ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet78g09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC168204.1| Medicago truncatula chromosome 7 BAC clone mth2-6... 42 0.30
2gb|AC136974.11| Medicago truncatula clone mth2-22e9, complete se... 42 0.30
3emb|AL121869.19|HSB138P15 Human DNA sequence from clone RP13-138... 42 0.30
4gb|AC010081.4|AC010081 Homo sapiens BAC clone RP11-65E7 from Y, ... 42 0.30
5gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, c... 42 0.30
6ref|XM_725146.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 1.2
7ref|XM_670697.1| Plasmodium berghei strain ANKA hypothetical pro... 40 1.2
8gb|AC113326.9| Mus musculus chromosome 1, clone RP23-454G7, comp... 40 1.2
9gb|AC137622.2| Oryza sativa (japonica cultivar-group) chromosome... 38 4.6
10gb|AC135430.2| Oryza sativa (japonica cultivar-group) chromosome... 38 4.6
11gb|AC110227.6| Mus musculus chromosome 9, clone RP24-331H14, com... 38 4.6
12gb|AC118702.8| Mus musculus chromosome 5, clone RP24-166J1, comp... 38 4.6
13emb|CR713085.2|CNS0GD61 Tetraodon nigroviridis full-length cDNA 38 4.6
14emb|CR708079.2|CNS0G9AZ Tetraodon nigroviridis full-length cDNA 38 4.6
15gb|AC092201.4| Homo sapiens BAC clone RP11-757A2 from 7, complet... 38 4.6
16gb|AC120138.9| Mus musculus chromosome 1, clone RP23-283D3, comp... 38 4.6
17gb|AC141113.5| Medicago truncatula clone mth2-7h7, complete sequ... 38 4.6
18gb|AC144515.14| Medicago truncatula clone mth2-5j8, complete seq... 38 4.6
19emb|CR361548.8| Zebrafish DNA sequence from clone CH211-140M22 i... 38 4.6
20emb|AL589693.3| Human DNA sequence from clone RP11-19F10 on chro... 38 4.6
21gb|AC174293.6| Medicago truncatula clone mth2-70h5, complete seq... 38 4.6
22gb|AC158151.4| Mus musculus chromosome 1, clone RP24-315B17, com... 38 4.6
23gb|AC115903.12| Mus musculus chromosome 1, clone RP24-472L18, co... 38 4.6
24gb|AC093015.5| Homo sapiens 12q BAC RP11-534K23 (Roswell Park Ca... 38 4.6
25gb|AC150705.16| Medicago truncatula clone mth2-132b13, complete ... 38 4.6
26dbj|AB219677.1| Minuartia arctica chloroplast rpl16 gene for rib... 38 4.6
27dbj|AB219676.1| Minuartia arctica chloroplast rpl16 gene for rib... 38 4.6
28dbj|AB219675.1| Minuartia arctica chloroplast rpl16 gene for rib... 38 4.6
29dbj|AB219674.1| Minuartia arctica chloroplast rpl16 gene for rib... 38 4.6
30dbj|AB219673.1| Minuartia arctica chloroplast rpl16 gene for rib... 38 4.6
31dbj|AB219672.1| Minuartia arctica chloroplast rpl16 gene for rib... 38 4.6
32gb|AC073358.14| Homo sapiens 3 BAC RP11-501M7 (Roswell Park Canc... 38 4.6
33emb|AL844155.6| Mouse DNA sequence from clone RP23-163L4 on chro... 38 4.6
34dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 38 4.6
35gb|AC158237.2| Mus musculus BAC clone RP23-142I8 from chromosome... 38 4.6
36gb|AC016730.9| Homo sapiens BAC clone RP11-375H3 from 2, complet... 38 4.6
37gb|AC084288.9| Mus musculus Strain C57BL6/J Chromosome 2 BAC, RP... 38 4.6
38emb|AL807381.6| Zebrafish DNA sequence from clone CH211-222N24, ... 38 4.6
39emb|AL133243.3|CNS01DUG BAC sequence from the SPG4 candidate reg... 38 4.6
40emb|BX248124.7| Zebrafish DNA sequence from clone CH211-214E3 in... 38 4.6
41gb|AC158945.6| Mus musculus chromosome 5, clone RP23-286J20, com... 38 4.6 
>gb|AC168204.1| Medicago truncatula chromosome 7 BAC clone mth2-64h15, complete
             sequence
          Length = 45758

