ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet75f02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC105256.7| Mus musculus BAC clone RP23-413O13 from chromosome 8, complete sequence Length = 210086 Score = 44.1 bits (22), Expect = 0.024 Identities = 22/22 (100%) Strand = Plus / Plus Query: 2 actcacatgcatgcacaaacac 23 |||||||||||||||||||||| Sbjct: 201863 actcacatgcatgcacaaacac 201884
>emb|AL096863.13|HS1119I23 Human DNA sequence from clone RP5-1119I23 on chromosome 10, complete sequence Length = 98818 Score = 44.1 bits (22), Expect = 0.024 Identities = 22/22 (100%) Strand = Plus / Plus Query: 2 actcacatgcatgcacaaacac 23 |||||||||||||||||||||| Sbjct: 92341 actcacatgcatgcacaaacac 92362
>gb|AC156024.2| Mus musculus BAC clone RP23-89J1 from chromosome 16, complete sequence Length = 240451 Score = 44.1 bits (22), Expect = 0.024 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaaca 22 |||||||||||||||||||||| Sbjct: 190571 cactcacatgcatgcacaaaca 190592
>gb|AC136454.4| Mus musculus BAC clone RP24-340J10 from 8, complete sequence Length = 172160 Score = 44.1 bits (22), Expect = 0.024 Identities = 22/22 (100%) Strand = Plus / Minus Query: 2 actcacatgcatgcacaaacac 23 |||||||||||||||||||||| Sbjct: 169029 actcacatgcatgcacaaacac 169008
>gb|AC106834.9| Mus musculus chromosome 19, clone RP24-132H7, complete sequence Length = 177277 Score = 40.1 bits (20), Expect = 0.38 Identities = 23/24 (95%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacactgaac 28 |||||||||||||| ||||||||| Sbjct: 133853 cacatgcatgcacacacactgaac 133830
>gb|AC099594.6| Mus musculus chromosome 15, clone RP23-458G7, complete sequence Length = 220242 Score = 40.1 bits (20), Expect = 0.38 Identities = 23/24 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacact 24 |||||||||||||||||| ||||| Sbjct: 80533 cactcacatgcatgcacacacact 80510
>gb|AC103947.20| Mus musculus chromosome 19, clone RP23-261A21, complete sequence Length = 245390 Score = 40.1 bits (20), Expect = 0.38 Identities = 23/24 (95%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacactgaac 28 |||||||||||||| ||||||||| Sbjct: 46326 cacatgcatgcacacacactgaac 46303
>gb|AC125340.3| Mus musculus BAC clone RP24-364H15 from chromosome 1, complete sequence Length = 177161 Score = 40.1 bits (20), Expect = 0.38 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaa 20 |||||||||||||||||||| Sbjct: 109783 cactcacatgcatgcacaaa 109764
>gb|AC011352.6| Homo sapiens chromosome 5 clone CTC-327F10, complete sequence Length = 166644 Score = 40.1 bits (20), Expect = 0.38 Identities = 23/24 (95%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacactgaac 28 |||||||||||||| ||||||||| Sbjct: 86180 cacatgcatgcacacacactgaac 86203
>gb|AC061709.25| Homo sapiens 12 BAC RP11-417O18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 208524 Score = 40.1 bits (20), Expect = 0.38 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaa 20 |||||||||||||||||||| Sbjct: 100272 cactcacatgcatgcacaaa 100291
>emb|BX897748.11| Zebrafish DNA sequence from clone CH211-152M4 in linkage group 4, complete sequence Length = 64422 Score = 40.1 bits (20), Expect = 0.38 Identities = 23/24 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacact 24 |||||||||||||||||| ||||| Sbjct: 53392 cactcacatgcatgcacatacact 53369
>gb|AC140393.3| Mus musculus BAC clone RP24-179D17 from 14, complete sequence Length = 184279 Score = 40.1 bits (20), Expect = 0.38 Identities = 23/24 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacact 24 |||||||||||||||||| ||||| Sbjct: 101679 cactcacatgcatgcacacacact 101656
>emb|AL669926.6| Mouse DNA sequence from clone RP23-74K21 on chromosome 2, complete sequence Length = 226854 Score = 40.1 bits (20), Expect = 0.38 Identities = 23/24 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacact 24 |||||||||||||||||| ||||| Sbjct: 145489 cactcacatgcatgcacacacact 145466
>gb|AC163452.12| Mus musculus chromosome 19, clone RP23-405C7, complete sequence Length = 185406 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 42925 cacatgcatgcacaaacac 42943
>gb|AY369199.1| Monodelphis domestica microsatellite Mdo4L028 sequence Length = 403 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 111 cacatgcatgcacaaacac 129
>gb|AF035927.1| Rhomboplites aurorubens microsatellite DNA Ra5 Length = 298 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 141 cactcacatgcatgcacacacac 163
>gb|AY144363.1| Megalops atlanticus microsatellite Mat16 sequence Length = 650 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 221 cacatgcatgcacaaacac 239
>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence Length = 1618915 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||| |||||||||||||||||| Sbjct: 1302882 cactgacatgcatgcacaaacac 1302860
>gb|AC007863.15| Trypanosoma brucei chromosome 6 clone RPCI93-26G9, complete sequence Length = 140056 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||| |||||||||||||||||| Sbjct: 38031 cactgacatgcatgcacaaacac 38053
>gb|AC119897.8| Mus musculus chromosome 1, clone RP24-227F14, complete sequence Length = 195375 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 2000 cacatgcatgcacaaacac 1982
>gb|AC117721.8| Mus musculus chromosome 1, clone RP24-196D2, complete sequence Length = 170426 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 165330 cacatgcatgcacaaacac 165348
>gb|AC138382.10| Mus musculus chromosome 1, clone RP24-400E14, complete sequence Length = 136819 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 108496 cacatgcatgcacaaacac 108478
>gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 188458 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 99483 cacatgcatgcacaaacac 99501
>gb|AC093195.2| Drosophila melanogaster clone BACR16J09, complete sequence Length = 178863 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 8 atgcatgcacaaacactga 26 ||||||||||||||||||| Sbjct: 178641 atgcatgcacaaacactga 178623
