ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet75h08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF055328.1|AF055328 Hordeum vulgare glucan endo-1,3-beta-gluc... 402 e-109
2gb|M96938.1|BLYGLCNHI Hordeum vulgare glucan endo-1,3-beta-gluco... 270 2e-69
3emb|AJ890250.1| Triticum aestivum partial mRNA for putative gluc... 111 1e-21
4gb|AY277385.1| Avena sativa 1,3-beta glucanase (Oglc13) gene, co... 66 7e-08
5gb|AF155932.1| Avena sativa 1,3-beta glucanase (Oglc13) mRNA, pa... 58 2e-05
6gb|AF112967.1| Triticum aestivum beta-1,3-glucanase precursor (G... 54 3e-04
7gb|S82315.1| PRm 6b=1,3-beta-glucanase {clone CHEM 9} [Zea mays=... 54 3e-04
8gb|AY111675.1| Zea mays CL1243_1 mRNA sequence 54 3e-04
9gb|DQ147119.1| Zea diploperennis isolate d8 pathogenesis-related... 54 3e-04
10gb|DQ147118.1| Zea diploperennis isolate d7 pathogenesis-related... 54 3e-04
11gb|DQ147116.1| Zea diploperennis isolate d5 pathogenesis-related... 54 3e-04
12gb|DQ147115.1| Zea diploperennis isolate d4 pathogenesis-related... 54 3e-04
13gb|DQ147114.1| Zea diploperennis isolate d3 pathogenesis-related... 54 3e-04
14gb|DQ147113.1| Zea diploperennis isolate d2 pathogenesis-related... 54 3e-04
15gb|DQ147112.1| Zea diploperennis isolate d1 pathogenesis-related... 54 3e-04
16gb|DQ147111.1| Zea mays subsp. parviglumis isolate p15 pathogene... 54 3e-04
17gb|DQ147110.1| Zea mays subsp. parviglumis isolate p14 pathogene... 54 3e-04
18gb|DQ147109.1| Zea mays subsp. parviglumis isolate p13 pathogene... 54 3e-04
19gb|DQ147108.1| Zea mays subsp. parviglumis isolate p12 pathogene... 54 3e-04
20gb|DQ147107.1| Zea mays subsp. parviglumis isolate p11 pathogene... 54 3e-04
21gb|DQ147105.1| Zea mays subsp. parviglumis isolate p9 pathogenes... 54 3e-04
22gb|DQ147104.1| Zea mays subsp. parviglumis isolate p8 pathogenes... 54 3e-04
23gb|DQ147103.1| Zea mays subsp. parviglumis isolate p6 pathogenes... 54 3e-04
24gb|DQ147102.1| Zea mays subsp. parviglumis isolate p5 pathogenes... 54 3e-04
25gb|DQ147101.1| Zea mays subsp. parviglumis isolate p4 pathogenes... 54 3e-04
26gb|DQ147099.1| Zea mays subsp. parviglumis isolate p2 pathogenes... 54 3e-04
27gb|DQ147098.1| Zea mays subsp. parviglumis isolate p1 pathogenes... 54 3e-04
28emb|Y18212.1|TAY18212 Triticum aestivum mRNA for beta-1,3-endogl... 48 0.016
29ref|NM_189718.1| Oryza sativa (japonica cultivar-group), predic... 46 0.063
30dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.063
31dbj|AP004031.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.063
32gb|M95407.1|MZE13BGLCN Wuglu; Zea mays; 1292 base-pairs 46 0.063
33gb|DQ147117.1| Zea diploperennis isolate d6 pathogenesis-related... 46 0.063
34gb|DQ147100.1| Zea mays subsp. parviglumis isolate p3 pathogenes... 46 0.063
35gb|AF515785.1| Hordeum vulgare subsp. vulgare beta-1,3-glucanase... 44 0.25
36gb|AF479647.2| Hordeum vulgare subsp. vulgare beta-1,3-glucanase... 44 0.25
37gb|AF030771.1|AF030771 Hordeum vulgare beta-1,3-glucanase 2 (BGL... 44 0.25
38emb|AJ271367.1|HVU271367 Hordeum vulgare mRNA for beta-1,3-gluca... 44 0.25
39gb|M62907.1|BLYCBGL32 H.vulgare L. (1-3)-beta-glucanase mRNA, co... 44 0.25
40gb|DQ090946.1| Triticum aestivum beta-1,3-glucanase mRNA, comple... 42 0.99
41gb|DQ078255.1| Triticum aestivum beta-1,3-glucanase mRNA, comple... 42 0.99
42gb|M23548.1|BLYGEH Hordeum vulgare 1,3-beta glucan endohydrolase... 42 0.99
43gb|DQ207707.1| Zea mays cultivar inbred line Mo17 IDP449 marker 40 3.9
44ref|XM_798356.1| Trypanosoma brucei TREU927 hypothetical protein... 40 3.9
45gb|AC157561.10| Mus musculus chromosome 7, clone RP23-356A20, co... 40 3.9
46dbj|AK153596.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 40 3.9
47gb|AC154848.2| Mus musculus BAC clone RP23-38J19 from 13, comple... 40 3.9
48emb|CT025639.13| Mouse DNA sequence from clone RP23-233I11 on ch... 40 3.9
49emb|AL772308.4| Mouse DNA sequence from clone RP23-451I21 on chr... 40 3.9 
>gb|AF055328.1|AF055328 Hordeum vulgare glucan endo-1,3-beta-glucosidase isoenzyme I (BHVG1)
            gene, complete cds
          Length = 3327

