ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet76b04 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Plus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 2544
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Plus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 2544
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 794
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 806 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 752
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 866 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 757 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 703
>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence Length = 124732 Score = 69.9 bits (35), Expect = 4e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcgatg 272 |||||||| ||||||| ||||| |||||||| ||||||||||| |||||||| |||||| Sbjct: 8576 ttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtcagcgatg 8634 Score = 63.9 bits (32), Expect = 2e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| ||||||| |||||||||||||| ||||||||||| || ||||| Sbjct: 212 ttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtc 161 Score = 54.0 bits (27), Expect = 2e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcgatg 272 ||||||| ||||||| |||||||||||||| |||||| |||| ||||| || |||||| Sbjct: 2068 ttccgggaacaaagtttgtggcaaaggcccaagcgttgctgttgactggatcagcgatg 2010
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 852 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 794
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 852 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 798
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Plus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 93208 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 93262
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 80994 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 80940
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 799 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 739
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 851 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 799 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 745
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 845 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 791
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 851 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 797
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 790
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggc 771
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZE01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 291 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 164 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 110
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 771
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 828 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 774
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Plus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 91 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 145
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 19891 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 19837 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 16116 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 16170 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||| || |||||||| ||||||||||| ||||| ||||| Sbjct: 22537 ttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 22483
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 866 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 812
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 1093 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggc 1039
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| Sbjct: 944 ttccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggc 890
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||||||| ||||||| ||||||||||| ||||||||||| Sbjct: 847 ttccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggc 793
>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end Length = 351 Score = 69.9 bits (35), Expect = 4e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||| |||||||||||||| ||||||||||| ||||||||||| Sbjct: 346 ttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggc 292
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I precursor (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1015 Score = 65.9 bits (33), Expect = 6e-08 Identities = 45/49 (91%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgg 262 |||||||| |||||||||||||| ||||||| || |||||||||||||| Sbjct: 819 ttccggggacaaagttggtggcataggcccatgcattgttgttcactgg 771
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 63.9 bits (32), Expect = 2e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| |||||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 848 ttccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtc 797
>emb|X16535.1|GMCAB4 G.max DNA for Cab4 Length = 1470 Score = 63.9 bits (32), Expect = 2e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| ||||||| |||||| ||||||| || ||||||||||||||||| Sbjct: 1120 ttccggggacaaagtttgtggcataggcccaagcattgttgttcactgggtc 1069