>gb|AC008328.6| Drosophila melanogaster clone BACR09A04, complete sequence Length = 166722 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 8 atgcatgcacaaacactga 26 ||||||||||||||||||| Sbjct: 136888 atgcatgcacaaacactga 136870
>gb|AC131335.11| Mus musculus chromosome 8, clone RP23-32D9, complete sequence Length = 190133 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 182689 cactcacatgcatgcacacacac 182667
>gb|AC131107.3| Mus musculus BAC clone RP23-339P15 from chromosome 8, complete sequence Length = 214894 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 157447 cactcacatgcatgcacacacac 157469
>gb|AC113510.9| Mus musculus chromosome 5, clone RP23-378O9, complete sequence Length = 171806 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 23745 cactcacatgcatgcacacacac 23767
>gb|AC165313.7| Mus musculus chromosome 5, clone RP24-294J23, complete sequence Length = 137597 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 2 actcacatgcatgcacaaa 20 ||||||||||||||||||| Sbjct: 26410 actcacatgcatgcacaaa 26392
>gb|AC157928.4| Mus musculus chromosome 5, clone RP24-119I9, complete sequence Length = 157594 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 92683 cactcacatgcatgcacacacac 92705
>gb|AF233439.7| Homo sapiens chromosome 8 clones GS1-24F4, CTD-2629I16 map p23.1, complete sequences Length = 231283 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 9569 cacatgcatgcacaaacac 9551
>gb|AC115860.9| Mus musculus chromosome 1, clone RP24-290C11, complete sequence Length = 240785 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 5901 cacatgcatgcacaaacac 5919
>gb|AC103379.8| Mus musculus chromosome 13, clone RP24-245I24, complete sequence Length = 170688 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 54520 cacatgcatgcacaaacac 54502 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 54504 cacatgcatgcacaaacac 54486
>gb|AC165335.3| Mus musculus BAC clone RP24-481H19 from chromosome 5, complete sequence Length = 212783 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2 actcacatgcatgcacaaa 20 ||||||||||||||||||| Sbjct: 134754 actcacatgcatgcacaaa 134772
>gb|AC102575.11| Mus musculus chromosome 14, clone RP23-239P22, complete sequence Length = 238123 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 190210 cacatgcatgcacaaacac 190228
>gb|AC113022.7| Mus musculus chromosome 5, clone RP23-187D22, complete sequence Length = 210968 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 173540 cacatgcatgcacaaacac 173522
>gb|AC118545.20| Mus musculus strain C57BL/6J clone rp23-324o14 map 17, complete sequence Length = 236365 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 167601 cactcacatgcatgcacacacac 167579
>gb|AC144861.3| Mus musculus BAC clone RP23-63D4 from chromosome 18, complete sequence Length = 176312 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 103243 cactcacatgcatgcacacacac 103221
>emb|CT025566.7| Mouse DNA sequence from clone RP24-151A22 on chromosome 13, complete sequence Length = 149381 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 110320 cacatgcatgcacaaacac 110302 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 110304 cacatgcatgcacaaacac 110286
>emb|CT025565.5| Mouse DNA sequence from clone RP24-126K5 on chromosome 17, complete sequence Length = 175523 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 68700 cactcacatgcatgcacacacac 68678
>gb|AC137511.3| Mus musculus BAC clone RP24-313I8 from chromosome 5, complete sequence Length = 168197 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 117033 cacatgcatgcacaaacac 117015
>gb|AC140222.3| Mus musculus BAC clone RP24-330A7 from chromosome 9, complete sequence Length = 145102 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 8 atgcatgcacaaacactga 26 ||||||||||||||||||| Sbjct: 69073 atgcatgcacaaacactga 69091
>gb|AC129018.4| Mus musculus BAC clone RP24-463L19 from chromosome 10, complete sequence Length = 169100 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacactgaa 27 |||||||||||||| |||||||| Sbjct: 61435 cacatgcatgcacatacactgaa 61413
>gb|AC131730.2| Mus musculus BAC clone RP23-115A5 from chromosome 5, complete sequence Length = 218708 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 ||||||||||||| ||||||||| Sbjct: 92608 cactcacatgcatacacaaacac 92586
>gb|AC002519.1|HUAC002519 Human Chromosome 16 BAC clone CIT987SK-A-355G7, complete sequence Length = 139958 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 136952 cacatgcatgcacaaacac 136934
>gb|AC116996.3| Mus musculus BAC clone RP23-6B22 from 15, complete sequence Length = 229669 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 182347 cacatgcatgcacaaacac 182365
>gb|AC114916.5| Mus musculus BAC clone RP23-68E10 from 15, complete sequence Length = 207411 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 163029 cacatgcatgcacaaacac 163011
>gb|AC145966.2| Pan troglodytes BAC clone RP43-17M9 from 7, complete sequence Length = 197140 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 90550 cacatgcatgcacaaacac 90532
>gb|AC116709.4| Mus musculus chromosome 1, clone RP23-91L14, complete sequence Length = 188848 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 78261 cacatgcatgcacaaacac 78243
>gb|AC002382.1| Homo sapiens BAC clone CTB-22J17 from 7, complete sequence Length = 125590 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 38838 cacatgcatgcacaaacac 38856
>gb|AC087175.6| Homo sapiens BAC clone RP11-139E5 from 7, complete sequence Length = 22996 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 11030 cacatgcatgcacaaacac 11012
>gb|AC116142.8| Mus musculus chromosome 5, clone RP23-140B23, complete sequence Length = 187461 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 139824 cacatgcatgcacaaacac 139842
