>gb|AC158340.9| Mus musculus chromosome 1, clone RP24-161N8, complete sequence
          Length = 163123

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 87    aagaaaactatagaactaaa 106
             ||||||||||||||||||||
Sbjct: 77376 aagaaaactatagaactaaa 77357

>gb|AC102781.5| Mus musculus chromosome 1, clone RP23-271G2, complete sequence
          Length = 198393

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 87     aagaaaactatagaactaaa 106
              ||||||||||||||||||||
Sbjct: 172173 aagaaaactatagaactaaa 172192

>gb|BC082919.1| Xenopus laevis similar to nucleobindin 1, mRNA (cDNA clone
           MGC:85482 IMAGE:6938506), complete cds
          Length = 1719

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 142 actccatctccatttgtat 160
           |||||||||||||||||||
Sbjct: 843 actccatctccatttgtat 825

>gb|AC150593.2| Bos taurus  BAC CH240-105D16 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 151783

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 124   acacagtatcactaattta 142
             |||||||||||||||||||
Sbjct: 51769 acacagtatcactaattta 51751

>gb|AY679523.1| Homo sapiens cell division cycle 2-like 5 (cholinesterase-related cell
             division controller) (CDC2L5) gene, complete cds
          Length = 148952

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 131   atcactaatttactccatc 149
             |||||||||||||||||||
Sbjct: 45954 atcactaatttactccatc 45936

>gb|AC072061.8| Homo sapiens BAC clone RP11-467D6 from 7, complete sequence
          Length = 167852

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 131    atcactaatttactccatc 149
              |||||||||||||||||||
Sbjct: 128148 atcactaatttactccatc 128130

>gb|AC127252.3| Mus musculus BAC clone RP24-276A6 from chromosome 3, complete sequence
          Length = 173199

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 70     tagtcatggctggcccgaa 88
              |||||||||||||||||||
Sbjct: 167578 tagtcatggctggcccgaa 167596

>gb|AC124202.3| Mus musculus BAC clone RP23-337F21 from chromosome 14, complete sequence
          Length = 189556

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      acaaacacctctcttcaag 19
              |||||||||||||||||||
Sbjct: 137312 acaaacacctctcttcaag 137294

>emb|AL391384.18| Human DNA sequence from clone RP11-555G22 on chromosome 13 Contains the
              5' end of the gene for mitotic control protein
              (DIS3,KIAA1008), the 5' end of the gene for
              progesterone-induced blocking factor 1 (PIBF1) and a CpG
              island, complete sequence
          Length = 155270

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 85     cgaagaaaactatagaact 103
              |||||||||||||||||||
Sbjct: 114522 cgaagaaaactatagaact 114540

>gb|AC158747.3| Mus musculus chromosome 15, clone RP24-248P22, complete sequence
          Length = 156293

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 136   taatttactccatctccat 154
             |||||||||||||||||||
Sbjct: 91171 taatttactccatctccat 91189

>gb|AC092656.1| Homo sapiens BAC clone RP11-455G16 from 4, complete sequence
          Length = 191840

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 125   cacagtatcactaatttac 143
             |||||||||||||||||||
Sbjct: 18029 cacagtatcactaatttac 18047

>gb|AC011853.7| Homo sapiens chromosome 8, clone RP11-403D15, complete sequence
          Length = 171541

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 142    actccatctccatttgtat 160
              |||||||||||||||||||
Sbjct: 139635 actccatctccatttgtat 139617

>gb|AC158989.1| Mus musculus BAC clone RP23-399H20 from chromosome 3, complete sequence
          Length = 190372

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 70     tagtcatggctggcccgaa 88
              |||||||||||||||||||
Sbjct: 135919 tagtcatggctggcccgaa 135901

>gb|AC105969.17| Mus musculus chromosome 15, clone RP23-477B23, complete sequence
          Length = 189238

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 136   taatttactccatctccat 154
             |||||||||||||||||||
Sbjct: 40096 taatttactccatctccat 40078

>gb|AC150033.2| Mus musculus BAC clone RP23-449N19 from 3, complete sequence
          Length = 179293

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 70    tagtcatggctggcccgaa 88
             |||||||||||||||||||
Sbjct: 63200 tagtcatggctggcccgaa 63218

>emb|AL596456.15| Mouse DNA sequence from clone RP23-353K20 on chromosome 11, complete
              sequence
          Length = 228428

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 3      aaacacctctcttcaagttgctc 25
              ||||||||| |||||||||||||
Sbjct: 177089 aaacacctcccttcaagttgctc 177111

>gb|AY500153.1| Mycobacteriophage Bethlehem, complete genome
          Length = 52250

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 76    tggctggcccgaagaaaac 94
             |||||||||||||||||||
Sbjct: 32779 tggctggcccgaagaaaac 32761

>gb|AY500152.1| Mycobacteriophage U2, complete genome
          Length = 51277

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 76    tggctggcccgaagaaaac 94
             |||||||||||||||||||
Sbjct: 32124 tggctggcccgaagaaaac 32106

>emb|AL606988.16| Mouse DNA sequence from clone RP23-35A4 on chromosome 4, complete
              sequence
          Length = 160100

 Score = 38.2 bits (19), Expect = 7.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 90     aaaactatagaactaaagt 108
              |||||||||||||||||||
Sbjct: 138505 aaaactatagaactaaagt 138487


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,090,415
Number of Sequences: 3902068
Number of extensions: 1090415
Number of successful extensions: 70311
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70275
Number of HSP's gapped (non-prelim): 36
length of query: 164
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 142
effective length of database: 17,147,199,772
effective search space: 2434902367624
effective search space used: 2434902367624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)