ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet79d09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|M61146.1|BLYPSAL Hordeum vulgare photosystem I protein (PSI-L... 248 3e-63
2dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.095
3emb|AL662939.4|OSJN00143 Oryza sativa genomic DNA, chromosome 4,... 44 0.095
4emb|AL663018.4|OSJN00219 Oryza sativa genomic DNA, chromosome 4,... 44 0.095
5gb|DP000012.1| Macropus eugenii target 1 genomic scaffold 42 0.38
6gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chr... 42 0.38
7gb|AC145409.3| Macropus eugenii clone ME_KBa-528O13, complete se... 42 0.38
8gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F... 42 0.38
9gb|AC132454.3| Mus musculus BAC clone RP23-127P22 from chromosom... 40 1.5
10gb|AC124513.3| Mus musculus BAC clone RP23-448C3 from chromosome... 40 1.5
11emb|AL731538.4| Human DNA sequence from clone RP11-457G5 on chro... 40 1.5
12dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.5
13dbj|AP002843.2| Oryza sativa (japonica cultivar-group) genomic D... 40 1.5
14gb|AC022002.5| Homo sapiens chromosome 3 clone RP11-198P17 map 3... 40 1.5
15gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 38 5.9
16gb|AC145405.3| Gorilla gorilla gorilla clone CH255-421A19, compl... 38 5.9
17gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 38 5.9
18gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 38 5.9
19gb|AC000111.1| Homo sapiens BAC clone CTB-68P20 from 7, complete... 38 5.9
20gb|AY296710.1| Castianeira sp. MCH-2003 16S ribosomal RNA and tR... 38 5.9
21gb|AC129202.3| Mus musculus BAC clone RP24-225J1 from chromosome... 38 5.9
22gb|AC126678.3| Mus musculus BAC clone RP24-231D7 from chromosome... 38 5.9
23gb|CP000001.1| Bacillus cereus E33L, complete genome 38 5.9
24emb|AL445668.10| Human DNA sequence from clone RP11-234O23 on ch... 38 5.9
25emb|AL137181.8| Human DNA sequence from clone RP1-23O21 on chrom... 38 5.9
26emb|BX890572.9| Zebrafish DNA sequence from clone CH211-234F20 i... 38 5.9
27emb|AL591481.5| Zebrafish DNA sequence from clone BUSM1-101L20 i... 38 5.9
28emb|AL592550.11| Zebrafish DNA sequence from clone BUSM1-18F12 i... 38 5.9
29emb|BX908384.15| Zebrafish DNA sequence from clone DKEY-38K3 in ... 38 5.9
30gb|AC107300.6| Homo sapiens 3 BAC RP11-516H5 (Roswell Park Cance... 38 5.9
31emb|BX649403.4| Zebrafish DNA sequence from clone CH211-153M11 i... 38 5.9
32gb|AC093500.2| Drosophila melanogaster 3L BAC RP98-29P5 (Roswell... 38 5.9
33gb|AC010716.4| Drosophila melanogaster 3L BAC RP98-11A21 (Roswel... 38 5.9
34gb|DQ388145.1| Homo sapiens isolate cftr13838_B cystic fibrosis ... 38 5.9
35gb|DQ388144.1| Homo sapiens isolate cftr13838_A cystic fibrosis ... 38 5.9
36gb|DQ388143.1| Homo sapiens isolate cftr11589_B cystic fibrosis ... 38 5.9
37gb|DQ388141.1| Homo sapiens isolate cftr11521_B cystic fibrosis ... 38 5.9
38gb|DQ388140.1| Homo sapiens isolate cftr11521_A cystic fibrosis ... 38 5.9