>gb|AC160106.2| Mus musculus BAC clone RP24-300H23 from chromosome 13, complete sequence Length = 184364 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 11348 cacatgcatgcacaaacac 11330
>gb|AC163225.4| Mus musculus chromosome 8, clone RP23-319L22, complete sequence Length = 192661 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 39442 cacatgcatgcacaaacac 39424
>emb|AL732314.18| Human DNA sequence from clone RP13-465B17 on chromosome X Contains the 5' end of the gene for protein phosphatase 2A 48 kDa regulatory subunit (PR48), a fatty acid binding protein 5 (psoriasis-associated) (FABP5) pseudogene, a pseudogene similar to part of keratin 18 (KRT18) and nine CpG islands, complete sequence Length = 218723 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 79095 cactcacatgcatgcacacacac 79073 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 78787 cactcacatgcatgcaca 78770
>emb|Z97988.1|HS491M17 Human DNA sequence from clone RP3-491M17 on chromosome 1p36.2-36.3, complete sequence Length = 86535 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 84077 cacatgcatgcacaaacac 84059
>emb|AL442125.13| Human DNA sequence from clone RP11-230F18 on chromosome 13 Contains the 5' end of the gene for FLJ10704 (FLJ20092), a novel gene, a novel gene (FLJ20623), the TFDP1 gene for transcription factor Dp-1 (DP-1, DRTF1) and 5 CpG islands, complete sequence Length = 184889 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 73841 cacatgcatgcacaaacac 73823
>emb|AL353789.18| Human DNA sequence from clone RP11-570F6 on chromosome 13 Contains the 5' end of the WASF3 gene for WAS protein family, member 3 (WASP family Verprolin-homologous protein 3(SCAR3, Scar3, WAVE3, KIAA0900)), a ribosomal protein S3A (RPS3A)(FTE1) pseudogene and a CpG island, complete sequence Length = 166787 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 35713 cacatgcatgcacaaacac 35695
>gb|AC158960.4| Mus musculus chromosome 1, clone RP23-315O2, complete sequence Length = 176947 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 66254 cacatgcatgcacaaacac 66236
>emb|AL133376.6| Human DNA sequence from clone RP1-76K20 on chromosome 11p13-14.3 Contains GSSs, complete sequence Length = 99228 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 31966 cacatgcatgcacaaacac 31948
>emb|AL078584.17|HSJ245M18 Human DNA sequence from clone RP1-245M18 on chromosome 6p21.32-22.3 Contains the 5' end of the gene for chromosome 6 open reading frame 32 (PL48, DIFF40, DIFF48, KIAA0386), a cytochrome c oxidase polypeptide II pseudogene and a CpG island, complete sequence Length = 104770 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 4 tcacatgcatgcacaaaca 22 ||||||||||||||||||| Sbjct: 9375 tcacatgcatgcacaaaca 9393
>gb|AC159291.3| Mus musculus BAC clone RP23-287P9 from chromosome 5, complete sequence Length = 197357 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2 actcacatgcatgcacaaa 20 ||||||||||||||||||| Sbjct: 10933 actcacatgcatgcacaaa 10951
>gb|AC164662.6| Mus musculus 10 BAC RP24-279D11 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 154482 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 58803 cacatgcatgcacaaacac 58821
>emb|AL645682.14| Mouse DNA sequence from clone RP23-287B22 on chromosome 11 Contains a CpG island, complete sequence Length = 198340 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 124164 cacatgcatgcacaaacac 124182
>emb|BX950854.12| Zebrafish DNA sequence from clone CH211-125M22, complete sequence Length = 171896 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 169220 cactcacatgcatgcacacacac 169242
>emb|AL589699.4| Mouse DNA sequence from clone RP23-92G13 on chromosome 13 Contains the 3' end of the gene for a novel protein similar to KIAA0386, five novel genes, the Gmnn gene for geminin, gene PNAS-27, the Ttrap gene for Traf and Tnf receptor associated protein, the gene for a novel protein similar to KIAA0319, the gene for the ortholog of human and rat aldehyde dehydrogenase 5A1 (succinate-semialdehyde dehydrogenase) (ALDH5A1) (SSADH), the 5' end of the Gpld1 gene for glycosylphosphatidylinositol specific phospholipase D1 and four CpG islands, complete sequence Length = 256608 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaa 19 ||||||||||||||||||| Sbjct: 223621 cactcacatgcatgcacaa 223639
>gb|AC009659.5| Homo sapiens chromosome 11, clone RP11-362G8, complete sequence Length = 175372 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 48138 cacatgcatgcacaaacac 48120
>gb|AC104561.3| Homo sapiens chromosome 8, clone CTC-756D1, complete sequence Length = 155366 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 123274 cacatgcatgcacaaacac 123256
>gb|AC079904.31| Homo sapiens 12 BAC RP11-84J24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 197964 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 11296 cactcacatgcatgcacacacac 11318
>gb|AC025571.20| Homo sapiens 3 BAC RP11-515C21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 159902 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 66965 cactcacatgcatgcacagacac 66987
>gb|AC074050.3| Homo sapiens chromosome 16 clone CTD-2358C21, complete sequence Length = 73661 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 27870 cacatgcatgcacaaacac 27852
>gb|AC010867.8| Homo sapiens chromosome 15 clone RP11-390M11 map 15q21.3, complete sequence Length = 221631 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 10384 cactcacatgcatgcacacacac 10362
>gb|AC153553.4| Mus musculus 10 BAC RP23-329D17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 185583 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 95363 cacatgcatgcacaaacac 95381
>emb|BX950219.10| Mouse DNA sequence from clone RP23-303E24 on chromosome 4, complete sequence Length = 167874 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 114631 cactcacatgcatgcacatacac 114653