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 63.9 bits (32), Expect = 2e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 223 caaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 796 caaagttggtggcataggcccatgcgttgttgttgacggggtcggcga 749
>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein 3C-like mRNA, complete cds Length = 1055 Score = 63.9 bits (32), Expect = 2e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| ||||||| |||||||||||||| ||||||||||| |||||||| Sbjct: 834 ttccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtc 783
>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end Length = 351 Score = 63.9 bits (32), Expect = 2e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| ||||||| |||||||||||||| ||||||||||| |||||||| Sbjct: 346 ttccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtc 295
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 63.9 bits (32), Expect = 2e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| |||||||||||||| ||||||| || |||||||| |||||||| Sbjct: 987 ttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtc 936
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 865 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| |||||||||||||||| ||||| || |||||||| || |||||||||| Sbjct: 465 ccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggcga 411
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence Length = 827 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 627 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 573
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 799 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 745
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 865 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 865 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 865 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 865 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 811
>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS20ZE02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 307 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 169 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 115
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 834 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 780
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 745 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 691
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||| |||||||| ||||||||||| ||||| ||||| Sbjct: 1016 ttccgggaacaaagttggtggcgaaggcccatgcgttgttgttaactggatcggc 962
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| ||||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 833 ccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 779
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| |||||||| ||||||||||| || |||||||||| Sbjct: 864 ccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 810
>gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene Cab-3T, complete cds Length = 339 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||| |||||||||||||| |||||||||| ||||||||||| Sbjct: 334 ttccgggaacaaagtttgtggcaaaggcccagacgttgttgttaactgggtcggc 280
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 61.9 bits (31), Expect = 1e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| |||||||| ||||||||||| || |||||||||| Sbjct: 1188 ccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 1134
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgg 262 |||||||| | ||||||||||| |||||||| ||||||||||| ||||| Sbjct: 627 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactgg 579
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgg 262 |||||||| | ||||||||||| |||||||| ||||||||||| ||||| Sbjct: 2371 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactgg 2323
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgg 262 |||||||| | |||||||||||||||||||| || |||||||| ||||| Sbjct: 838 ttccggggacgaagttggtggcaaaggcccatgcattgttgttgactgg 790
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 228 ttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 814 ttggtggcgaaggcccaagcgttgttgttgactgggtcggc 774
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgg 262 |||||||| | ||||||||||| |||||||| ||||||||||| ||||| Sbjct: 2372 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactgg 2324
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcgatg 272 |||||| | ||||| |||||||| ||||| ||||||||||| || |||||||||||| Sbjct: 812 ccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggcgatg 756
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcgatg 272 |||||| | ||||||||||| ||||||| ||||||||||| |||||||| |||||| Sbjct: 1673 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcagcgatg 1617
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcgatg 272 |||||| ||||||||||||| || ||||| || |||||||| || |||||||||||| Sbjct: 803 ccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgatg 747