 Score =  402 bits (203), Expect = e-109
 Identities = 206/207 (99%)
 Strand = Plus / Minus

                                                                        
Query: 92   gatctggttacacacttcactgctgcaatacgtccatgcatcttatttagggcgatatat 151
            ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 3308 gatctggttacacacttcactgctgcaatacgtccatgcatcttatttaggccgatatat 3249

                                                                        
Query: 152  cgacgtgtacgtatatagtatccacgttacccttcactcctgcattatacgcagcttatt 211
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3248 cgacgtgtacgtatatagtatccacgttacccttcactcctgcattatacgcagcttatt 3189

                                                                        
Query: 212  tattactgtattaggttgacgtacgtacgcatgcacggacgacgctactggaaccggatg 271
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3188 tattactgtattaggttgacgtacgtacgcatgcacggacgacgctactggaaccggatg 3129

                                       
Query: 272  gggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||||||||||||
Sbjct: 3128 gggtacgccggcgacttgtccgggttg 3102
to top
>gb|M96938.1|BLYGLCNHI Hordeum vulgare glucan endo-1,3-beta-glucosidase (isoenzyme I) mRNA,
            3' end
          Length = 1025

 Score =  270 bits (136), Expect = 2e-69
 Identities = 136/136 (100%)
 Strand = Plus / Minus

                                                                        
Query: 163  tatatagtatccacgttacccttcactcctgcattatacgcagcttatttattactgtat 222
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1014 tatatagtatccacgttacccttcactcctgcattatacgcagcttatttattactgtat 955

                                                                        
Query: 223  taggttgacgtacgtacgcatgcacggacgacgctactggaaccggatggggtacgccgg 282
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 954  taggttgacgtacgtacgcatgcacggacgacgctactggaaccggatggggtacgccgg 895

                            
Query: 283  cgacttgtccgggttg 298
            ||||||||||||||||
Sbjct: 894  cgacttgtccgggttg 879
to top
>emb|AJ890250.1| Triticum aestivum partial mRNA for putative glucan
            endo-1,3-beta-D-glucosidase (wgluc5 gene)
          Length = 1242

 Score =  111 bits (56), Expect = 1e-21
 Identities = 184/221 (83%), Gaps = 18/221 (8%)
 Strand = Plus / Minus

                                                                        
Query: 2    cctcaatatctttctctttattcatgacagacggcatag--caccacctgcaatggttgc 59
            ||||||| || ||||||||||||||||||||||  |||   ||||||||| |||||| ||
Sbjct: 1239 cctcaatttccttctctttattcatgacagacgatatataacaccacctggaatggtcgc 1180

                                                                        
Query: 60   act---ctcgcatgaatcg-tgttatgacatgcattgatctggttacacacttcactgct 115
            |||   || |||||||||| |||| ||||||||| |   || |||||||  |||||||||
Sbjct: 1179 actactcttgcatgaatcgatgttctgacatgcact---ctcgttacac--ttcactgct 1125