>gb|AC115847.19| Mus musculus chromosome 5, clone RP24-245J15, complete sequence Length = 182243 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 32787 cacatgcatgcacaaacac 32805
>gb|AC084759.2|AC084759 Homo sapiens chromosome 15 clone RP11-643A5 map 15q21.3, complete sequence Length = 173921 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 173204 cactcacatgcatgcacacacac 173182
>gb|AC008329.3|AC008329 Drosophila melanogaster, chromosome 2L, region 28C-28D, BAC clone BACR31D05, complete sequence Length = 172633 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 8 atgcatgcacaaacactga 26 ||||||||||||||||||| Sbjct: 37645 atgcatgcacaaacactga 37627
>gb|AF532115.1| Mus musculus strain 129/SvJ BAC clone citb553n23 from the MHC region, complete sequence Length = 161729 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacactgaa 27 |||||||||||||| |||||||| Sbjct: 123276 cacatgcatgcacacacactgaa 123298
>gb|AF532112.1| Mus musculus strain 129/SvJ BAC clone citb20h22 from the MHC region, complete sequence Length = 172199 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacactgaa 27 |||||||||||||| |||||||| Sbjct: 50584 cacatgcatgcacacacactgaa 50606
>gb|AC108866.5| Homo sapiens BAC clone RP11-44D21 from 4, complete sequence Length = 152822 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 3494 cacatgcatgcacaaacac 3512
>gb|AC093771.3| Homo sapiens BAC clone RP11-121I23 from 4, complete sequence Length = 165420 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 14302 cacatgcatgcacaaacac 14284
>gb|AC102022.8| Mus musculus chromosome 8, clone RP24-67K5, complete sequence Length = 156728 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 54745 cacatgcatgcacaaacac 54727
>gb|AC154337.2| Mus musculus BAC clone RP23-254P20 from chromosome 17, complete sequence Length = 182101 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 142000 cactcacatgcatgcacacacac 142022
>gb|AC154610.3| Mus musculus BAC clone RP23-335A11 from chromosome 13, complete sequence Length = 201893 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 175159 cacatgcatgcacaaacac 175141
>gb|AC079612.6| Homo sapiens BAC clone RP11-314A6 from 2, complete sequence Length = 118368 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 72313 cactcacatgcatgcacacacac 72291 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 88826 cacatgcatgcacaaaca 88809
>gb|AC078988.18| Homo sapiens X BAC RP11-169J21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 169849 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 27463 cacatgcatgcacaaacac 27445
>gb|AC140183.2| Mus musculus BAC clone RP24-350N4 from chromosome 9, complete sequence Length = 181029 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 88310 cacatgcatgcacaaacac 88328
>emb|BX530080.5| Zebrafish DNA sequence from clone CH211-191O15 in linkage group 14, complete sequence Length = 165220 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 111897 cacatgcatgcacaaacac 111879
>gb|AC006229.17|AC006229 Homo sapiens chromosome 4 clone C0011D19, complete sequence Length = 186373 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 100446 cacatgcatgcacaaacac 100428
>gb|AC154557.2| Mus musculus BAC clone RP23-425M9 from 17, complete sequence Length = 186378 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 123039 cacatgcatgcacaaacac 123057 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 122952 acatgcatgcacaaacac 122969
>gb|AC154609.2| Mus musculus BAC clone RP23-334N13 from 16, complete sequence Length = 202556 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 187687 cacatgcatgcacaaacac 187669
>gb|AC153496.4| Mus musculus 10 BAC RP23-373D1 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 149839 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 72326 cacatgcatgcacaaacac 72308
>gb|AC156387.5| Mus musculus 10 BAC RP24-396H15 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 230270 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 61324 cacatgcatgcacaaacac 61342
>gb|AC122205.6| Mus musculus BAC clone RP23-76C13 from chromosome 8, complete sequence Length = 249808 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 26988 cacatgcatgcacaaacac 27006
>gb|AE003619.3| Drosophila melanogaster chromosome 2L, section 28 of 83 of the complete sequence Length = 289516 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 8 atgcatgcacaaacactga 26 ||||||||||||||||||| Sbjct: 8035 atgcatgcacaaacactga 8017
>gb|AC116555.23| Mus musculus strain C57BL/6J clone rp23-160b14 map 8, complete sequence Length = 209784 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 5295 cacatgcatgcacaaacac 5277
>gb|AC116782.11| Mus musculus chromosome 5, clone RP24-145A24, complete sequence Length = 167925 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 63163 cactcacatgcatgcacacacac 63185
>gb|AC121504.14| Mus musculus chromosome 13, clone RP24-140A15, complete sequence Length = 156791 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 34354 cacatgcatgcacaaacac 34336
>dbj|AP003464.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-768K4, complete sequence Length = 148000 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 36956 cacatgcatgcacaaacac 36938
>gb|AC091484.8| Mus musculus strain C57BL/6J chromosome 17 clone rp23-386a1, complete sequence Length = 205343 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 61613 cactcacatgcatgcacacacac 61591
>gb|AC005960.1|AC005960 Mus musculus chromosome 17 BAC citb20h22 from the MHC region, complete sequence Length = 158414 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacactgaa 27 |||||||||||||| |||||||| Sbjct: 50566 cacatgcatgcacacacactgaa 50588