>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein Length = 686 Score = 58.0 bits (29), Expect = 2e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgg 262 |||||||| |||||||||||||| ||||||| || |||||||| ||||| Sbjct: 577 ttccggggacaaagttggtggcataggcccatgcattgttgtttactgg 529
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 56.0 bits (28), Expect = 6e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| | ||||||||||| ||||||| ||||||||||| |||||||| Sbjct: 845 ttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtc 794
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 56.0 bits (28), Expect = 6e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| ||||||| ||||||||||||||||| |||||||| || ||||| Sbjct: 1026 ttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtc 975
>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein Length = 1656 Score = 56.0 bits (28), Expect = 6e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| ||||||| |||||| ||||||| ||||||||||| || ||||| Sbjct: 1300 ttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtc 1249
>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II Length = 518 Score = 56.0 bits (28), Expect = 6e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| | |||||||| || |||||||| ||||||||||| |||||||| Sbjct: 370 ttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtc 319
>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102, 3' end and flank Length = 302 Score = 56.0 bits (28), Expect = 6e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| ||||||| ||||||||||||||||| |||||||| || ||||| Sbjct: 184 ttccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtc 133
>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb1) mRNA, partial cds Length = 414 Score = 56.0 bits (28), Expect = 6e-05 Identities = 40/44 (90%) Strand = Plus / Minus Query: 225 aagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||||||| ||||||| ||||||||||| || |||||||| Sbjct: 273 aagttggtggcataggcccaggcgttgttgttaacggggtcggc 230
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007, complete sequence Length = 92741 Score = 56.0 bits (28), Expect = 6e-05 Identities = 46/52 (88%) Strand = Plus / Plus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||| ||| |||||||||||||| ||||||| || |||||||| |||||||| Sbjct: 65564 ttccagggacaaagttggtggcataggcccaggcattgttgttaactgggtc 65615
>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end Length = 351 Score = 56.0 bits (28), Expect = 6e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| ||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 346 ttccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtc 295
>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3102 Score = 56.0 bits (28), Expect = 6e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| ||||||| |||||| ||||||| ||||||||||| || ||||| Sbjct: 2703 ttccggggacaaagtttgtggcataggcccaggcgttgttgttaacggggtc 2652
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7299 Score = 56.0 bits (28), Expect = 6e-05 Identities = 46/52 (88%) Strand = Plus / Plus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| ||||||| |||||| ||||||| ||||||||||| |||||||| Sbjct: 1875 ttccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtc 1926
>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds Length = 1020 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||| || |||||||| ||||||||||| ||||| ||||| Sbjct: 852 ttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 791 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 737
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 779 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 725
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 1240 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1186
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 54.0 bits (27), Expect = 2e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 225 aagttggtggcaaaggcccacgcgttgttgttcactgggtcgg 267 ||||||||||| |||||||| ||||||||||| || ||||||| Sbjct: 848 aagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 806
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 13883 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 13937
>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910) mRNA, complete cds Length = 870 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||| || |||||||| ||||||||||| ||||| ||||| Sbjct: 799 ttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 745
>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910; F1N18.5) mRNA, complete cds Length = 1019 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||| || |||||||| ||||||||||| ||||| ||||| Sbjct: 852 ttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 30025128 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 30025074 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 23604322 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 23604268
>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 54.0 bits (27), Expect = 2e-04 Identities = 49/55 (89%), Gaps = 1/55 (1%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| ||||||||||||||| |||||| ||||||||||| ||||| ||||| Sbjct: 836 ttccgggaacaaagttggtggcaa-ggcccaagcgttgttgttgactggatcggc 783
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| | ||||||||||| ||||||| |||||||||| ||||||||||| Sbjct: 835 ttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggc 781
