ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet79b04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|L37070.1|WHTHSP169L Triticum aestivum clone 17LC3 heat shock ... 70 3e-09
2ref|XM_636462.1| Dictyostelium discoideum aldehyde dehydrogenase... 40 2.4
3gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Can... 40 2.4
4gb|AC158598.7| Mus musculus 10 BAC RP24-286B23 (Roswell Park Can... 40 2.4
5emb|AL391707.9| Human DNA sequence from clone RP11-166B18 on chr... 38 9.5
6dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 38 9.5
7dbj|AP003205.3| Oryza sativa (japonica cultivar-group) genomic D... 38 9.5
8gb|AC090358.16| Homo sapiens chromosome 18, clone RP11-775G23, c... 38 9.5
9gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, comple... 38 9.5

>gb|L37070.1|WHTHSP169L Triticum aestivum clone 17LC3 heat shock protein 16.9
           (hsp16.9-17LC3) mRNA, partial cds
          Length = 440

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 64/74 (86%), Gaps = 6/74 (8%)
 Strand = Plus / Plus

                                                                       
Query: 100 gtagcactaaatgaacaaaccggaagcgagtggcttcatcgac------acaaccttgat 153
           |||| ||||||||||||||| |||||||| |||||||||||||      |||||||||||
Sbjct: 294 gtagtactaaatgaacaaacaggaagcgactggcttcatcgaccgaacaacaaccttgat 353

                         
Query: 154 ttcaaactcgtggc 167
           |||||||| |||||
Sbjct: 354 ttcaaacttgtggc 367



to top

>ref|XM_636462.1| Dictyostelium discoideum aldehyde dehydrogenase (DDB0231482),
           partial mRNA
          Length = 1770

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 36  acaaatcttacaagatttca 55
           ||||||||||||||||||||
Sbjct: 339 acaaatcttacaagatttca 358



to top

>gb|AC154028.7| Mus musculus 10 BAC RP23-246J13 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 206191

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 13    caccttccatagccactggatatacaaa 40
             ||||||||||||||||||  ||||||||
Sbjct: 41677 caccttccatagccactgtgtatacaaa 41650



to top

>gb|AC158598.7| Mus musculus 10 BAC RP24-286B23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 162273

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 13     caccttccatagccactggatatacaaa 40
              ||||||||||||||||||  ||||||||
Sbjct: 153678 caccttccatagccactgtgtatacaaa 153651



to top

>emb|AL391707.9| Human DNA sequence from clone RP11-166B18 on chromosome 10, complete
              sequence
          Length = 166826

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 17     ttccatagccactggatat 35
              |||||||||||||||||||
Sbjct: 131264 ttccatagccactggatat 131246



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 161      tcgtggcacaataaattat 179
                |||||||||||||||||||
Sbjct: 13744435 tcgtggcacaataaattat 13744453



to top

>dbj|AP003205.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1146B04
          Length = 145186

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 161   tcgtggcacaataaattat 179
             |||||||||||||||||||
Sbjct: 82763 tcgtggcacaataaattat 82781



to top

>gb|AC090358.16| Homo sapiens chromosome 18, clone RP11-775G23, complete sequence
          Length = 176680

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 174   aattatgcactgcactgca 192
             |||||||||||||||||||
Sbjct: 38182 aattatgcactgcactgca 38164



to top

>gb|AC132438.3| Mus musculus BAC clone RP23-234G15 from 3, complete sequence
          Length = 180660

 Score = 38.2 bits (19), Expect = 9.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 18    tccatagccactggatatacaaa 40
             ||||||||||||| |||||||||
Sbjct: 95161 tccatagccactgcatatacaaa 95183


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,391,527
Number of Sequences: 3902068
Number of extensions: 1391527
Number of successful extensions: 90859
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 90818
Number of HSP's gapped (non-prelim): 41
length of query: 192
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 170
effective length of database: 17,147,199,772
effective search space: 2915023961240
effective search space used: 2915023961240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top