>gb|AC004723.1|AC004723 Drosophila melanogaster, chromosome 2L, region 28C4-28D2, P1 clone DS00289, complete sequence Length = 52277 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 8 atgcatgcacaaacactga 26 ||||||||||||||||||| Sbjct: 3547 atgcatgcacaaacactga 3529
>gb|AC003106.1|AC003106 Homo sapiens Xp22 GS-524I1 (Genome Systems Human BAC library), complete sequence Length = 128888 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 104001 cacatgcatgcacaaacac 104019
>emb|AL824712.8| Mouse DNA sequence from clone RP23-430M12 on chromosome 4, complete sequence Length = 33400 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 8051 cactcacatgcatgcacacacac 8073
>gb|AC162949.7| Mus musculus BAC clone RP23-8D10 from chromosome 8, complete sequence Length = 228830 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 77572 cacatgcatgcacaaacac 77554
>gb|AC137708.16| Mus musculus chromosome 3, clone RP24-277H8, complete sequence Length = 154779 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 25003 cacatgcatgcacaaacac 25021
>emb|AL772270.24| Mouse DNA sequence from clone RP23-272I16 on chromosome 4, complete sequence Length = 146140 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaacac 23 |||||||||||||||||| |||| Sbjct: 21287 cactcacatgcatgcacatacac 21265
>emb|AL929199.11| Mouse DNA sequence from clone RP23-458A10 on chromosome 2, complete sequence Length = 95855 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 93016 cacatgcatgcacaaacac 92998
>emb|CT030155.10| Mouse DNA sequence from clone RP23-425N11 on chromosome 17, complete sequence Length = 189713 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 156926 cacatgcatgcacaaacac 156944 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 156839 acatgcatgcacaaacac 156856
>emb|CR956641.9| Mouse DNA sequence from clone RP23-77N9 on chromosome 17, complete sequence Length = 202624 Score = 38.2 bits (19), Expect = 1.5 Identities = 22/23 (95%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacactgaa 27 |||||||||||||| |||||||| Sbjct: 134989 cacatgcatgcacacacactgaa 134967
>emb|AL672244.15| Mouse DNA sequence from clone RP23-43I8 on chromosome 16, complete sequence Length = 243114 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 75523 cacatgcatgcacaaacac 75505
>emb|AL607074.13| Mouse DNA sequence from clone RP23-174M9 on chromosome 4, complete sequence Length = 204428 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 39774 cacatgcatgcacaaacac 39792
>emb|AL596116.14| Mouse DNA sequence from clone RP23-317F9 on chromosome 11, complete sequence Length = 217735 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 215969 cacatgcatgcacaaacac 215951
>emb|AL808103.8| Mouse DNA sequence from clone RP23-301G2 on chromosome 4, complete sequence Length = 232070 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 95174 cacatgcatgcacaaacac 95156
>emb|AL606746.17| Mouse DNA sequence from clone RP23-423J10 on chromosome 3, complete sequence Length = 203345 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 42275 cacatgcatgcacaaacac 42257
>emb|AL513345.20| Mouse DNA sequence from clone RP23-129N7 on chromosome 15, complete sequence Length = 217225 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 200148 cacatgcatgcacaaacac 200166
>emb|AL671975.12| Mouse DNA sequence from clone RP23-25O15 on chromosome X, complete sequence Length = 231530 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 212793 cacatgcatgcacaaacac 212775
>gb|AC087859.3| Homo sapiens chromosome 3 clone RP11-34L16 map 3p, complete sequence Length = 151927 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 57961 cacatgcatgcacaaacac 57943
>gb|AC116729.14| Mus musculus chromosome 3, clone RP23-346I1, complete sequence Length = 224088 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 23047 cacatgcatgcacaaacac 23065
>emb|AL645905.11| Mouse DNA sequence from clone RP23-19M18 on chromosome 11, complete sequence Length = 99317 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 234 cacatgcatgcacaaacac 216
>emb|AL627073.15| Mouse DNA sequence from clone RP23-234E14 on chromosome 4, complete sequence Length = 137991 Score = 38.2 bits (19), Expect = 1.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaacac 23 ||||||||||||||||||| Sbjct: 18353 cacatgcatgcacaaacac 18371
>gb|AC161376.2| Mus musculus BAC clone RP23-264M10 from chromosome 16, complete sequence Length = 199086 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 70933 acatgcatgcacaaacac 70950
>gb|AC102739.7| Mus musculus chromosome 5, clone RP24-309H3, complete sequence Length = 191542 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 15548 cactcacatgcatgcaca 15565
>gb|AC101689.12| Mus musculus chromosome 1, clone RP23-217C21, complete sequence Length = 189241 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 19379 cactcacatgcatgcaca 19396
>gb|AC165353.4| Mus musculus BAC clone RP23-167C2 from chromosome 3, complete sequence Length = 198393 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 85812 acatgcatgcacaaacac 85829
>gb|AC139867.4| Mus musculus BAC clone RP23-430P22 from chromosome 1, complete sequence Length = 224730 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 109881 cactcacatgcatgcaca 109898
>gb|AC166346.5| Mus musculus BAC clone RP24-83P13 from chromosome 16, complete sequence Length = 199678 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 70732 cactcacatgcatgcaca 70715
>gb|AC164302.2| Mus musculus BAC clone RP23-286N12 from chromosome 16, complete sequence Length = 192765 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Minus Query: 1 cactcacatgcatgcacaaaca 22 ||||||||||| |||||||||| Sbjct: 137718 cactcacatgcgtgcacaaaca 137697
>gb|AC158397.2| Mus musculus BAC clone RP23-274H19 from chromosome 16, complete sequence Length = 197843 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaaca 22 ||||||||||||| |||||||| Sbjct: 71367 cactcacatgcatacacaaaca 71388