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 21118 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 21064
>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*2) mRNA, complete cds; nuclear gene for chloroplast product Length = 932 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||| ||| ||||||||||||| ||||||| ||||||||||| || |||||||| Sbjct: 846 ttccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcggc 792
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 67021 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 66967
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 850 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 796
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 849 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 795
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 1279 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 1225
>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein Length = 1060 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||| || |||||||| ||||||||||| ||||| ||||| Sbjct: 1005 ttccgggaacaaagttggttgcgaaggcccatgcgttgttgttgactggatcggc 951
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 54.0 bits (27), Expect = 2e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgtt 256 |||||||| | |||||||||||| ||||||| ||||||||||| Sbjct: 1037 ttccggggacgaagttggtggcataggcccaggcgttgttgtt 995
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| |||||||| || |||||||| || |||||||||| Sbjct: 968 ccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggcga 914
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 818
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 379 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcga 325
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 857 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 803
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||||| Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcga 820
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 54.0 bits (27), Expect = 2e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 222 gcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| ||||| |||||||| || |||||||| ||||||||||| Sbjct: 803 gcaaagtttgtggcgaaggcccaagcattgttgttaactgggtcggc 757
>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide 15) mRNA, clone pAB96 Length = 822 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||| |||||||||| ||| | | ||| ||||||||||||||||||||||| Sbjct: 683 ttccgggaacaaagttggtagcatatgaccatgcgttgttgttcactgggtcggc 629
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 52.0 bits (26), Expect = 0.001 Identities = 41/46 (89%) Strand = Plus / Minus Query: 225 aagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 ||||||||||| |||||||| ||||||||||| || ||||| |||| Sbjct: 693 aagttggtggcgaaggcccaggcgttgttgttgacggggtcagcga 648
>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3386 Score = 52.0 bits (26), Expect = 0.001 Identities = 35/38 (92%) Strand = Plus / Minus Query: 231 gtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||| ||||||| ||||||||||| ||||||||||| Sbjct: 2232 gtggcataggcccaagcgttgttgttaactgggtcggc 2195
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 50.1 bits (25), Expect = 0.004 Identities = 46/53 (86%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||| Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggc 1751
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 50.1 bits (25), Expect = 0.004 Identities = 46/53 (86%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||| | |||||||||||| ||||||| ||||||||| | || |||||||| Sbjct: 881 ccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 829
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 50.1 bits (25), Expect = 0.004 Identities = 46/53 (86%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||| | ||||||||||| ||||||| || ||||||||||| |||||||| Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggc 840
>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I Length = 2432 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgg 262 ||||||| ||||||| |||||||| ||||| ||||||||||| ||||| Sbjct: 1699 ttccgggaacaaagtttgtggcaaaagcccatgcgttgttgttaactgg 1651
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 50.1 bits (25), Expect = 0.004 Identities = 46/53 (86%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||| Sbjct: 855 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggc 803
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 50.1 bits (25), Expect = 0.004 Identities = 46/53 (86%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||| | |||||||||||| ||||||| ||||||||| | || |||||||| Sbjct: 1959 ccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggc 1907
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 50.1 bits (25), Expect = 0.004 Identities = 46/53 (86%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||| | ||||||||||| ||||||| ||||||||||| || |||||||| Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggc 1751
