ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet78a09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC097525.3| Homo sapiens BAC clone RP11-627E8 from 2, complet... 40 0.14
2emb|BX537346.18| Zebrafish DNA sequence from clone DKEYP-2A6 in ... 38 0.56
3emb|AL672236.18| Mouse DNA sequence from clone RP23-206L21 on ch... 36 2.2
4gb|S68729.1| LHC Ib-20=light-harvesting complex I [Hordeum vulga... 36 2.2
5gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome 34 8.7
6gb|AC158548.10| Mus musculus chromosome 5, clone RP23-258F17, co... 34 8.7
7gb|AC120861.7| Mus musculus chromosome 5, clone RP23-60J23, comp... 34 8.7
8gb|AC140030.6| Medicago truncatula clone mth2-7g24, complete seq... 34 8.7
9gb|AC090685.8| Homo sapiens chromosome 17, clone RP11-252O24, co... 34 8.7
10ref|NM_065557.2| Caenorhabditis elegans T04A8.5 (Amidophosphorib... 34 8.7
11gb|AC016759.11| Homo sapiens BAC clone RP11-535J8 from 2, comple... 34 8.7
12gb|AC098823.3| Homo sapiens BAC clone RP11-420E18 from 2, comple... 34 8.7
13gb|AC107209.4| Homo sapiens BAC clone RP11-4F12 from 2, complete... 34 8.7
14gb|AC127465.3| Didelphis virginiana clone LB3-97M17, complete se... 34 8.7
15gb|AC123718.9| Mus musculus chromosome 1, clone RP23-401A11, com... 34 8.7
16gb|AC125443.8| Mus musculus chromosome 1, clone RP24-493N12, com... 34 8.7
17gb|AC006050.1|AC006050 Homo sapiens chromosome 17, clone hRPK.2... 34 8.7
18emb|Z35663.1|CET04A8 Caenorhabditis elegans Cosmid T04A8, comple... 34 8.7
19gb|DP000023.1| Didelphis virginiana target 1 genomic scaffold 34 8.7

>gb|AC097525.3| Homo sapiens BAC clone RP11-627E8 from 2, complete sequence
          Length = 55514

 Score = 40.1 bits (20), Expect = 0.14
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     catgggtgatattacaagta 25
             ||||||||||||||||||||
Sbjct: 11077 catgggtgatattacaagta 11096



to top

>emb|BX537346.18| Zebrafish DNA sequence from clone DKEYP-2A6 in linkage group 1,
             complete sequence
          Length = 102802

 Score = 38.2 bits (19), Expect = 0.56
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    ggtgatattacaagtacag 28
             |||||||||||||||||||
Sbjct: 41416 ggtgatattacaagtacag 41434



to top

>emb|AL672236.18| Mouse DNA sequence from clone RP23-206L21 on chromosome 11 Contains a
             ribosomal protein S6 (Rps6) pseudogene, a novel gene, the
             gene for a novel immunoglobulin domain containing protein
             and two CpG islands, complete sequence
          Length = 219893

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     acacgcatgggtgatatt 18
             ||||||||||||||||||
Sbjct: 79495 acacgcatgggtgatatt 79478



to top

>gb|S68729.1| LHC Ib-20=light-harvesting complex I [Hordeum vulgare=barley,
           Prato, mRNA Chloroplast, 939 nt]
          Length = 939

 Score = 36.2 bits (18), Expect = 2.2
 Identities = 28/30 (93%), Gaps = 1/30 (3%)
 Strand = Plus / Minus

                                         
Query: 1   acacgcatgggtg-atattacaagtacagc 29
           ||||||||||||  ||||||||||||||||
Sbjct: 891 acacgcatgggtatatattacaagtacagc 862



to top

>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome
          Length = 2572079

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 4       cgcatgggtgatattac 20
               |||||||||||||||||
Sbjct: 1727128 cgcatgggtgatattac 1727144



to top

>gb|AC158548.10| Mus musculus chromosome 5, clone RP23-258F17, complete sequence
          Length = 227065