39gb|DQ388139.1| Homo sapiens isolate cftr11376_B cystic fibrosis ... 38 5.9
40gb|DQ388138.1| Homo sapiens isolate cftr11376_A cystic fibrosis ... 38 5.9
41gb|DQ388135.1| Homo sapiens isolate cftr11321_B cystic fibrosis ... 38 5.9
42gb|DQ388134.1| Homo sapiens isolate cftr11321_A cystic fibrosis ... 38 5.9
43gb|DQ388137.1| Homo sapiens isolate cftr11373_B cystic fibrosis ... 38 5.9
44gb|DQ388133.1| Homo sapiens isolate cftr10976_B cystic fibrosis ... 38 5.9
45gb|DQ388132.1| Homo sapiens isolate cftr10976_A cystic fibrosis ... 38 5.9
46gb|DQ388131.1| Homo sapiens isolate cftr10543_B cystic fibrosis ... 38 5.9
47gb|DQ388130.1| Homo sapiens isolate cftr10543_A cystic fibrosis ... 38 5.9
48gb|DQ388129.1| Homo sapiens isolate cftr10540_B cystic fibrosis ... 38 5.9
49gb|DQ388128.1| Homo sapiens isolate cftr10540_A cystic fibrosis ... 38 5.9
50gb|AC166600.4| Nomascus leucogenys leucogenys clone CH271-368I9,... 38 5.9
51gb|DQ356264.1| Homo sapiens isolate cftr14672_B cystic fibrosis ... 38 5.9
52gb|DQ356263.1| Homo sapiens isolate cftr14672_A cystic fibrosis ... 38 5.9
53gb|DQ356262.1| Homo sapiens isolate cftr14663_B cystic fibrosis ... 38 5.9
54gb|DQ356261.1| Homo sapiens isolate cftr14663_A cystic fibrosis ... 38 5.9
55gb|DQ356260.1| Homo sapiens isolate cftr10975_B cystic fibrosis ... 38 5.9
56gb|DQ356259.1| Homo sapiens isolate cftr10975_A cystic fibrosis ... 38 5.9
57gb|DQ356258.1| Homo sapiens isolate cftr10471_B cystic fibrosis ... 38 5.9
58gb|DQ356257.1| Homo sapiens isolate cftr10471_A cystic fibrosis ... 38 5.9
59gb|DP000025.1| Gorilla gorilla gorilla target 1 genomic scaffold 38 5.9
60gb|DP000026.1| Pongo pygmaeus target 1 genomic scaffold 38 5.9
61gb|AC116957.2| Dictyostelium discoideum chromosome 2 map 1685067... 38 5.9
62gb|DQ354391.1| Homo sapiens isolate cftr01814_B cystic fibrosis ... 38 5.9
63gb|DQ354390.1| Homo sapiens isolate cftr01814_A cystic fibrosis ... 38 5.9
64gb|DQ354389.1| Homo sapiens isolate cftr14683_B cystic fibrosis ... 38 5.9
65gb|DQ354388.1| Homo sapiens isolate cftr14683_A cystic fibrosis ... 38 5.9
66gb|AC156989.3| Mus musculus chromosome 1, clone RP23-379L2, comp... 38 5.9
67emb|AL391262.3|CNS06C86 Human chromosome 14 DNA sequence BAC R-8... 38 5.9
68gb|AF042062.1|AF042062 Mycosphaerella graminicola succinate dehy... 38 5.9
69gb|AE003564.3| Drosophila melanogaster chromosome 3L, section 21... 38 5.9
70gb|AC004664.1|AC004664 Homo sapiens chromosome 4 clone C0500H20 ... 38 5.9
71emb|AL117694.5|CNS01DRQ Human chromosome 14 DNA sequence BAC R-2... 38 5.9
72gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 38 5.9
73gb|AC147437.2| Gallus gallus BAC clone CH261-80L21 from chromoso... 38 5.9
74gb|AC147639.3| Mus musculus BAC clone RP23-115M6 from 13, comple... 38 5.9
75emb|AL935175.6| Mouse DNA sequence from clone RP23-397E13 on chr... 38 5.9 
>gb|M61146.1|BLYPSAL Hordeum vulgare photosystem I protein (PSI-L) mRNA, complete cds
          Length = 777