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 50.1 bits (25), Expect = 0.004 Identities = 37/41 (90%) Strand = Plus / Minus Query: 225 aagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||||||| |||||||| || |||||||| |||||||| Sbjct: 812 aagttggtggcgaaggcccaagcattgttgttgactgggtc 772
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgg 262 ||||||| ||||||| |||||||||||||| || |||||||| ||||| Sbjct: 793 ttccgggaacaaagtttgtggcaaaggcccatgcattgttgttgactgg 745
>gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end Length = 1919 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgg 262 |||| ||||||||||| |||||| | ||||| || |||||||||||||| Sbjct: 580 ttccaggggcaaagtttgtggcatatgcccatgcattgttgttcactgg 532
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 50.1 bits (25), Expect = 0.004 Identities = 49/57 (85%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcgatg 272 |||||| | ||||||||||| |||||||| ||||||||| || |||||||||||| Sbjct: 1527 ccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcgatg 1471
>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein Length = 983 Score = 48.1 bits (24), Expect = 0.015 Identities = 45/52 (86%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| |||||||||||||| ||||||| || |||||||| || ||||| Sbjct: 810 ttccgggaacaaagttggtggcataggcccatgcattgttgttgacagggtc 759
>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein Length = 963 Score = 48.1 bits (24), Expect = 0.015 Identities = 45/52 (86%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| ||||||| |||||||||||||| || |||||||| || ||||| Sbjct: 832 ttccgggaacaaagttagtggcaaaggcccaggcattgttgttaacagggtc 781
>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein Length = 964 Score = 48.1 bits (24), Expect = 0.015 Identities = 45/52 (86%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| ||||||||||||| ||| ||| || |||||||| |||||||| Sbjct: 866 ttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtc 815
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 48.1 bits (24), Expect = 0.015 Identities = 42/48 (87%) Strand = Plus / Minus Query: 223 caaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 ||||||||||||| ||||||| ||||||||||| || ||||| |||| Sbjct: 824 caaagttggtggcgtaggcccaggcgttgttgttgacagggtcagcga 777
>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 48.1 bits (24), Expect = 0.015 Identities = 45/52 (86%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| ||||||| ||||| || ||||| ||||||||||| || ||||| Sbjct: 793 ttccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtc 742
>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein Length = 980 Score = 48.1 bits (24), Expect = 0.015 Identities = 45/52 (86%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| ||||||||||||||||| ||| || |||||||| || ||||| Sbjct: 848 ttccggggacaaagttggtggcaaagttccaagcattgttgttaaccgggtc 797
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 48.1 bits (24), Expect = 0.015 Identities = 39/44 (88%) Strand = Plus / Minus Query: 225 aagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 ||||||||||||| | ||||||||||||||| || |||||||| Sbjct: 985 aagttggtggcaatgagccacgcgttgttgttgacagggtcggc 942
>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end Length = 351 Score = 48.1 bits (24), Expect = 0.015 Identities = 45/52 (86%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| ||||||| |||||||| ||||| ||||||||||| || ||||| Sbjct: 346 ttccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtc 295
>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7965 Score = 48.1 bits (24), Expect = 0.015 Identities = 45/52 (86%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| ||||||| |||||| ||| ||| ||||||||||| || ||||| Sbjct: 5127 ttccggggacaaagtttgtggcataggaccaggcgttgttgttaacagggtc 5076 Score = 40.1 bits (20), Expect = 3.5 Identities = 44/52 (84%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||| ||| ||||||| ||||| ||| ||| ||||||||||| |||||||| Sbjct: 2674 ttccagggacaaagtttgtggcgtaggaccaggcgttgttgttaactgggtc 2623
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 46.1 bits (23), Expect = 0.057 Identities = 47/55 (85%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| | ||||| ||||||||||| || |||||||||| Sbjct: 10793775 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 10793721
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 46.1 bits (23), Expect = 0.057 Identities = 47/55 (85%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| | ||||| ||||||||||| || |||||||||| Sbjct: 17498 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 17444
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 46.1 bits (23), Expect = 0.057 Identities = 47/55 (85%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| | ||||| ||||||||||| || |||||||||| Sbjct: 130393 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 130339
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13 Length = 1019 Score = 46.1 bits (23), Expect = 0.057 Identities = 32/35 (91%) Strand = Plus / Minus Query: 231 gtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||||||||||||| |||||||| || ||||| Sbjct: 900 gtggcaaaggcccacgcattgttgttaacggggtc 866
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 46.1 bits (23), Expect = 0.057 Identities = 47/55 (85%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| | ||||| ||||||||||| || |||||||||| Sbjct: 843 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 789