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 48    ttattatttttgctcaattaa 68
             |||||||||||||||||||||
Sbjct: 12268 ttattatttttgctcaattaa 12288
to top
>gb|AC136974.11| Medicago truncatula clone mth2-22e9, complete sequence
          Length = 124037

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 48    ttattatttttgctcaattaa 68
             |||||||||||||||||||||
Sbjct: 11525 ttattatttttgctcaattaa 11505
to top
>emb|AL121869.19|HSB138P15 Human DNA sequence from clone RP13-138P15 on chromosome X Contains a
             keratin 18 (KRT18) pseudogene, a pseudogene similar to
             part of SNX3 (sorting nexin 3) and the 3' end of the
             PCDH11X gene for protocadherin 11 X-linked, complete
             sequence
          Length = 171727

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    cataataatatatctcttctt 32
             |||||||||||||||||||||
Sbjct: 37582 cataataatatatctcttctt 37602
to top
>gb|AC010081.4|AC010081 Homo sapiens BAC clone RP11-65E7 from Y, complete sequence
          Length = 176781

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    cataataatatatctcttctt 32
             |||||||||||||||||||||
Sbjct: 9987  cataataatatatctcttctt 10007
to top
>gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, complete sequence
          Length = 178059

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 52    tatttttgctcaattaacaac 72
             |||||||||||||||||||||
Sbjct: 79311 tatttttgctcaattaacaac 79291
to top
>ref|XM_725146.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY02366)
            partial mRNA
          Length = 4472

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 13   ataataatatatctcttcttaatt 36
            |||| |||||||||||||||||||
Sbjct: 4315 ataaaaatatatctcttcttaatt 4338
to top
>ref|XM_670697.1| Plasmodium berghei strain ANKA hypothetical protein (PB103910.00.0)
            partial mRNA
          Length = 3190

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 47   attattatttttgctcaatt 66
            ||||||||||||||||||||
Sbjct: 1392 attattatttttgctcaatt 1373
to top
>gb|AC113326.9| Mus musculus chromosome 1, clone RP23-454G7, complete sequence
          Length = 192734

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 39     catgccacattattattttt 58
              ||||||||||||||||||||
Sbjct: 105697 catgccacattattattttt 105716
to top
>gb|AC137622.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0118N20,
              complete sequence
          Length = 146139

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 76     aacacttgtacaaaatgga 94
              |||||||||||||||||||
Sbjct: 112262 aacacttgtacaaaatgga 112280



 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    aacacttgtacaaaatgga 94
             |||||||||||||||||||
Sbjct: 95503 aacacttgtacaaaatgga 95521
to top
>gb|AC135430.2| Oryza sativa (japonica cultivar-group) chromosome 5 PAC clone P0671E09,
             complete sequence
          Length = 158472

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    aacacttgtacaaaatgga 94
             |||||||||||||||||||
Sbjct: 63692 aacacttgtacaaaatgga 63710



 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    aacacttgtacaaaatgga 94
             |||||||||||||||||||
Sbjct: 46933 aacacttgtacaaaatgga 46951
to top
>gb|AC110227.6| Mus musculus chromosome 9, clone RP24-331H14, complete sequence
          Length = 196758

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 32     taattaacatgccacatta 50
              |||||||||||||||||||
Sbjct: 181929 taattaacatgccacatta 181911
to top
>gb|AC118702.8| Mus musculus chromosome 5, clone RP24-166J1, complete sequence
          Length = 171263

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    tatatctcttcttaattaa 38
             |||||||||||||||||||
Sbjct: 77308 tatatctcttcttaattaa 77290
to top
>emb|CR713085.2|CNS0GD61 Tetraodon nigroviridis full-length cDNA
          Length = 825

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 71 actttaacacttgtacaaa 89
          |||||||||||||||||||
Sbjct: 51 actttaacacttgtacaaa 33
to top
>emb|CR708079.2|CNS0G9AZ Tetraodon nigroviridis full-length cDNA
          Length = 823