 Score =  248 bits (125), Expect = 3e-63
 Identities = 125/125 (100%)
 Strand = Plus / Minus

                                                                       
Query: 2   ttttttatgaggaatatgtaaaaattcatttatacatagaagactcgttcaggcaaccac 61
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 776 ttttttatgaggaatatgtaaaaattcatttatacatagaagactcgttcaggcaaccac 717

                                                                       
Query: 62  cgagaagagatggcatgatctggagacatcgtacatgcatgccacctattaatctacttg 121
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 716 cgagaagagatggcatgatctggagacatcgtacatgcatgccacctattaatctacttg 657

                
Query: 122 aagaa 126
           |||||
Sbjct: 656 aagaa 652
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 44.1 bits (22), Expect = 0.095
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 23      aaattcatttatacatagaaga 44
               ||||||||||||||||||||||
Sbjct: 5987801 aaattcatttatacatagaaga 5987780
to top
>emb|AL662939.4|OSJN00143 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0013J13,
             complete sequence
          Length = 137572

 Score = 44.1 bits (22), Expect = 0.095
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 23    aaattcatttatacatagaaga 44
             ||||||||||||||||||||||
Sbjct: 11198 aaattcatttatacatagaaga 11177
to top
>emb|AL663018.4|OSJN00219 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0045O17,
              complete sequence
          Length = 137981

 Score = 44.1 bits (22), Expect = 0.095
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 23     aaattcatttatacatagaaga 44
              ||||||||||||||||||||||
Sbjct: 131038 aaattcatttatacatagaaga 131017
to top
>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold
          Length = 1996640

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 15    atatgtaaaaattcatttata 35
             |||||||||||||||||||||
Sbjct: 41414 atatgtaaaaattcatttata 41394
to top
>gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chromosome I, complete
               sequence
          Length = 4332241

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 5       tttatgaggaatatgtaaaaa 25
               |||||||||||||||||||||
Sbjct: 4009296 tttatgaggaatatgtaaaaa 4009316
to top
>gb|AC145409.3| Macropus eugenii clone ME_KBa-528O13, complete sequence
          Length = 140426

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 15    atatgtaaaaattcatttata 35
             |||||||||||||||||||||
Sbjct: 41414 atatgtaaaaattcatttata 41394
to top
>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome
               I, complete sequence
          Length = 4277185

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 5       tttatgaggaatatgtaaaaa 25
               |||||||||||||||||||||
Sbjct: 3949709 tttatgaggaatatgtaaaaa 3949729
to top
>gb|AC132454.3| Mus musculus BAC clone RP23-127P22 from chromosome 19, complete sequence
          Length = 225152

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 20     taaaaattcatttatacatagaag 43
              ||||||||||||||| ||||||||
Sbjct: 218092 taaaaattcatttatccatagaag 218069
to top
>gb|AC124513.3| Mus musculus BAC clone RP23-448C3 from chromosome 19, complete sequence
          Length = 202236

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 20    taaaaattcatttatacatagaag 43
             ||||||||||||||| ||||||||
Sbjct: 11868 taaaaattcatttatccatagaag 11845
to top
>emb|AL731538.4| Human DNA sequence from clone RP11-457G5 on chromosome 10 Contains part
             of the gene for alpha-catenin-like protein (MGC26194)
             (VR22), complete sequence
          Length = 163119

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     tatgaggaatatgtaaaaat 26
             ||||||||||||||||||||
Sbjct: 64642 tatgaggaatatgtaaaaat 64661
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 8        atgaggaatatgtaaaaatt 27
                ||||||||||||||||||||
Sbjct: 24723095 atgaggaatatgtaaaaatt 24723114
to top
>dbj|AP002843.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0407B12
          Length = 148762

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     atgaggaatatgtaaaaatt 27
             ||||||||||||||||||||
Sbjct: 91672 atgaggaatatgtaaaaatt 91691
to top
>gb|AC022002.5| Homo sapiens chromosome 3 clone RP11-198P17 map 3p, complete sequence
          Length = 189097

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 90    tcgtacatgcatgccaccta 109
             ||||||||||||||||||||
Sbjct: 81350 tcgtacatgcatgccaccta 81369
to top
>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 17      atgtaaaaattcatttata 35
               |||||||||||||||||||
Sbjct: 4055085 atgtaaaaattcatttata 4055103