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 46.1 bits (23), Expect = 0.057 Identities = 47/55 (85%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| | ||||| ||||||||||| || |||||||||| Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 46.1 bits (23), Expect = 0.057 Identities = 47/55 (85%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| | ||||| ||||||||||| || |||||||||| Sbjct: 850 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 796
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 46.1 bits (23), Expect = 0.057 Identities = 47/55 (85%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| | ||||| ||||||||||| || |||||||||| Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 46.1 bits (23), Expect = 0.057 Identities = 47/55 (85%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| | ||||| ||||||||||| || |||||||||| Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 794
>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding protein mRNA, complete cds Length = 1118 Score = 46.1 bits (23), Expect = 0.057 Identities = 38/43 (88%) Strand = Plus / Minus Query: 223 caaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||||||||| | ||||| ||||| |||||||| ||||| Sbjct: 873 caaagttggtggcataagcccaggcgttattgttcaccgggtc 831
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 46.1 bits (23), Expect = 0.057 Identities = 47/55 (85%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggcga 270 |||||| | ||||||||||| | ||||| ||||||||||| || |||||||||| Sbjct: 829 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcga 775
>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein Lhcb1 mRNA, complete cds Length = 801 Score = 44.1 bits (22), Expect = 0.23 Identities = 46/54 (85%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcgg 267 ||||||| |||||||||||||| | | ||| || |||||||| |||||||||| Sbjct: 796 ttccgggaacaaagttggtggcatatgaccatgcattgttgttaactgggtcgg 743
>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1042 Score = 44.1 bits (22), Expect = 0.23 Identities = 34/38 (89%) Strand = Plus / Minus Query: 225 aagttggtggcaaaggcccacgcgttgttgttcactgg 262 |||||||| ||||||||||| || |||||||| ||||| Sbjct: 860 aagttggtagcaaaggcccatgcattgttgttaactgg 823
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 44.1 bits (22), Expect = 0.23 Identities = 43/50 (86%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||| | ||||||||||| ||||||| ||||||||||| || ||||| Sbjct: 857 ccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 808
>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding protein Length = 2236 Score = 44.1 bits (22), Expect = 0.23 Identities = 46/54 (85%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcgg 267 ||||||| |||||||||||||| | | ||| || |||||||| |||||||||| Sbjct: 2112 ttccgggaacaaagttggtggcatatgaccatgcattgttgttaactgggtcgg 2059
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 44.1 bits (22), Expect = 0.23 Identities = 43/50 (86%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||| | ||||||||||| ||||||| ||||||||||| || ||||| Sbjct: 866 ccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtc 817
>gb|AF082693.1|AF082693 Fundulus heteroclitus clone FHGA7 lactate dehydrogenase B gene, promoter Length = 309 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 54 tcgatgatgatgatacaaataa 33
>gb|AF082692.1|AF082692 Fundulus heteroclitus clone FHGA6 lactate dehydrogenase B gene, promoter Length = 315 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 54 tcgatgatgatgatacaaataa 33
>gb|U59854.1|FHU59854 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR Length = 1039 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 804 tcgatgatgatgatacaaataa 783
>gb|U59853.1|FHU59853 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR Length = 1041 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 806 tcgatgatgatgatacaaataa 785
>gb|U59843.1|FHU59843 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR Length = 1040 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 806 tcgatgatgatgatacaaataa 785
>gb|U59841.1|FHU59841 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR Length = 1084 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 844 tcgatgatgatgatacaaataa 823
>gb|U59837.1|FHU59837 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR Length = 1042 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 808 tcgatgatgatgatacaaataa 787
>gb|U59836.1|FHU59836 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR Length = 1039 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 805 tcgatgatgatgatacaaataa 784
>gb|U59835.1|FHU59835 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR Length = 1038 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 804 tcgatgatgatgatacaaataa 783
>gb|U59834.1|FHU59834 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR Length = 1037 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 802 tcgatgatgatgatacaaataa 781
>gb|U59833.1|FHU59833 Fundulus heteroclitus lactate dehydrogenase-B (Ldh-B) gene, 5'UTR Length = 1037 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Minus Query: 92 tcgatgatgatgatacaaataa 113 |||||||||||||||||||||| Sbjct: 802 tcgatgatgatgatacaaataa 781
