt 136109



to top

>gb|AC155332.10| Mus musculus 6 BAC RP24-140J8 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 202181

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 127    cttttcccttctttttccttgagg 150
              ||||||||||||||| ||||||||
Sbjct: 143209 cttttcccttcttttaccttgagg 143186



to top

>gb|AC119840.12| Mus musculus chromosome 3, clone RP24-112E5, complete sequence
          Length = 206159

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   cttttcccttctttttcctt 146
             ||||||||||||||||||||
Sbjct: 79842 cttttcccttctttttcctt 79861



to top

>gb|AC161237.8| Mus musculus chromosome 3, clone RP23-307M9, complete sequence
          Length = 206004

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    cttttcccttctttttcctt 146
              ||||||||||||||||||||
Sbjct: 118767 cttttcccttctttttcctt 118748



to top

>gb|AF407166.1| Homo sapiens PKC-potentiated PP1 inhibitory protein (KEPI) gene,
             complete cds
          Length = 168856

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   ttcctgtcttttcccttctt 139
             ||||||||||||||||||||
Sbjct: 99371 ttcctgtcttttcccttctt 99390



to top

>gb|AC158672.6| Mus musculus 6 BAC RP23-64J23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 216954

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 127    cttttcccttctttttccttgagg 150
              ||||||||||||||| ||||||||
Sbjct: 196138 cttttcccttcttttaccttgagg 196115



 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 127   cttttcccttctttttccttgagg 150
             ||||||||||||||| ||||||||
Sbjct: 37224 cttttcccttcttttaccttgagg 37201



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 130     ttcccttctttttccttgag 149
               ||||||||||||||||||||
Sbjct: 2511742 ttcccttctttttccttgag 2511761



to top

>gb|AC156284.8| Mus musculus 6 BAC RP24-392D13 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 182146

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 127   cttttcccttctttttccttgagg 150
             ||||||||||||||| ||||||||
Sbjct: 13332 cttttcccttcttttaccttgagg 13309



to top

>gb|AC093884.4| Homo sapiens BAC clone RP11-660K21 from 2, complete sequence
          Length = 105087

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 82    atcattacaaaatgatcatc 101
             ||||||||||||||||||||
Sbjct: 34323 atcattacaaaatgatcatc 34342



to top

>gb|AC140334.3| Mus musculus BAC clone RP23-244J7 from chromosome 6, complete sequence
          Length = 192598

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    cttttcccttctttttcctt 146
              ||||||||||||||||||||
Sbjct: 142750 cttttcccttctttttcctt 142731



 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   cttttcccttctttttcctt 146
             ||||||||||||||||||||
Sbjct: 25526 cttttcccttctttttcctt 25507



to top

>gb|AC114558.18| Mus musculus chromosome 8, clone RP23-47G19, complete sequence
          Length = 262311

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    cttttcccttctttttcctt 146
              ||||||||||||||||||||
Sbjct: 139070 cttttcccttctttttcctt 139089



 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    cttttcccttctttttcctt 146
              ||||||||||||||||||||
Sbjct: 138755 cttttcccttctttttcctt 138774



 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    cttttcccttctttttcctt 146
              ||||||||||||||||||||
Sbjct: 138723 cttttcccttctttttcctt 138742



to top

>gb|AC153855.4| Mus musculus 6 BAC RP23-175B24 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 183070

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 127  cttttcccttctttttccttgagg 150
            ||||||||||||||| ||||||||
Sbjct: 2580 cttttcccttcttttaccttgagg 2557



to top

>gb|U34198.1|HVU34198 Hordeum vulgare high affinity nitrate transporter homolog BCH1 mRNA,
            complete cds
          Length = 1837

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 279  tgccagcgccgacgccacgg 298
            ||||||||||||||||||||
Sbjct: 1431 tgccagcgccgacgccacgg 1450



to top

>emb|BX255949.3| Zebrafish DNA sequence from clone DKEY-76F5 in linkage group 2, complete
              sequence
          Length = 214484

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 156    cagcagtaataaatacgaatgaaa 179
              ||||||||||||| ||||||||||
Sbjct: 125553 cagcagtaataaacacgaatgaaa 125530



to top

>gb|AC132606.3| Mus musculus BAC clone RP23-434H18 from 8, complete sequence
          Length = 215743

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    cttttcccttctttttcctt 146
              ||||||||||||||||||||
Sbjct: 184906 cttttcccttctttttcctt 184925



to top

>emb|AL607129.16| Mouse DNA sequence from clone RP23-120H2 on chromosome 4, complete
             sequence
          Length = 76465

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 229   agaactcagcacaaaaacac 248
             ||||||||||||||||||||
Sbjct: 44778 agaactcagcacaaaaacac 44759


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,092,233
Number of Sequences: 3902068
Number of extensions: 3092233
Number of successful extensions: 70386
Number of sequences better than 10.0: 46
Number of HSP's better than 10.0 without gapping: 46
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70220
Number of HSP's gapped (non-prelim): 166
length of query: 302
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 280
effective length of database: 17,147,199,772
effective search space: 4801215936160
effective search space used: 4801215936160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top