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 6       ttatgaggaatatgtaaaa 24
               |||||||||||||||||||
Sbjct: 1463465 ttatgaggaatatgtaaaa 1463483
to top
>gb|AC145405.3| Gorilla gorilla gorilla clone CH255-421A19, complete sequence
          Length = 179099

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                             
Query: 2      ttttttatgaggaatatgtaaaaattcattt 32
              |||| ||||| ||||||| ||||||||||||
Sbjct: 176133 ttttctatgatgaatatggaaaaattcattt 176163
to top
>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 17      atgtaaaaattcatttata 35
               |||||||||||||||||||
Sbjct: 4067251 atgtaaaaattcatttata 4067269



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 6       ttatgaggaatatgtaaaa 24
               |||||||||||||||||||
Sbjct: 1439129 ttatgaggaatatgtaaaa 1439147
to top
>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 17      atgtaaaaattcatttata 35
               |||||||||||||||||||
Sbjct: 4067624 atgtaaaaattcatttata 4067642



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 6       ttatgaggaatatgtaaaa 24
               |||||||||||||||||||
Sbjct: 1439075 ttatgaggaatatgtaaaa 1439093
to top
>gb|AC000111.1| Homo sapiens BAC clone CTB-68P20 from 7, complete sequence
          Length = 149554

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 58990 ttttctatgatgaatatggaaaaattcattt 59020
to top
>gb|AY296710.1| Castianeira sp. MCH-2003 16S ribosomal RNA and tRNA-Leu genes,
           partial sequence; mitochondrial genes for mitochondrial
           products
          Length = 596

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 17  atgtaaaaattcatttata 35
           |||||||||||||||||||
Sbjct: 147 atgtaaaaattcatttata 165
to top
>gb|AC129202.3| Mus musculus BAC clone RP24-225J1 from chromosome 13, complete sequence
          Length = 168558

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 16     tatgtaaaaattcatttatacat 38
              ||||||||||||||| |||||||
Sbjct: 150499 tatgtaaaaattcatgtatacat 150477
to top
>gb|AC126678.3| Mus musculus BAC clone RP24-231D7 from chromosome 13, complete sequence
          Length = 150512

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 16    tatgtaaaaattcatttatacat 38
             ||||||||||||||| |||||||
Sbjct: 20967 tatgtaaaaattcatgtatacat 20945
to top
>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 17      atgtaaaaattcatttata 35
               |||||||||||||||||||
Sbjct: 4109312 atgtaaaaattcatttata 4109330



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 6       ttatgaggaatatgtaaaa 24
               |||||||||||||||||||
Sbjct: 1474082 ttatgaggaatatgtaaaa 1474100
to top
>emb|AL445668.10| Human DNA sequence from clone RP11-234O23 on chromosome 13 Contains the
             3' end of a novel gene, complete sequence
          Length = 168068

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 14    aatatgtaaaaattcattt 32
             |||||||||||||||||||
Sbjct: 45426 aatatgtaaaaattcattt 45444
to top
>emb|AL137181.8| Human DNA sequence from clone RP1-23O21 on chromosome 6 Contains an
            acidic calponin 3 (CNN3) pseudogene, complete sequence
          Length = 60248

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 15   atatgtaaaaattcattta 33
            |||||||||||||||||||
Sbjct: 8475 atatgtaaaaattcattta 8493
to top
>emb|BX890572.9| Zebrafish DNA sequence from clone CH211-234F20 in linkage group 4
             Contains the gene for a novel protein containing two notch
             (DSL) domains and an EF hand domain, the gene for a novel
             protein similar to vertebrate myosin binding protein H
             (MYBPH), the gene for a novel protein sinilar to human and
             mouse CWF19-like 1, cell cycle control (S. pombe)
             (CWF19L1), the gene for a novel protein (zgc:55718), the
             gene for a novel protein containing Kelch motifs and a
             BTB/POZ domain, the sycp3 gene for synaptonemal complex
             protein 3, a novel gene and a CpG island, complete
             sequence
          Length = 166208