>gb|AC166832.2| Mus musculus BAC clone RP23-220N17 from chromosome 16, complete sequence Length = 172644 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 101469 cactcacatgcatgcaca 101452
>gb|AC147651.4| Homo sapiens BAC clone RP13-689E11 from 7, complete sequence Length = 162139 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 112231 cactcacatgcatgcaca 112248
>gb|AC116800.11| Mus musculus chromosome 8, clone RP24-335D17, complete sequence Length = 168912 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 56835 cactcacatgcatgcaca 56852
>gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, complete sequence Length = 191054 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 90804 cactcacatgcatgcaca 90821
>gb|AC107786.14| Mus musculus chromosome 5, clone RP23-5E3, complete sequence Length = 226673 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 201703 acatgcatgcacaaacac 201686
>gb|AC150524.3| Bos taurus BAC CH240-89P8 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 189720 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Minus Query: 2 actcacatgcatgcacaaacac 23 ||||||||||||||||| |||| Sbjct: 182285 actcacatgcatgcacacacac 182264
>gb|AC101956.5| Mus musculus chromosome 5, clone RP24-166L23, complete sequence Length = 183807 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 151596 cacatgcatgcacaaaca 151579
>gb|AC122556.15| Mus musculus chromosome 12, clone RP24-352D3, complete sequence Length = 167088 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 161237 cactcacatgcatgcaca 161220
>gb|AC124998.10| Mus musculus chromosome 10, clone RP24-350B12, complete sequence Length = 185801 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 27342 cactcacatgcatgcaca 27359
>gb|AC125583.3| Rattus norvegicus 4 BAC CH230-1A7 (Children's Hospital Oakland Research Institute) complete sequence Length = 205786 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 196876 cactcacatgcatgcaca 196859
>ref|NM_008966.3| Mus musculus prostaglandin F receptor (Ptgfr), mRNA Length = 4414 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 4015 cactcacatgcatgcaca 3998
>gb|AC117693.9| Mus musculus chromosome 1, clone RP23-448D22, complete sequence Length = 193386 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 25209 acatgcatgcacaaacac 25192
>gb|AC117627.16| Mus musculus chromosome 1, clone RP23-116N6, complete sequence Length = 201995 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 144250 acatgcatgcacaaacac 144233
>gb|AC132248.3| Mus musculus BAC clone RP24-425H24 from chromosome 7, complete sequence Length = 195294 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 143456 cactcacatgcatgcaca 143439
>gb|AC102217.9| Mus musculus chromosome 1, clone RP24-160A23, complete sequence Length = 214578 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 125282 cactcacatgcatgcaca 125265
>gb|AC118476.15| Mus musculus chromosome 9, clone RP23-242K3, complete sequence Length = 197683 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 137929 cactcacatgcatgcaca 137946
>gb|AC114539.8| Mus musculus chromosome 19, clone RP23-62I23, complete sequence Length = 249767 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 179688 cactcacatgcatgcaca 179705
>gb|AC152166.4| Mus musculus BAC clone RP23-425A3 from chromosome 7, complete sequence Length = 216652 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 102581 cactcacatgcatgcaca 102564
>gb|AC113495.15| Mus musculus chromosome 9, clone RP23-361O11, complete sequence Length = 195356 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 5794 acatgcatgcacaaacac 5811
>gb|AC107846.4| Mus musculus chromosome 1, clone RP23-309I23, complete sequence Length = 178870 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 43299 acatgcatgcacaaacac 43316
>gb|AC148980.6| Mus musculus BAC clone RP23-230C16 from chromosome 7, complete sequence Length = 192433 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 116768 cactcacatgcatgcaca 116751
>gb|AC138791.3| Mus musculus BAC clone RP23-222G6 from chromosome 7, complete sequence Length = 203288 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 177954 cactcacatgcatgcaca 177937
>gb|AC125079.3| Mus musculus chromosome 16 clone RP23-480M17, complete sequence Length = 174536 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 80635 cacatgcatgcacaaaca 80652
>gb|AC113483.7| Mus musculus chromosome 1, clone RP23-343E12, complete sequence Length = 207188 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 143532 cacatgcatgcacaaaca 143549
>emb|CT010581.10| Mouse DNA sequence from clone RP23-104J14 on chromosome 16, complete sequence Length = 218225 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 63879 cactcacatgcatgcaca 63862
>gb|AC121920.3| Mus musculus BAC clone RP24-196F6 from chromosome 7, complete sequence Length = 159469 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 128034 cacatgcatgcacaaaca 128051
>gb|AC123055.3| Mus musculus BAC clone RP24-267D17 from chromosome 3, complete sequence Length = 187323 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 61399 cactcacatgcatgcaca 61416
>gb|AC132464.3| Mus musculus BAC clone RP23-53K19 from chromosome 18, complete sequence Length = 175801 Score = 36.2 bits (18), Expect = 6.0 Identities = 24/26 (92%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacactga 26 ||||||||||||| |||| ||||||| Sbjct: 114115 cactcacatgcatacacacacactga 114140
>gb|AC122199.4| Mus musculus BAC clone RP23-57C9 from chromosome 8, complete sequence Length = 202975 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 97706 cactcacatgcatgcaca 97689 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 97690 cactcacatgcatgcaca 97673