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 71 actttaacacttgtacaaa 89
          |||||||||||||||||||
Sbjct: 49 actttaacacttgtacaaa 31
to top
>gb|AC092201.4| Homo sapiens BAC clone RP11-757A2 from 7, complete sequence
          Length = 64374

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 72   ctttaacacttgtacaaaa 90
            |||||||||||||||||||
Sbjct: 8532 ctttaacacttgtacaaaa 8514
to top
>gb|AC120138.9| Mus musculus chromosome 1, clone RP23-283D3, complete sequence
          Length = 216381

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 16     ataatatatctcttcttaa 34
              |||||||||||||||||||
Sbjct: 188005 ataatatatctcttcttaa 187987
to top
>gb|AC141113.5| Medicago truncatula clone mth2-7h7, complete sequence
          Length = 138094

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 48     ttattatttttgctcaatt 66
              |||||||||||||||||||
Sbjct: 130770 ttattatttttgctcaatt 130788
to top
>gb|AC144515.14| Medicago truncatula clone mth2-5j8, complete sequence
          Length = 119095

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 48    ttattatttttgctcaatt 66
             |||||||||||||||||||
Sbjct: 38096 ttattatttttgctcaatt 38114
to top
>emb|CR361548.8| Zebrafish DNA sequence from clone CH211-140M22 in linkage group 1,
             complete sequence
          Length = 146409

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 47    attattatttttgctcaattaac 69
             ||||||||||||||| |||||||
Sbjct: 44329 attattatttttgctaaattaac 44351
to top
>emb|AL589693.3| Human DNA sequence from clone RP11-19F10 on chromosome 6 Contains a CpG
              island, complete sequence
          Length = 165203

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 14     taataatatatctcttctt 32
              |||||||||||||||||||
Sbjct: 146195 taataatatatctcttctt 146213
to top
>gb|AC174293.6| Medicago truncatula clone mth2-70h5, complete sequence
          Length = 132047

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 48    ttattatttttgctcaatt 66
             |||||||||||||||||||
Sbjct: 55217 ttattatttttgctcaatt 55199
to top
>gb|AC158151.4| Mus musculus chromosome 1, clone RP24-315B17, complete sequence
          Length = 184935

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 16     ataatatatctcttcttaa 34
              |||||||||||||||||||
Sbjct: 129849 ataatatatctcttcttaa 129867
to top
>gb|AC115903.12| Mus musculus chromosome 1, clone RP24-472L18, complete sequence
          Length = 125123

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 16     ataatatatctcttcttaa 34
              |||||||||||||||||||
Sbjct: 114531 ataatatatctcttcttaa 114549
to top
>gb|AC093015.5| Homo sapiens 12q BAC RP11-534K23 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 115294

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 40    atgccacattattattttt 58
             |||||||||||||||||||
Sbjct: 64446 atgccacattattattttt 64428
to top
>gb|AC150705.16| Medicago truncatula clone mth2-132b13, complete sequence
          Length = 121342

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 20     tatatctcttcttaattaa 38
              |||||||||||||||||||
Sbjct: 106003 tatatctcttcttaattaa 105985
to top
>dbj|AB219677.1| Minuartia arctica chloroplast rpl16 gene for ribosomal protein 16,
           intron and partial cds, specimen_voucher:K. Senni  S1998
           (MAK)
          Length = 961

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 20  tatatctcttcttaattaa 38
           |||||||||||||||||||
Sbjct: 835 tatatctcttcttaattaa 853
to top
>dbj|AB219676.1| Minuartia arctica chloroplast rpl16 gene for ribosomal protein 16,
           intron and partial cds, specimen_voucher:K. Senni  S243
           (MAK)
          Length = 957

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 20  tatatctcttcttaattaa 38
           |||||||||||||||||||
Sbjct: 831 tatatctcttcttaattaa 849
to top
>dbj|AB219675.1| Minuartia arctica chloroplast rpl16 gene for ribosomal protein 16,
           intron and partial cds, specimen_voucher:N. Fujii
           F01657 (MAK)
          Length = 957

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 20  tatatctcttcttaattaa 38
           |||||||||||||||||||
Sbjct: 831 tatatctcttcttaattaa 849
to top
>dbj|AB219674.1| Minuartia arctica chloroplast rpl16 gene for ribosomal protein 16,
           intron and partial cds, specimen_voucher:K. Senni  S2818
           (MAK)
          Length = 957