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 17    atgtaaaaattcatttatacata 39
             |||||||||||||||||| ||||
Sbjct: 26030 atgtaaaaattcatttattcata 26052
to top
>emb|AL591481.5| Zebrafish DNA sequence from clone BUSM1-101L20 in linkage group 2
             Contains 37 TCR-alpha V segments (II-1 to II-37 according
             to annotation by Tatsuya Ota) two of which are pseudogenes
             (II-21, II-22) and a CpG island, complete sequence
          Length = 100317

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    atgtaaaaattcatttata 35
             |||||||||||||||||||
Sbjct: 80610 atgtaaaaattcatttata 80592
to top
>emb|AL592550.11| Zebrafish DNA sequence from clone BUSM1-18F12 in linkage group 2
             Contains 37 TCR-alpha V segments (II-11 to II-26, II-28 to
             II-48) three of which are pseudogenes (II-21, II-22,
             II-31), complete sequence
          Length = 96481

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    atgtaaaaattcatttata 35
             |||||||||||||||||||
Sbjct: 47620 atgtaaaaattcatttata 47602
to top
>emb|BX908384.15| Zebrafish DNA sequence from clone DKEY-38K3 in linkage group 13,
             complete sequence
          Length = 213699

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 16    tatgtaaaaattcatttatacat 38
             ||||||||||| |||||||||||
Sbjct: 90085 tatgtaaaaatgcatttatacat 90063
to top
>gb|AC107300.6| Homo sapiens 3 BAC RP11-516H5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 161699

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 14    aatatgtaaaaattcattt 32
             |||||||||||||||||||
Sbjct: 29537 aatatgtaaaaattcattt 29555
to top
>emb|BX649403.4| Zebrafish DNA sequence from clone CH211-153M11 in linkage group 13,
             complete sequence
          Length = 170097

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 16    tatgtaaaaattcatttatacat 38
             ||||||||||| |||||||||||
Sbjct: 32446 tatgtaaaaatgcatttatacat 32468
to top
>gb|AC093500.2| Drosophila melanogaster 3L BAC RP98-29P5 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 173558

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 18     tgtaaaaattcatttatacatag 40
              ||||||||| |||||||||||||
Sbjct: 165471 tgtaaaaatacatttatacatag 165449
to top
>gb|AC010716.4| Drosophila melanogaster 3L BAC RP98-11A21 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 173386

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 18    tgtaaaaattcatttatacatag 40
             ||||||||| |||||||||||||
Sbjct: 70400 tgtaaaaatacatttatacatag 70378
to top
>gb|DQ388145.1| Homo sapiens isolate cftr13838_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) gene, complete cds; and CTTNBP2 (CTTNBP2)
             gene, partial cds
          Length = 422127

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 45458 ttttctatgatgaatatggaaaaattcattt 45488
to top
>gb|DQ388144.1| Homo sapiens isolate cftr13838_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 423518

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 46840 ttttctatgatgaatatggaaaaattcattt 46870
to top
>gb|DQ388143.1| Homo sapiens isolate cftr11589_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 460130

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 47305 ttttctatgatgaatatggaaaaattcattt 47335
to top
>gb|DQ388141.1| Homo sapiens isolate cftr11521_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 459743

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 49833 ttttctatgatgaatatggaaaaattcattt 49863
to top
>gb|DQ388140.1| Homo sapiens isolate cftr11521_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 468331

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 55672 ttttctatgatgaatatggaaaaattcattt 55702
to top
>gb|DQ388139.1| Homo sapiens isolate cftr11376_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 480116

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 61686 ttttctatgatgaatatggaaaaattcattt 61716
to top
>gb|DQ388138.1| Homo sapiens isolate cftr11376_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 450881

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 52289 ttttctatgatgaatatggaaaaattcattt 52319
to top
>gb|DQ388135.1| Homo sapiens isolate cftr11321_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 429415

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 46106 ttttctatgatgaatatggaaaaattcattt 46136
to top
>gb|DQ388134.1| Homo sapiens isolate cftr11321_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 434687

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 51323 ttttctatgatgaatatggaaaaattcattt 51353
to top
>gb|DQ388137.1| Homo sapiens isolate cftr11373_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 411333