>gb|AC129020.4| Mus musculus BAC clone RP23-234A5 from chromosome 16, complete sequence Length = 192668 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 156307 cactcacatgcatgcaca 156290
>gb|AC126688.4| Mus musculus BAC clone RP23-152P20 from chromosome 7, complete sequence Length = 205673 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Plus Query: 2 actcacatgcatgcacaaacac 23 ||||||||||||||||| |||| Sbjct: 19015 actcacatgcatgcacacacac 19036
>gb|AC124543.4| Mus musculus BAC clone RP23-264A21 from chromosome 15, complete sequence Length = 224760 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 92861 cactcacatgcatgcaca 92844
>gb|AC131080.13| Mus musculus chromosome 16, clone RP23-438H16, complete sequence Length = 192584 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 18965 cactcacatgcatgcaca 18948
>gb|AC123034.5| Mus musculus BAC clone RP24-484E17 from chromosome 13, complete sequence Length = 177675 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 145129 cacatgcatgcacaaaca 145146
>gb|AC124456.5| Mus musculus BAC clone RP24-134C11 from chromosome 9, complete sequence Length = 148114 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 117400 acatgcatgcacaaacac 117383
>gb|AC124502.4| Mus musculus BAC clone RP23-414G6 from chromosome 19, complete sequence Length = 219212 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 125199 cactcacatgcatgcaca 125182
>gb|AC132597.3| Mus musculus BAC clone RP24-180D17 from chromosome 5, complete sequence Length = 162871 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 122897 cacatgcatgcacaaaca 122914
>emb|CR938718.3| Pig DNA sequence from clone CH242-2F11, complete sequence Length = 170585 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 84922 cactcacatgcatgcaca 84939
>gb|AC125206.3| Mus musculus BAC clone RP23-240G3 from 10, complete sequence Length = 184252 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 7064 cactcacatgcatgcaca 7047
>gb|AC084384.1| Mus musculus BAC clone RP23-24F24 from 15, complete sequence Length = 208833 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 172758 acatgcatgcacaaacac 172775
>gb|AC098745.4| Mus musculus BAC clone RP23-122P16 from 18, complete sequence Length = 213331 Score = 36.2 bits (18), Expect = 6.0 Identities = 24/26 (92%) Strand = Plus / Plus Query: 1 cactcacatgcatgcacaaacactga 26 ||||||||||||| |||| ||||||| Sbjct: 12608 cactcacatgcatacacacacactga 12633
>gb|AY442346.1| Homo sapiens insulin-like growth factor binding protein 4 (IGFBP4) gene, complete cds Length = 16904 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Minus Query: 2 actcacatgcatgcacaaacac 23 ||||||||||||||||| |||| Sbjct: 16339 actcacatgcatgcacacacac 16318
>gb|AC113270.8| Mus musculus chromosome 7, clone RP23-375O10, complete sequence Length = 175280 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 8002 cacatgcatgcacaaaca 8019
>gb|AC107736.10| Mus musculus chromosome 7, clone RP23-354B2, complete sequence Length = 272413 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 790 cacatgcatgcacaaaca 773
>gb|AC155171.7| Mus musculus BAC clone RP23-100A10 from chromosome 7, complete sequence Length = 193027 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 182497 cactcacatgcatgcaca 182514
>gb|AC159140.10| Mus musculus chromosome 7, clone RP24-84I4, complete sequence Length = 202318 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 168346 cactcacatgcatgcaca 168329
>gb|AC163105.5| Mus musculus BAC clone RP23-259A11 from chromosome 14, complete sequence Length = 227806 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 131470 cactcacatgcatgcaca 131487
>gb|AC126071.5| Rattus norvegicus 10 BAC CH230-209B21 (Children's Hospital Oakland Research Institute) complete sequence Length = 227741 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 153241 acatgcatgcacaaacac 153224
>emb|AL451056.11| Human DNA sequence from clone RP13-449N13 on chromosome 10, complete sequence Length = 31951 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaacactga 26 |||||||||||||| ||||||| Sbjct: 11828 cacatgcatgcacacacactga 11807
>emb|AL354743.33| Human DNA sequence from clone RP4-785P20 on chromosome 1p36.23-36.33 Contains the 3' end of the PRDM16 gene for PR domain containing 16 and two CpG islands, complete sequence Length = 140572 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 2838 cactcacatgcatgcaca 2821
>gb|AC096626.31| Mus musculus strain C57BL/6J clone rp23-423p15 map 1, complete sequence Length = 208247 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 194638 cacatgcatgcacaaaca 194655
>gb|AF462446.1| Homo sapiens unknown mRNA Length = 1666 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 231 cactcacatgcatgcaca 214
>emb|AL139119.18| Human DNA sequence from clone RP11-18M11 on chromosome 10 Contains a eukaryotic translational initiation factor 2A pseudogene and part of a novel gene, complete sequence Length = 93324 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 69568 cacatgcatgcacaaaca 69551
>gb|AC018629.12| Homo sapiens chromosome 17, clone RP11-58O9, complete sequence Length = 166234 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Minus Query: 2 actcacatgcatgcacaaacac 23 ||||||||||||||||| |||| Sbjct: 114146 actcacatgcatgcacacacac 114125
>emb|AL096708.34|HS1179L24 Human DNA sequence from clone RP5-1179L24 on chromosome 6q24.3-25.3 Contains the PPP1R14C gene for protein phosphatase 1 regulatory (inhibitor) subunit 14C (KEPI NY-BR-81 CPI17-like), complete sequence Length = 107104 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 32886 cactcacatgcatgcaca 32869
>emb|AL049575.7|HSDJ316D7 Human DNA sequence from clone RP1-316D7 on chromosome 11p13 Contains part of the gene for G2 protein, ESTs, STSs and GSSs, complete sequence Length = 94835 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 21285 acatgcatgcacaaacac 21268
