>ref|XM_725534.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY02711)
            partial mRNA
          Length = 13395

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 39   ttttgcatattaatttctgaaaatt 63
            |||||||||| ||||||||||||||
Sbjct: 1702 ttttgcatataaatttctgaaaatt 1678

>gb|AE008702.1| Salmonella typhimurium LT2, section 10 of 220 of the complete
           genome
          Length = 21072

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 66  atgattatgttacgccgtgat 86
           |||||||||||||||||||||
Sbjct: 621 atgattatgttacgccgtgat 641

>emb|AL627265.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
              complete chromosome; segment 1/20
          Length = 251050

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 66     atgattatgttacgccgtgat 86
              |||||||||||||||||||||
Sbjct: 198714 atgattatgttacgccgtgat 198734

>gb|AC114958.2| Homo sapiens chromosome 5 clone RP11-167O18, complete sequence
          Length = 79173

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 48   ttaatttctgaaaattctatgatta 72
            ||||||||| |||||||||||||||
Sbjct: 1603 ttaatttcttaaaattctatgatta 1579

>gb|AC114285.2| Homo sapiens chromosome 5 clone CTD-2335A14, complete sequence
          Length = 122885

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 48     ttaatttctgaaaattctatgatta 72
              ||||||||| |||||||||||||||
Sbjct: 116466 ttaatttcttaaaattctatgatta 116442

>gb|AY053392.1| Salmonella typhimurium multicopper oxidase (cuiD) gene, complete
           cds
          Length = 1980

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 66  atgattatgttacgccgtgat 86
           |||||||||||||||||||||
Sbjct: 187 atgattatgttacgccgtgat 207

>gb|AC027313.4|AC027313 Homo sapiens chromosome 5 clone CTC-278L1, complete sequence
          Length = 87302

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 48    ttaatttctgaaaattctatgatta 72
             ||||||||| |||||||||||||||
Sbjct: 33546 ttaatttcttaaaattctatgatta 33522

>gb|AC008548.6| Homo sapiens chromosome 5 clone CTC-505D13, complete sequence
          Length = 116730

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 56    tgaaaattctatgattatgtt 76
             |||||||||||||||||||||
Sbjct: 55122 tgaaaattctatgattatgtt 55102

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 66     atgattatgttacgccgtgat 86
              |||||||||||||||||||||
Sbjct: 198803 atgattatgttacgccgtgat 198823

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 66     atgattatgttacgccgtgat 86
              |||||||||||||||||||||
Sbjct: 198705 atgattatgttacgccgtgat 198725

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
              complete genome
          Length = 4755700

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 66     atgattatgttacgccgtgat 86
              |||||||||||||||||||||
Sbjct: 192636 atgattatgttacgccgtgat 192656

>gb|AC129591.4| Mus musculus BAC clone RP24-510A3 from chromosome 14, complete sequence
          Length = 176214

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 186   tttgctgaggacaggaggaa 205
             ||||||||||||||||||||
Sbjct: 85177 tttgctgaggacaggaggaa 85158

>ref|XM_805678.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053511605.20) partial mRNA
          Length = 1128

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 195 gacaggaggaacatgaggaa 214
           ||||||||||||||||||||
Sbjct: 335 gacaggaggaacatgaggaa 354

>emb|AL359736.19| Human DNA sequence from clone RP11-307N16 on chromosome 13 Contains the
             gene for a novel protein (FLJ31208), three novel genes, a
             novel pseudogene and three CpG islands, complete sequence
          Length = 178850

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     aacacaggctgccattttaa 27
             ||||||||||||||||||||
Sbjct: 67581 aacacaggctgccattttaa 67600

>emb|AL157827.17| Human DNA sequence from clone RP11-19J3 on chromosome 9q21.33-22.31
              Contains the 5' end of the ASPN gene for asporin (LRR class
              1), the ECM2 gene for female organ and adipocyte specific
              extracellular matrix protein 2, a pseudogene similar to
              part of cytochrome c oxidase I (MTCO1), the 3' end of a
              novel gene, the 3' end of the C9orf12 gene and a CpG
              island, complete sequence
          Length = 167734

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     ttaatttctgaaaattctat 67
              ||||||||||||||||||||
Sbjct: 146306 ttaatttctgaaaattctat 146287

>emb|CR392013.8| Zebrafish DNA sequence from clone DKEY-170H15 in linkage group 5,
              complete sequence
          Length = 187191

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 35     cattttttgcatattaattt 54
              ||||||||||||||||||||
Sbjct: 168354 cattttttgcatattaattt 168335

>gb|AC078994.3|AC078994 Homo sapiens chromosome 2 clone RP11-16B4 containing NRXN1 gene,
            partial cds, complete sequence
          Length = 179616

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 13   aggctgccattttaagcaac 32
            ||||||||||||||||||||
Sbjct: 4178 aggctgccattttaagcaac 4159

>gb|AC013403.9| Homo sapiens BAC clone RP11-195B17 from 2, complete sequence
          Length = 159707

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     ttaatttctgaaaattctat 67
              ||||||||||||||||||||
Sbjct: 106543 ttaatttctgaaaattctat 106524

>emb|BX005000.10| Zebrafish DNA sequence from clone DKEY-25O16 in linkage group 1,
             complete sequence
          Length = 234373

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 25    taagcaaccgcattttttgcatat 48
             |||||||| |||||||||||||||
Sbjct: 11893 taagcaacggcattttttgcatat 11916

>emb|BX640593.8| Zebrafish DNA sequence from clone DKEY-183C16 in linkage group 4,
              complete sequence
          Length = 218192

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     cattttttgcatattaattt 54
              ||||||||||||||||||||
Sbjct: 145806 cattttttgcatattaattt 145825

>emb|BX649423.7| Zebrafish DNA sequence from clone DKEY-18O7 in linkage group 4,
             complete sequence
          Length = 182374

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   ttttgaagtttggattgcaa 172
             ||||||||||||||||||||
Sbjct: 30014 ttttgaagtttggattgcaa 30033

>emb|BX005107.4| Zebrafish DNA sequence from clone CH211-204F4 in linkage group 4,
              complete sequence
          Length = 187251

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 35     cattttttgcatattaattt 54
              ||||||||||||||||||||
Sbjct: 131597 cattttttgcatattaattt 131578

>emb|AL359398.2|CNS05TE1 Human chromosome 14 DNA sequence BAC R-369C8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 176399

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    tgcatattaatttctgaaaa 61
             ||||||||||||||||||||
Sbjct: 34411 tgcatattaatttctgaaaa 34392

>emb|AL139354.6|CNS01DXK Human chromosome 14 DNA sequence BAC R-945F5 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 201539

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 42     tgcatattaatttctgaaaa 61
              ||||||||||||||||||||
Sbjct: 163496 tgcatattaatttctgaaaa 163477

>dbj|AP006864.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT18I21, TM1144,
             complete sequence
          Length = 135217

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    aaaattctatgattatgtta 77
             ||||||||||||||||||||
Sbjct: 31958 aaaattctatgattatgtta 31977

>gb|DQ021666.1| Influenza A virus (A/northern pintail/TX/828197/02(H6)) hemagglutinin
            gene, partial cds
          Length = 1050

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 167  ttgcaactggacttagaaat 186
            ||||||||||||||||||||
Sbjct: 992  ttgcaactggacttagaaat 1011


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,009,853
Number of Sequences: 3902068
Number of extensions: 3009853
Number of successful extensions: 58780
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58727
Number of HSP's gapped (non-prelim): 53
length of query: 287
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 265
effective length of database: 17,147,199,772
effective search space: 4544007939580
effective search space used: 4544007939580
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)