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 45035 ttttctatgatgaatatggaaaaattcattt 45065
to top
>gb|DQ388133.1| Homo sapiens isolate cftr10976_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 462987

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 48975 ttttctatgatgaatatggaaaaattcattt 49005
to top
>gb|DQ388132.1| Homo sapiens isolate cftr10976_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 456610

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 48137 ttttctatgatgaatatggaaaaattcattt 48167
to top
>gb|DQ388131.1| Homo sapiens isolate cftr10543_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 443905

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 45001 ttttctatgatgaatatggaaaaattcattt 45031
to top
>gb|DQ388130.1| Homo sapiens isolate cftr10543_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 459213

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 45001 ttttctatgatgaatatggaaaaattcattt 45031
to top
>gb|DQ388129.1| Homo sapiens isolate cftr10540_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 458144

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 45017 ttttctatgatgaatatggaaaaattcattt 45047
to top
>gb|DQ388128.1| Homo sapiens isolate cftr10540_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 451649

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 45017 ttttctatgatgaatatggaaaaattcattt 45047
to top
>gb|AC166600.4| Nomascus leucogenys leucogenys clone CH271-368I9, complete sequence
          Length = 179470

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 87124 ttttctatgatgaatatggaaaaattcattt 87154
to top
>gb|DQ356264.1| Homo sapiens isolate cftr14672_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 425451

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 48867 ttttctatgatgaatatggaaaaattcattt 48897
to top
>gb|DQ356263.1| Homo sapiens isolate cftr14672_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 458173

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 53970 ttttctatgatgaatatggaaaaattcattt 54000
to top
>gb|DQ356262.1| Homo sapiens isolate cftr14663_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 451123

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 47304 ttttctatgatgaatatggaaaaattcattt 47334
to top
>gb|DQ356261.1| Homo sapiens isolate cftr14663_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) gene, partial cds; and CTTNBP2 (CTTNBP2)
             gene, complete cds
          Length = 449665

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 49591 ttttctatgatgaatatggaaaaattcattt 49621
to top
>gb|DQ356260.1| Homo sapiens isolate cftr10975_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 447228

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 48963 ttttctatgatgaatatggaaaaattcattt 48993
to top
>gb|DQ356259.1| Homo sapiens isolate cftr10975_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 450685

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 48125 ttttctatgatgaatatggaaaaattcattt 48155
to top
>gb|DQ356258.1| Homo sapiens isolate cftr10471_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) gene, partial cds; and CTTNBP2 (CTTNBP2)
             gene, complete cds
          Length = 461061

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 33333 ttttctatgatgaatatggaaaaattcattt 33363
to top
>gb|DQ356257.1| Homo sapiens isolate cftr10471_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member 7 (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 495329

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 57624 ttttctatgatgaatatggaaaaattcattt 57654
to top
>gb|DP000025.1| Gorilla gorilla gorilla target 1 genomic scaffold
          Length = 1787293

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                              
Query: 2       ttttttatgaggaatatgtaaaaattcattt 32
               |||| ||||| ||||||| ||||||||||||
Sbjct: 1292716 ttttctatgatgaatatggaaaaattcattt 1292746
to top
>gb|DP000026.1| Pongo pygmaeus target 1 genomic scaffold
          Length = 1819346

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                              
Query: 2       ttttttatgaggaatatgtaaaaattcattt 32
               |||| ||||| ||||||| ||||||||||||
Sbjct: 1288250 ttttctatgatgaatatggaaaaattcattt 1288280
to top
>gb|AC116957.2| Dictyostelium discoideum chromosome 2 map 1685067-2090751 strain AX4,
              complete sequence
          Length = 405682

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 20     taaaaattcatttatacatagaa 42
              |||||||| ||||||||||||||
Sbjct: 309737 taaaaatttatttatacatagaa 309715
to top
>gb|DQ354391.1| Homo sapiens isolate cftr01814_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 439798

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 59961 ttttctatgatgaatatggaaaaattcattt 59991
to top
>gb|DQ354390.1| Homo sapiens isolate cftr01814_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 437219