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 20  tatatctcttcttaattaa 38
           |||||||||||||||||||
Sbjct: 831 tatatctcttcttaattaa 849
to top
>dbj|AB219673.1| Minuartia arctica chloroplast rpl16 gene for ribosomal protein 16,
           intron and partial cds, specimen_voucher:K. Senni  S1552
           (MAK)
          Length = 957

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 20  tatatctcttcttaattaa 38
           |||||||||||||||||||
Sbjct: 831 tatatctcttcttaattaa 849
to top
>dbj|AB219672.1| Minuartia arctica chloroplast rpl16 gene for ribosomal protein 16,
           intron and partial cds, specimen_voucher:N. Fujii
           F01070 (MAK)
          Length = 958

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 20  tatatctcttcttaattaa 38
           |||||||||||||||||||
Sbjct: 832 tatatctcttcttaattaa 850
to top
>gb|AC073358.14| Homo sapiens 3 BAC RP11-501M7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 164078

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    attattatttttgctcaat 65
             |||||||||||||||||||
Sbjct: 37790 attattatttttgctcaat 37808
to top
>emb|AL844155.6| Mouse DNA sequence from clone RP23-163L4 on chromosome 2, complete
             sequence
          Length = 193188

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 50    attatttttgctcaattaa 68
             |||||||||||||||||||
Sbjct: 59072 attatttttgctcaattaa 59054
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 76       aacacttgtacaaaatgga 94
                |||||||||||||||||||
Sbjct: 13846190 aacacttgtacaaaatgga 13846208



 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 76       aacacttgtacaaaatgga 94
                |||||||||||||||||||
Sbjct: 13829431 aacacttgtacaaaatgga 13829449
to top
>gb|AC158237.2| Mus musculus BAC clone RP23-142I8 from chromosome 9, complete
            sequence
          Length = 179606

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 32   taattaacatgccacatta 50
            |||||||||||||||||||
Sbjct: 4039 taattaacatgccacatta 4021
to top
>gb|AC016730.9| Homo sapiens BAC clone RP11-375H3 from 2, complete sequence
          Length = 172243

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    aataatatatctcttctta 33
             |||||||||||||||||||
Sbjct: 53219 aataatatatctcttctta 53237
to top
>gb|AC084288.9| Mus musculus Strain C57BL6/J Chromosome 2 BAC, RP23-108H5, complete
             sequence
          Length = 200393

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 50    attatttttgctcaattaa 68
             |||||||||||||||||||
Sbjct: 27140 attatttttgctcaattaa 27158
to top
>emb|AL807381.6| Zebrafish DNA sequence from clone CH211-222N24, complete sequence
          Length = 230718

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 48     ttattatttttgctcaatt 66
              |||||||||||||||||||
Sbjct: 125095 ttattatttttgctcaatt 125077
to top
>emb|AL133243.3|CNS01DUG BAC sequence from the SPG4 candidate region at 2p21-2p22 BAC 559D11 of
              library RPCI-11 from chromosome 2 of Homo sapiens (Human)
          Length = 166318

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 54     tttttgctcaattaacaac 72
              |||||||||||||||||||
Sbjct: 135467 tttttgctcaattaacaac 135449
to top
>emb|BX248124.7| Zebrafish DNA sequence from clone CH211-214E3 in linkage group 12,
             complete sequence
          Length = 211571

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    acattattatttttgctca 63
             |||||||||||||||||||
Sbjct: 84970 acattattatttttgctca 84952
to top
>gb|AC158945.6| Mus musculus chromosome 5, clone RP23-286J20, complete sequence
          Length = 210182

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 20     tatatctcttcttaattaa 38
              |||||||||||||||||||
Sbjct: 173003 tatatctcttcttaattaa 173021


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,786,898
Number of Sequences: 3902068
Number of extensions: 1786898
Number of successful extensions: 124510
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 124365
Number of HSP's gapped (non-prelim): 145
length of query: 104
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 83
effective length of database: 17,151,101,840
effective search space: 1423541452720
effective search space used: 1423541452720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top