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 5      gcatgggtgatattaca 21
              |||||||||||||||||
Sbjct: 122321 gcatgggtgatattaca 122337



to top

>gb|AC120861.7| Mus musculus chromosome 5, clone RP23-60J23, complete sequence
          Length = 239102

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 5      gcatgggtgatattaca 21
              |||||||||||||||||
Sbjct: 220899 gcatgggtgatattaca 220883



to top

>gb|AC140030.6| Medicago truncatula clone mth2-7g24, complete sequence
          Length = 122057

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 5     gcatgggtgatattaca 21
             |||||||||||||||||
Sbjct: 70686 gcatgggtgatattaca 70670



to top

>gb|AC090685.8| Homo sapiens chromosome 17, clone RP11-252O24, complete sequence
          Length = 171140

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 14     atattacaagtacagcc 30
              |||||||||||||||||
Sbjct: 165339 atattacaagtacagcc 165355



to top

>ref|NM_065557.2| Caenorhabditis elegans T04A8.5 (Amidophosphoribosyltransferase)
           mRNA, complete cds
          Length = 1525

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 7   atgggtgatattacaag 23
           |||||||||||||||||
Sbjct: 516 atgggtgatattacaag 532



to top

>gb|AC016759.11| Homo sapiens BAC clone RP11-535J8 from 2, complete sequence
          Length = 219574

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                  
Query: 6     catgggtgatattacaagtac 26
             |||||||||||||||| ||||
Sbjct: 32989 catgggtgatattacatgtac 32969



to top

>gb|AC098823.3| Homo sapiens BAC clone RP11-420E18 from 2, complete sequence
          Length = 102117

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                  
Query: 8     tgggtgatattacaagtacag 28
             |||||||||||| ||||||||
Sbjct: 70555 tgggtgatattaaaagtacag 70535



to top

>gb|AC107209.4| Homo sapiens BAC clone RP11-4F12 from 2, complete sequence
          Length = 113078

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                  
Query: 6     catgggtgatattacaagtac 26
             |||||||||||||||| ||||
Sbjct: 63785 catgggtgatattacatgtac 63765



to top

>gb|AC127465.3| Didelphis virginiana clone LB3-97M17, complete sequence
          Length = 165669

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 9      gggtgatattacaagta 25
              |||||||||||||||||
Sbjct: 142836 gggtgatattacaagta 142820



to top

>gb|AC123718.9| Mus musculus chromosome 1, clone RP23-401A11, complete sequence
          Length = 225702

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 13    gatattacaagtacagc 29
             |||||||||||||||||
Sbjct: 13714 gatattacaagtacagc 13698



to top

>gb|AC125443.8| Mus musculus chromosome 1, clone RP24-493N12, complete sequence
          Length = 156248

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 13    gatattacaagtacagc 29
             |||||||||||||||||
Sbjct: 42154 gatattacaagtacagc 42170



to top

>gb|AC006050.1|AC006050 Homo sapiens chromosome 17, clone  hRPK.268_F_2, complete sequence
          Length = 162746

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 14    atattacaagtacagcc 30
             |||||||||||||||||
Sbjct: 75811 atattacaagtacagcc 75827



to top

>emb|Z35663.1|CET04A8 Caenorhabditis elegans Cosmid T04A8, complete sequence
          Length = 39482

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 7     atgggtgatattacaag 23
             |||||||||||||||||
Sbjct: 12964 atgggtgatattacaag 12980



to top

>gb|DP000023.1| Didelphis virginiana target 1 genomic scaffold
          Length = 1751794

 Score = 34.2 bits (17), Expect = 8.7
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 9      gggtgatattacaagta 25
              |||||||||||||||||
Sbjct: 280710 gggtgatattacaagta 280694


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 126,341
Number of Sequences: 3902068
Number of extensions: 126341
Number of successful extensions: 31018
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 30987
Number of HSP's gapped (non-prelim): 31
length of query: 30
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 10
effective length of database: 17,155,003,908
effective search space: 171550039080
effective search space used: 171550039080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)
to top