                                                                        
Query: 116  gcaatacgtccatgcatcttatttagggcga---tatatcgacgtgtacgtatatagtat 172
            |||||||||    ||| ||||||||||  ||   ||| ||||||||||||||||| ||| 
Sbjct: 1124 gcaatacgt----gcagcttatttaggctgacaatatgtcgacgtgtacgtatattgtac 1069

                                                     
Query: 173  ccacgttacccttcactcctgcattatacgcagcttattta 213
            ||||||||| ||||||||||||| |||||||||||||||||
Sbjct: 1068 ccacgttacacttcactcctgcactatacgcagcttattta 1028



 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 38/39 (97%)
 Strand = Plus / Minus

                                                  
Query: 260 tggaaccggatggggtacgccggcgacttgtccgggttg 298
           |||||| ||||||||||||||||||||||||||||||||
Sbjct: 965 tggaactggatggggtacgccggcgacttgtccgggttg 927
to top
>gb|AY277385.1| Avena sativa 1,3-beta glucanase (Oglc13) gene, complete cds
          Length = 3281

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 266  cggatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||||||||||||||||||
Sbjct: 3156 cggatggggtacgccggcgacttgtccgggttg 3124
to top
>gb|AF155932.1| Avena sativa 1,3-beta glucanase (Oglc13) mRNA, partial cds
          Length = 1045

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 266 cggatggggtacgccggcgacttgtccgggttg 298
           ||||||||||| |||||||||||||||||||||
Sbjct: 911 cggatggggtaggccggcgacttgtccgggttg 879
to top
>gb|AF112967.1| Triticum aestivum beta-1,3-glucanase precursor (Glb3) mRNA, complete
            cds
          Length = 1439

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1071 gatggggtacgccggcgatttgtccgggttg 1041
to top
>gb|S82315.1| PRm 6b=1,3-beta-glucanase {clone CHEM 9} [Zea mays=maize, cv. INRA
            258, mercuric chloride-treated, leaves, mRNA Partial,
            1243 nt]
          Length = 1243

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1047 gatggggtacgccggcgatttgtccgggttg 1017
to top
>gb|AY111675.1| Zea mays CL1243_1 mRNA sequence
          Length = 1272

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1068 gatggggtacgccggcgatttgtccgggttg 1038
to top
>gb|DQ147119.1| Zea diploperennis isolate d8 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1178

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1127 gatggggtacgccggcgatttgtccgggttg 1097
to top
>gb|DQ147118.1| Zea diploperennis isolate d7 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1130 gatggggtacgccggcgatttgtccgggttg 1100
to top
>gb|DQ147116.1| Zea diploperennis isolate d5 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1130 gatggggtacgccggcgatttgtccgggttg 1100
to top
>gb|DQ147115.1| Zea diploperennis isolate d4 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1130 gatggggtacgccggcgatttgtccgggttg 1100
to top
>gb|DQ147114.1| Zea diploperennis isolate d3 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1130 gatggggtacgccggcgatttgtccgggttg 1100
to top
>gb|DQ147113.1| Zea diploperennis isolate d2 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1189

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1138 gatggggtacgccggcgatttgtccgggttg 1108
to top
>gb|DQ147112.1| Zea diploperennis isolate d1 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1130 gatggggtacgccggcgatttgtccgggttg 1100
to top
>gb|DQ147111.1| Zea mays subsp. parviglumis isolate p15 pathogenesis-related protein
            6 (pr6) gene, complete cds
          Length = 1182

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1131 gatggggtacgccggcgatttgtccgggttg 1101
to top
>gb|DQ147110.1| Zea mays subsp. parviglumis isolate p14 pathogenesis-related protein
            6 (pr6) gene, complete cds
          Length = 1181

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1130 gatggggtacgccggcgatttgtccgggttg 1100
to top
>gb|DQ147109.1| Zea mays subsp. parviglumis isolate p13 pathogenesis-related protein
            6 (pr6) gene, complete cds
          Length = 1181

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1130 gatggggtacgccggcgatttgtccgggttg 1100
to top
>gb|DQ147108.1| Zea mays subsp. parviglumis isolate p12 pathogenesis-related protein
            6 (pr6) gene, complete cds
          Length = 1185

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1134 gatggggtacgccggcgatttgtccgggttg 1104
to top
>gb|DQ147107.1| Zea mays subsp. parviglumis isolate p11 pathogenesis-related protein
            6 (pr6) gene, complete cds
          Length = 1186