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 44.1 bits (22), Expect = 0.23 Identities = 43/50 (86%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||| | ||||||||||| ||||||| || |||||||| |||||||| Sbjct: 816 ccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtc 767
>gb|AC147462.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1110B01, complete sequence Length = 160142 Score = 42.1 bits (21), Expect = 0.90 Identities = 21/21 (100%) Strand = Plus / Plus Query: 92 tcgatgatgatgatacaaata 112 ||||||||||||||||||||| Sbjct: 28388 tcgatgatgatgatacaaata 28408
>gb|U49830.2| Caenorhabditis elegans cosmid C33F10, complete sequence Length = 46463 Score = 42.1 bits (21), Expect = 0.90 Identities = 21/21 (100%) Strand = Plus / Plus Query: 93 cgatgatgatgatacaaataa 113 ||||||||||||||||||||| Sbjct: 44151 cgatgatgatgatacaaataa 44171
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 42.1 bits (21), Expect = 0.90 Identities = 21/21 (100%) Strand = Plus / Plus Query: 92 tcgatgatgatgatacaaata 112 ||||||||||||||||||||| Sbjct: 21435305 tcgatgatgatgatacaaata 21435325 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 177 ccgatggacagacggatggc 196 |||||||||||||||||||| Sbjct: 13146461 ccgatggacagacggatggc 13146442 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 177 ccgatggacagacggatggc 196 |||||||||||||||||||| Sbjct: 13143677 ccgatggacagacggatggc 13143658
>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein Length = 1036 Score = 42.1 bits (21), Expect = 0.90 Identities = 27/29 (93%) Strand = Plus / Minus Query: 225 aagttggtggcaaaggcccacgcgttgtt 253 |||||||||||||||||||| || ||||| Sbjct: 857 aagttggtggcaaaggcccaggcattgtt 829
>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein Length = 1083 Score = 42.1 bits (21), Expect = 0.90 Identities = 36/41 (87%) Strand = Plus / Minus Query: 228 ttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||||| ||||||| || ||||||||||| |||||||| Sbjct: 873 ttggtggcgtaggcccaggcattgttgttcacggggtcggc 833
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial cds Length = 551 Score = 42.1 bits (21), Expect = 0.90 Identities = 45/53 (84%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcggc 268 |||||| | ||||||||||| | ||||| ||||||||||| || |||||||| Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggc 337
>gb|AE014851.1| Plasmodium falciparum 3D7 chromosome 12, section 8 of 9 of the complete sequence Length = 251762 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 atgatgatgatacaaataaa 114 |||||||||||||||||||| Sbjct: 91207 atgatgatgatacaaataaa 91226
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 40.1 bits (20), Expect = 3.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 225 aagttggtggcaaaggcccacgcgttgttgtt 256 |||||||||||||| ||||| || |||||||| Sbjct: 658 aagttggtggcaaacgcccaggcattgttgtt 627
>gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OSJNBa0082F22, complete sequence Length = 176038 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 177 ccgatggacagacggatggc 196 |||||||||||||||||||| Sbjct: 109238 ccgatggacagacggatggc 109219 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 177 ccgatggacagacggatggc 196 |||||||||||||||||||| Sbjct: 106454 ccgatggacagacggatggc 106435
>gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, complete sequence Length = 202733 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 gtacaagtacacatgcatat 171 |||||||||||||||||||| Sbjct: 22438 gtacaagtacacatgcatat 22419
>emb|AL136461.10| Human DNA sequence from clone RP11-32G22 on chromosome 20 Contains part of the PTPRT gene for protein tyrosine phosphatase receptor type T, ESTs, STSs and GSSs, complete sequence Length = 48860 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 219 ggggcaaagttggtggcaaa 238 |||||||||||||||||||| Sbjct: 23718 ggggcaaagttggtggcaaa 23699
>gb|AY177248.1| Oryctolagus cuniculus whey acidic protein (WAP) gene, upstream regulatory region Length = 2560 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 gagggcatctcgctcgctcg 94 |||||||||||||||||||| Sbjct: 755 gagggcatctcgctcgctcg 774
>gb|AC112800.6| Rattus norvegicus X BAC CH230-275F1 (Children's Hospital Oakland Research Institute) complete sequence Length = 147560 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gatgatgatgatacaaataa 113 |||||||||||||||||||| Sbjct: 26076 gatgatgatgatacaaataa 26057
>emb|CR937191.1| Single read from an extremity of a cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAB2YK24AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 908 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 92 tcgatgatgatgatacaaat 111 |||||||||||||||||||| Sbjct: 318 tcgatgatgatgatacaaat 337
>emb|CR354438.9| Zebrafish DNA sequence from clone CH211-243G16 in linkage group 8, complete sequence Length = 136324 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 atgatgatacaaataaacacacaa 121 ||||||| |||||||||||||||| Sbjct: 58180 atgatgaaacaaataaacacacaa 58203
