>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score = 56.0 bits (28), Expect = 4e-06
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 3    aacaatagtcttttgcattcaaccctcgtactttac 38
            ||||| |||||||||||||||||| |||||||||||
Sbjct: 1011 aacaacagtcttttgcattcaaccttcgtactttac 976

>gb|AC136372.13| Mus musculus chromosome 15, clone RP23-232G24, complete sequence
          Length = 201204

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 2     aaacaatagtcttttgcattca 23
             ||||||||| ||||||||||||
Sbjct: 26058 aaacaatagccttttgcattca 26079

>gb|AC138715.3| Mus musculus BAC clone RP23-283E23 from chromosome 15, complete
             sequence
          Length = 164806

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 2     aaacaatagtcttttgcattca 23
             ||||||||| ||||||||||||
Sbjct: 64966 aaacaatagccttttgcattca 64945

>emb|AL356285.9| Human DNA sequence from clone RP11-569O4 on chromosome 13 Contains the
             5' end of the XPO4 gene for likely ortholog of mouse
             exportin 4, a CCR4-NOT transcription complex, subunit 4
             (CNOT4) (NOT4, NOT4H, CLONE243) pseudogene, a
             heterogeneous nuclear ribonucleoprotein A1
             (HNRPA1)(HNRNPA1) pseudogene, a pseudogene similar to part
             of peptidylprolyl isomerase A (cyclophilin A) (PPIA), a
             Laminin receptor 1 (67kD, ribosomal protein
             SA)(LAMR1)(LRP, p40, RPSA, 37LRP, LAMBR) pseudogene, the
             3' end of the LATS2 gene for LATS, large tumor suppressor,
             homolog 2 (LATS (large tumor suppressor, Drosophila)
             homolog 2), two novel genes and three CpG islands,
             complete sequence
          Length = 183597

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 7     atagtcttttgcattcaa 24
             ||||||||||||||||||
Sbjct: 39579 atagtcttttgcattcaa 39562

>gb|AC158755.6| Mus musculus chromosome 1, clone RP23-461O16, complete sequence
          Length = 224116

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 2      aaacaatagtcttttgcattca 23
              |||| |||||||||||||||||
Sbjct: 121047 aaactatagtcttttgcattca 121068

>dbj|AK126800.1| Homo sapiens cDNA FLJ44850 fis, clone BRACE3051722
          Length = 4213

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 8    tagtcttttgcattcaaccctc 29
            ||||| ||||||||||||||||
Sbjct: 2762 tagtcctttgcattcaaccctc 2783

>ref|XM_942230.1| PREDICTED: Homo sapiens hypothetical protein LOC650072 (LOC650072),
            mRNA
          Length = 4237

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 8    tagtcttttgcattcaaccctc 29
            ||||| ||||||||||||||||
Sbjct: 2792 tagtcctttgcattcaaccctc 2813

>ref|XM_930340.1| PREDICTED: Homo sapiens hypothetical protein LOC644804 (LOC644804),
            mRNA
          Length = 4237

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 8    tagtcttttgcattcaaccctc 29
            ||||| ||||||||||||||||
Sbjct: 2792 tagtcctttgcattcaaccctc 2813

>gb|AC012370.8| Homo sapiens BAC clone RP11-568D19 from 2, complete sequence
          Length = 105362

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 8     tagtcttttgcattcaaccctc 29
             ||||| ||||||||||||||||
Sbjct: 27695 tagtcctttgcattcaaccctc 27674

>gb|AC099344.4| Homo sapiens BAC clone RP11-427E2 from 2, complete sequence
          Length = 135598

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 8     tagtcttttgcattcaac 25
             ||||||||||||||||||
Sbjct: 31167 tagtcttttgcattcaac 31150

>gb|AC007653.5|AC007653 Homo sapiens chromosome , clone RP11-51A1, complete sequence
          Length = 159926

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 5    caatagtcttttgcattc 22
            ||||||||||||||||||
Sbjct: 7138 caatagtcttttgcattc 7155

>gb|AC092939.8| Homo sapiens 3 BAC RP11-791G22 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 167152

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      caatagtcttttgcattc 22
              ||||||||||||||||||
Sbjct: 135933 caatagtcttttgcattc 135950

>emb|AL928895.5| Mouse DNA sequence from clone RP23-338J3 on chromosome 2, complete
             sequence
          Length = 120507

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 2     aaacaatagtcttttgca 19
             ||||||||||||||||||
Sbjct: 47149 aaacaatagtcttttgca 47166


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 233,751
Number of Sequences: 3902068
Number of extensions: 233751
Number of successful extensions: 68768
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68747
Number of HSP's gapped (non-prelim): 21
length of query: 38
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 18
effective length of database: 17,155,003,908
effective search space: 308790070344
effective search space used: 308790070344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)