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 51351 ttttctatgatgaatatggaaaaattcattt 51381
to top
>gb|DQ354389.1| Homo sapiens isolate cftr14683_B cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 430078

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 46702 ttttctatgatgaatatggaaaaattcattt 46732
to top
>gb|DQ354388.1| Homo sapiens isolate cftr14683_A cystic fibrosis transmembrane
             conductance regulator ATP-binding cassette sub-family C
             member (CFTR) and CTTNBP2 (CTTNBP2) genes, complete cds
          Length = 461441

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                            
Query: 2     ttttttatgaggaatatgtaaaaattcattt 32
             |||| ||||| ||||||| ||||||||||||
Sbjct: 46850 ttttctatgatgaatatggaaaaattcattt 46880
to top
>gb|AC156989.3| Mus musculus chromosome 1, clone RP23-379L2, complete sequence
          Length = 188691

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 10    gaggaatatgtaaaaattcattt 32
             ||||||||| |||||||||||||
Sbjct: 65379 gaggaatatataaaaattcattt 65357
to top
>emb|AL391262.3|CNS06C86 Human chromosome 14 DNA sequence BAC R-817G13 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 171296

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     gaatatgtaaaaattcatt 31
              |||||||||||||||||||
Sbjct: 124951 gaatatgtaaaaattcatt 124933
to top
>gb|AF042062.1|AF042062 Mycosphaerella graminicola succinate dehydrogenase iron-sulphur
            protein gene, complete cds
          Length = 3486

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 81   ctggagacatcgtacatgc 99
            |||||||||||||||||||
Sbjct: 2175 ctggagacatcgtacatgc 2157
to top
>gb|AE003564.3| Drosophila melanogaster chromosome 3L, section 21 of 83 of the complete
             sequence
          Length = 315944

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 18    tgtaaaaattcatttatacatag 40
             ||||||||| |||||||||||||
Sbjct: 50500 tgtaaaaatacatttatacatag 50478
to top
>gb|AC004664.1|AC004664 Homo sapiens chromosome 4 clone C0500H20 map 4p16, complete sequence
          Length = 172072

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 17     atgtaaaaattcatttata 35
              |||||||||||||||||||
Sbjct: 143134 atgtaaaaattcatttata 143116
to top
>emb|AL117694.5|CNS01DRQ Human chromosome 14 DNA sequence BAC R-226F19 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 166279

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 13     gaatatgtaaaaattcatt 31
              |||||||||||||||||||
Sbjct: 161219 gaatatgtaaaaattcatt 161237
to top
>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 17      atgtaaaaattcatttata 35
               |||||||||||||||||||
Sbjct: 4067124 atgtaaaaattcatttata 4067142



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 6       ttatgaggaatatgtaaaa 24
               |||||||||||||||||||
Sbjct: 1439006 ttatgaggaatatgtaaaa 1439024
to top
>gb|AC147437.2| Gallus gallus BAC clone CH261-80L21 from chromosome unknown, complete
              sequence
          Length = 221338

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 13     gaatatgtaaaaattcatt 31
              |||||||||||||||||||
Sbjct: 164488 gaatatgtaaaaattcatt 164506
to top
>gb|AC147639.3| Mus musculus BAC clone RP23-115M6 from 13, complete sequence
          Length = 187485

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 16     tatgtaaaaattcatttatacat 38
              ||||||||||||||| |||||||
Sbjct: 146130 tatgtaaaaattcatgtatacat 146152
to top
>emb|AL935175.6| Mouse DNA sequence from clone RP23-397E13 on chromosome 2, complete
             sequence
          Length = 158592

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 11    aggaatatgtaaaaattcattta 33
             |||||||||||| ||||||||||
Sbjct: 36105 aggaatatgtaagaattcattta 36083


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,412,132
Number of Sequences: 3902068
Number of extensions: 1412132
Number of successful extensions: 99819
Number of sequences better than 10.0: 75
Number of HSP's better than 10.0 without gapping: 75
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99176
Number of HSP's gapped (non-prelim): 643
length of query: 126
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 105
effective length of database: 17,151,101,840
effective search space: 1800865693200
effective search space used: 1800865693200
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top