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1135 gatggggtacgccggcgatttgtccgggttg 1105
to top
>gb|DQ147105.1| Zea mays subsp. parviglumis isolate p9 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1185

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1134 gatggggtacgccggcgatttgtccgggttg 1104
to top
>gb|DQ147104.1| Zea mays subsp. parviglumis isolate p8 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1182

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1131 gatggggtacgccggcgatttgtccgggttg 1101
to top
>gb|DQ147103.1| Zea mays subsp. parviglumis isolate p6 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1182

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1131 gatggggtacgccggcgatttgtccgggttg 1101
to top
>gb|DQ147102.1| Zea mays subsp. parviglumis isolate p5 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1185

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1134 gatggggtacgccggcgatttgtccgggttg 1104
to top
>gb|DQ147101.1| Zea mays subsp. parviglumis isolate p4 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1185

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1134 gatggggtacgccggcgatttgtccgggttg 1104
to top
>gb|DQ147099.1| Zea mays subsp. parviglumis isolate p2 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1182

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1131 gatggggtacgccggcgatttgtccgggttg 1101
to top
>gb|DQ147098.1| Zea mays subsp. parviglumis isolate p1 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1185

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||||||||||| ||||||||||||
Sbjct: 1134 gatggggtacgccggcgatttgtccgggttg 1104
to top
>emb|Y18212.1|TAY18212 Triticum aestivum mRNA for beta-1,3-endoglucanase
          Length = 1229

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 255  gctactggaaccggatggggtacgccggcgacttgtccgggttg 298
            |||||| |||| |||||  ||| |||||||||||||||||||||
Sbjct: 1034 gctacttgaactggatgttgtaggccggcgacttgtccgggttg 991
to top
>ref|NM_189718.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 996

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 272 gggtacgccggcgacttgtccgggttg 298
           |||||||||||||||||||| ||||||
Sbjct: 974 gggtacgccggcgacttgtcggggttg 948
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 272      gggtacgccggcgacttgtccgggttg 298
                |||||||||||||||||||| ||||||
Sbjct: 41368634 gggtacgccggcgacttgtcggggttg 41368608
to top
>dbj|AP004031.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0432C03
          Length = 164394

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 272   gggtacgccggcgacttgtccgggttg 298
             |||||||||||||||||||| ||||||
Sbjct: 60127 gggtacgccggcgacttgtcggggttg 60101
to top
>gb|M95407.1|MZE13BGLCN Wuglu; Zea mays; 1292 base-pairs
          Length = 1265

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            |||||||||| ||||||| ||||||||||||
Sbjct: 1061 gatggggtacaccggcgatttgtccgggttg 1031
to top
>gb|DQ147117.1| Zea diploperennis isolate d6 pathogenesis-related protein 6 (pr6)
            gene, complete cds
          Length = 1181

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            ||||||||| |||||||| ||||||||||||
Sbjct: 1130 gatggggtaagccggcgatttgtccgggttg 1100
to top
>gb|DQ147100.1| Zea mays subsp. parviglumis isolate p3 pathogenesis-related protein 6
            (pr6) gene, complete cds
          Length = 1186

 Score = 46.1 bits (23), Expect = 0.063
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 268  gatggggtacgccggcgacttgtccgggttg 298
            ||||||||| |||||||| ||||||||||||
Sbjct: 1135 gatggggtaagccggcgatttgtccgggttg 1105
to top
>gb|AF515785.1| Hordeum vulgare subsp. vulgare beta-1,3-glucanase II mRNA, complete
            cds
          Length = 1215

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 257  tactggaaccggatggggtacgccggcgacttgtccgggttg 298
            |||| |||| |||||  ||| |||||||||||||||||||||
Sbjct: 1053 tactagaactggatgttgtatgccggcgacttgtccgggttg 1012
to top
>gb|AF479647.2| Hordeum vulgare subsp. vulgare beta-1,3-glucanase gene, complete cds
          Length = 2135

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 257  tactggaaccggatggggtacgccggcgacttgtccgggttg 298
            |||| |||| |||||  ||| |||||||||||||||||||||
Sbjct: 1991 tactagaactggatgttgtatgccggcgacttgtccgggttg 1950
to top
>gb|AF030771.1|AF030771 Hordeum vulgare beta-1,3-glucanase 2 (BGL32) gene, complete cds
          Length = 1242