>emb|BX276114.6| Zebrafish DNA sequence from clone CH211-176L11 in linkage group 20 Contains the kit gene for kit receptor, the 3' end of the pdgfra gene for platelet derived growth factor receptor alpha and a CpG island, complete sequence Length = 134212 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 atgatacaaataaacacaca 120 |||||||||||||||||||| Sbjct: 114632 atgatacaaataaacacaca 114613
>gb|AC154642.2| Mus musculus BAC clone RP23-277C14 from chromosome 14, complete sequence Length = 211315 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 54 tacattgcccacagctagggagag 77 |||||||| ||||||||||||||| Sbjct: 81357 tacattgctcacagctagggagag 81380
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome Length = 3046682 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 cgggggcaaagttggtggca 236 |||||||||||||||||||| Sbjct: 1209304 cgggggcaaagttggtggca 1209323
>emb|BX470077.5| Zebrafish DNA sequence from clone CH211-136P17 in linkage group 5, complete sequence Length = 165851 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 195 gctgctaaacacatttaact 214 |||||||||||||||||||| Sbjct: 103691 gctgctaaacacatttaact 103672
>emb|BX322622.10| Zebrafish DNA sequence from clone DKEYP-14D3 in linkage group 8, complete sequence Length = 162365 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 98 atgatgatacaaataaacacacaa 121 ||||||| |||||||||||||||| Sbjct: 158836 atgatgaaacaaataaacacacaa 158859
>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 907 Score = 40.1 bits (20), Expect = 3.5 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Plus Query: 214 ttccgggggcaaagttggtggcaaaggccc-acgcgttgttgttcactgggtcggc 268 ||||||| |||||||||| || ||||||| | ||||||||||| ||||| ||||| Sbjct: 56 ttccgggaacaaagttggttgcgaaggccctatgcgttgttgttgactggatcggc 111
>gb|AC079384.26| Homo sapiens 12 BAC RP11-148B3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 180555 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gatgatgatgatacaaataa 113 |||||||||||||||||||| Sbjct: 61129 gatgatgatgatacaaataa 61110
>dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete genome Length = 3544776 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 aatccttccatccattcgct 27 |||||||||||||||||||| Sbjct: 519053 aatccttccatccattcgct 519034
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 40.1 bits (20), Expect = 3.5 Identities = 44/52 (84%) Strand = Plus / Minus Query: 216 ccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtcgg 267 |||||| | ||||||||||| | ||||| ||||||||||| || ||||||| Sbjct: 2714 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcgg 2663
>emb|BX248242.5| Zebrafish DNA sequence from clone BUSM1-205D10 in linkage group 20, complete sequence Length = 104779 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 atgatacaaataaacacaca 120 |||||||||||||||||||| Sbjct: 10904 atgatacaaataaacacaca 10885
>emb|AL691516.5| Zebrafish DNA sequence from clone BUSM1-116L04 in linkage group 20, complete sequence Length = 80250 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 atgatacaaataaacacaca 120 |||||||||||||||||||| Sbjct: 63793 atgatacaaataaacacaca 63774
>gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complete sequence Length = 205880 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 gtacaagtacacatgcatat 171 |||||||||||||||||||| Sbjct: 125910 gtacaagtacacatgcatat 125891
>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 40.1 bits (20), Expect = 3.5 Identities = 44/52 (84%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 |||||||| ||||||| |||||| | | ||| ||||||||||| || ||||| Sbjct: 793 ttccggggacaaagtttgtggcataagaccaggcgttgttgttaacggggtc 742
>gb|M64619.1|PEACAB66 Pea cab gene, complete cds Length = 1666 Score = 40.1 bits (20), Expect = 3.5 Identities = 44/52 (84%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| |||||||||||||| | | ||| || |||||||| |||||||| Sbjct: 1514 ttccgggaacaaagttggtggcatatgaccatgcattgttgttgactgggtc 1463
>gb|M14449.1|TOMCBPG Tomato chlorophyll a/b-binding protein gene Cab-1D, complete cds Length = 351 Score = 40.1 bits (20), Expect = 3.5 Identities = 44/52 (84%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| ||||||| ||||| ||| ||| ||||||||||| |||||||| Sbjct: 346 ttccgggaacaaagttagtggcgtaggaccaggcgttgttgtttactgggtc 295
>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll a/b-binding protein (polypeptide 15) complex precursor, complete coding sequence Length = 1993 Score = 40.1 bits (20), Expect = 3.5 Identities = 44/52 (84%) Strand = Plus / Minus Query: 214 ttccgggggcaaagttggtggcaaaggcccacgcgttgttgttcactgggtc 265 ||||||| |||||||||||||| | | ||| || |||||||| |||||||| Sbjct: 1815 ttccgggaacaaagttggtggcatatgaccatgcattgttgttgactgggtc 1764 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,624,908 Number of Sequences: 3902068 Number of extensions: 2624908 Number of successful extensions: 51098 Number of sequences better than 10.0: 189 Number of HSP's better than 10.0 without gapping: 190 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 50766 Number of HSP's gapped (non-prelim): 332 length of query: 272 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 250 effective length of database: 17,147,199,772 effective search space: 4286799943000 effective search space used: 4286799943000 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
