>gb|AC147916.2| Xenopus tropicalis clone CH216-89A23, complete sequence
          Length = 163647

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 135   gtcctgttggaattggagaga 155
             |||||||||||||||||||||
Sbjct: 38659 gtcctgttggaattggagaga 38639

>gb|AC084604.1|CBRG43O03 Caenorhabditis briggsae cosmid G43O03, complete sequence
          Length = 39067

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 82    tacaaaaaggaatgagaggacattctaac 110
             ||||||||||||||| | |||||||||||
Sbjct: 35745 tacaaaaaggaatgacatgacattctaac 35717

>emb|AL844564.14| Mouse DNA sequence from clone RP23-400D4 on chromosome 11, complete
              sequence
          Length = 196136

 Score = 42.1 bits (21), Expect = 0.78
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 176    atctttctagtttcagctttc 196
              |||||||||||||||||||||
Sbjct: 107551 atctttctagtttcagctttc 107531

>emb|AL158835.11| Human DNA sequence from clone RP11-383C5 on chromosome 10 Contains a
              aldolase A, fructose-bisphosphate pseudogene 2, four novel
              genes, the gene for erythroid differentiation-related
              factor 1 (EDRF1), the 3' end of the MMP21 gene for matrix
              metalloproteinase 21 and one CpG island, complete sequence
          Length = 174530

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 188    tcagctttctgatgccaccatagt 211
              |||||||||| |||||||||||||
Sbjct: 141094 tcagctttcttatgccaccatagt 141117

>emb|AL590450.1|CNS07EGH chromosome XI of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 267509

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      gaaaaaggaactacctcttc 21
              ||||||||||||||||||||
Sbjct: 172824 gaaaaaggaactacctcttc 172805


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,934,500
Number of Sequences: 3902068
Number of extensions: 1934500
Number of successful extensions: 59655
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59644
Number of HSP's gapped (non-prelim): 11
length of query: 240
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 218
effective length of database: 17,147,199,772
effective search space: 3738089550296
effective search space used: 3738089550296
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)