ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet77a04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL845436.7| Mouse DNA sequence from clone RP23-299N13 on chr... 44 0.21
2emb|CR788310.10| Zebrafish DNA sequence from clone DKEY-74F15 in... 42 0.83
3gb|AF125222.1| Antheraea yamamai mariner transposon Ay1.1 transp... 42 0.83
4gb|AF125219.1| Antheraea mylitta mariner transposon Anm1.1 trans... 42 0.83
5gb|BC100571.1| Mus musculus cDNA clone IMAGE:6435376 40 3.3
6dbj|AK085028.1| Mus musculus 13 days embryo lung cDNA, RIKEN ful... 40 3.3
7gb|AC097525.3| Homo sapiens BAC clone RP11-627E8 from 2, complet... 40 3.3
8gb|AC006994.4| Homo sapiens BAC clone RP11-396J8 from 2, complet... 40 3.3
9emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 3.3
10emb|AL671426.6| Mouse DNA sequence from clone RP23-107F15 on chr... 40 3.3

>emb|AL845436.7| Mouse DNA sequence from clone RP23-299N13 on chromosome 2, complete
             sequence
          Length = 126095

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 178   tttctcagtgtatttatcacaaggga 203
             |||||||| |||||||||||||||||
Sbjct: 40560 tttctcagagtatttatcacaaggga 40535



to top

>emb|CR788310.10| Zebrafish DNA sequence from clone DKEY-74F15 in linkage group 2,
            complete sequence
          Length = 244700

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 175  gtgtttctcagtgtatttatcacaa 199
            |||||||||||||||||||| ||||
Sbjct: 6464 gtgtttctcagtgtatttattacaa 6440



to top

>gb|AF125222.1| Antheraea yamamai mariner transposon Ay1.1 transposase pseudogene,
           partial sequence
          Length = 450

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 91  agggcattgtttaagtgctga 111
           |||||||||||||||||||||
Sbjct: 175 agggcattgtttaagtgctga 155



to top

>gb|AF125219.1| Antheraea mylitta mariner transposon Anm1.1 transposase pseudogene,
           partial sequence
          Length = 450

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 91  agggcattgtttaagtgctga 111
           |||||||||||||||||||||
Sbjct: 175 agggcattgtttaagtgctga 155



to top

>gb|BC100571.1| Mus musculus cDNA clone IMAGE:6435376
          Length = 3338

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 211 tcaagcctgtgaaattggta 230
           ||||||||||||||||||||
Sbjct: 936 tcaagcctgtgaaattggta 917



to top

>dbj|AK085028.1| Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched
            library, clone:D430026I16 product:hypothetical protein,
            full insert sequence
          Length = 3010

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 211  tcaagcctgtgaaattggta 230
            ||||||||||||||||||||
Sbjct: 2392 tcaagcctgtgaaattggta 2411



to top

>gb|AC097525.3| Homo sapiens BAC clone RP11-627E8 from 2, complete sequence
          Length = 55514

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 23  caaaaggacatctataagtg 42
           ||||||||||||||||||||
Sbjct: 297 caaaaggacatctataagtg 316



to top

>gb|AC006994.4| Homo sapiens BAC clone RP11-396J8 from 2, complete sequence
          Length = 192104

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 23     caaaaggacatctataagtg 42
              ||||||||||||||||||||
Sbjct: 190400 caaaaggacatctataagtg 190419



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 173     tcgtgtttctcagtgtattt 192
               ||||||||||||||||||||
Sbjct: 2362193 tcgtgtttctcagtgtattt 2362212



to top

>emb|AL671426.6| Mouse DNA sequence from clone RP23-107F15 on chromosome X, complete
             sequence
          Length = 123745

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tcaagcctgtgaaattggta 230
             ||||||||||||||||||||
Sbjct: 40881 tcaagcctgtgaaattggta 40862


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,877,356
Number of Sequences: 3902068
Number of extensions: 1877356
Number of successful extensions: 31343
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31325
Number of HSP's gapped (non-prelim): 18
length of query: 254
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 232
effective length of database: 17,147,199,772
effective search space: 3978150347104
effective search space used: 3978150347104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top