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 257  tactggaaccggatggggtacgccggcgacttgtccgggttg 298
            |||| |||| |||||  ||| |||||||||||||||||||||
Sbjct: 1188 tactagaactggatgttgtatgccggcgacttgtccgggttg 1147
to top
>emb|AJ271367.1|HVU271367 Hordeum vulgare mRNA for beta-1,3-glucanase
          Length = 1257

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 257  tactggaaccggatggggtacgccggcgacttgtccgggttg 298
            |||| |||| |||||  ||| |||||||||||||||||||||
Sbjct: 1056 tactagaactggatgttgtatgccggcgacttgtccgggttg 1015
to top
>gb|M62907.1|BLYCBGL32 H.vulgare L. (1-3)-beta-glucanase mRNA, complete cds
          Length = 1234

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 257  tactggaaccggatggggtacgccggcgacttgtccgggttg 298
            |||| |||| |||||  ||| |||||||||||||||||||||
Sbjct: 1055 tactagaactggatgttgtatgccggcgacttgtccgggttg 1014
to top
>gb|DQ090946.1| Triticum aestivum beta-1,3-glucanase mRNA, complete cds
          Length = 1338

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 278  gccggcgacttgtccgggttg 298
            |||||||||||||||||||||
Sbjct: 1064 gccggcgacttgtccgggttg 1044
to top
>gb|DQ078255.1| Triticum aestivum beta-1,3-glucanase mRNA, complete cds
          Length = 1337

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 278  gccggcgacttgtccgggttg 298
            |||||||||||||||||||||
Sbjct: 1063 gccggcgacttgtccgggttg 1043
to top
>gb|M23548.1|BLYGEH Hordeum vulgare 1,3-beta glucan endohydrolase precursor, mRNA,
            complete cds
          Length = 1250

 Score = 42.1 bits (21), Expect = 0.99
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 278  gccggcgacttgtccgggttg 298
            |||||||||||||||||||||
Sbjct: 1033 gccggcgacttgtccgggttg 1013
to top
>gb|DQ207707.1| Zea mays cultivar inbred line Mo17 IDP449 marker
          Length = 508

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 227 ttgacgtacgtacgcatgca 246
           ||||||||||||||||||||
Sbjct: 164 ttgacgtacgtacgcatgca 145
to top
>ref|XM_798356.1| Trypanosoma brucei TREU927 hypothetical protein (Tb09.160.0520)
            partial mRNA
          Length = 4818

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 189  tcctgcattatacgcagctt 208
            ||||||||||||||||||||
Sbjct: 4241 tcctgcattatacgcagctt 4222
to top
>gb|AC157561.10| Mus musculus chromosome 7, clone RP23-356A20, complete sequence
          Length = 232927

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 87     gcattgatctggttacacacttca 110
              ||||||||||||||||||| ||||
Sbjct: 106861 gcattgatctggttacacatttca 106884
to top
>dbj|AK153596.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630010I08 product:unclassifiable, full
           insert sequence
          Length = 1375

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 9   atctttctctttattcatga 28
           ||||||||||||||||||||
Sbjct: 327 atctttctctttattcatga 308
to top
>gb|AC154848.2| Mus musculus BAC clone RP23-38J19 from 13, complete sequence
          Length = 140465

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      atctttctctttattcatga 28
              ||||||||||||||||||||
Sbjct: 139940 atctttctctttattcatga 139921
to top
>emb|CT025639.13| Mouse DNA sequence from clone RP23-233I11 on chromosome 13, complete
              sequence
          Length = 219226

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      atctttctctttattcatga 28
              ||||||||||||||||||||
Sbjct: 150464 atctttctctttattcatga 150483
to top
>emb|AL772308.4| Mouse DNA sequence from clone RP23-451I21 on chromosome 15, complete
             sequence
          Length = 148496

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     aatatctttctctttattca 25
             ||||||||||||||||||||
Sbjct: 95328 aatatctttctctttattca 95309


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,892,266
Number of Sequences: 3902068
Number of extensions: 1892266
Number of successful extensions: 34835
Number of sequences better than 10.0: 49
Number of HSP's better than 10.0 without gapping: 49
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34767
Number of HSP's gapped (non-prelim): 68
length of query: 298
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 276
effective length of database: 17,147,199,772
effective search space: 4732627137072
effective search space used: 4732627137072
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top