>gb|AC156555.8| Mus musculus chromosome 7, clone RP23-59P20, complete sequence Length = 247652 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 221703 cacatgcatgcacaaaca 221720
>gb|AC159974.7| Mus musculus chromosome 1, clone RP24-266D16, complete sequence Length = 158901 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 22284 acatgcatgcacaaacac 22267
>emb|AL713870.26| Mouse DNA sequence from clone RP24-239D8 on chromosome 11 Contains the 5' end of the Slc36a3 gene for solute carrier family 36 (proton/amino acid symporter) member 3, two novel genes, the Tramd1 gene for tramdorin 1 (transmembrane domain rich protein), the Slc36a1 gene for solute carrier family 36 (proton/amino acid symporter) member 1 and the gene for the ortholog of human and rat FAT tumor suppressor homolog 2 (Drosophila) FAT2, complete sequence Length = 188782 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 39401 cactcacatgcatgcaca 39384
>emb|AL604031.10| Mouse DNA sequence from clone RP23-24O5 on chromosome 11 Contains a ribosomal protein L13 (Rpl13) pseudogene, a novel gene and two CpG islands, complete sequence Length = 215675 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 178910 acatgcatgcacaaacac 178893
>emb|CR749745.16| Zebrafish DNA sequence from clone DKEY-7O20 in linkage group 5, complete sequence Length = 110199 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 48138 acatgcatgcacaaacac 48121
>emb|CR937047.1|RN510H6 Rattus norvegicus chromosome 5 BAC CH230-510H6, complete sequence Length = 188516 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 15486 cactcacatgcatgcaca 15503
>emb|CR936739.1| Homo sapiens mRNA; cDNA DKFZp781M0898 (from clone DKFZp781M0898) Length = 5020 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 709 cactcacatgcatgcaca 726
>emb|AL731728.10| Mouse DNA sequence from clone RP24-531N10 on chromosome 11 Contains part of the Car10 gene for carbonic anhydrase 10, complete sequence Length = 146735 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 1293 acatgcatgcacaaacac 1276
>emb|AL672013.9| Mouse DNA sequence from clone RP23-32G8 on chromosome 11 Contains the 3' end of the Ebf1 gene for early B-cell factor 1 and a novel gene, complete sequence Length = 207905 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 148096 cactcacatgcatgcaca 148113
>emb|AL669946.9| Mouse DNA sequence from clone RP23-71G18 on chromosome 11 Contains the 3' end of a novel gene, the Nsg2 gene neuron specific gene family, a novel gene and a CpG island, complete sequence Length = 177182 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 169811 cactcacatgcatgcaca 169828 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 101892 cactcacatgcatgcaca 101875
>emb|AL646096.8| Mouse DNA sequence from clone RP23-176J13 on chromosome 11 Contains the 5' end of the Scpep1 gene for serine carboxypeptidase 1, two transcription elongation factor B (SIII) polypeptide 2 (Tceb2) pseudogenes, four novel genes (incl. A930013B10Rik), the Coil gene for coilin, the Trim25 gene for tripartite motif protein 25 and the Dgke gene for diacylglycerol kinase epsilon, complete sequence Length = 171512 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 160255 acatgcatgcacaaacac 160272
>emb|AL646002.6| Mouse DNA sequence from clone RP23-237P10 on chromosome 11 Contains gene D930008C07Rik, the Canx gene for calnexin, a high mobility group nucleosomal binding domain 2 (Hmgn2) pseudogene and two CpG islands, complete sequence Length = 113907 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 79834 cacatgcatgcacaaaca 79851
>emb|AL731849.5| Mouse DNA sequence from clone RP23-208A2 on chromosome 11 Contains part of the Car10 gene for carbonic anhydrase 10, complete sequence Length = 114636 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 113929 acatgcatgcacaaacac 113912
>emb|BX640499.5| Zebrafish DNA sequence from clone DKEYP-67D2 in linkage group 9, complete sequence Length = 184606 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 3 ctcacatgcatgcacaaa 20 |||||||||||||||||| Sbjct: 100559 ctcacatgcatgcacaaa 100576
>gb|AC094105.3| Homo sapiens chromosome 5 clone RP11-468D11, complete sequence Length = 186314 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 69901 acatgcatgcacaaacac 69884
>gb|AC118003.21| Mus musculus chromosome 5, clone RP23-146G20, complete sequence Length = 176116 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 29948 cacatgcatgcacaaaca 29931
>gb|AC162615.2| Mus musculus chromosome 7, clone RP23-94C20, complete sequence Length = 130735 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 21269 cacatgcatgcacaaaca 21286
>gb|AC158746.8| Mus musculus chromosome 1, clone RP23-50E17, complete sequence Length = 245991 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 27292 cacatgcatgcacaaaca 27309
>gb|AC154697.2| Mus musculus BAC clone RP23-136A22 from chromosome 13, complete sequence Length = 202379 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 45252 acatgcatgcacaaacac 45235
>gb|AC164568.1| Mus musculus BAC clone RP23-7A23 from chromosome 14, complete sequence Length = 227675 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Minus Query: 3 ctcacatgcatgcacaaacact 24 |||||||||||||| ||||||| Sbjct: 94965 ctcacatgcatgcaaaaacact 94944
>gb|AC101690.7| Mus musculus chromosome 7, clone RP23-218E6, complete sequence Length = 229964 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Plus Query: 2 actcacatgcatgcacaaacac 23 ||||||||||||||||| |||| Sbjct: 218301 actcacatgcatgcacacacac 218322
>gb|AC009711.10| Homo sapiens chromosome 15, clone RP11-356B18, complete sequence Length = 205925 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 7091 acatgcatgcacaaacac 7074
>dbj|AK125674.1| Homo sapiens cDNA FLJ43686 fis, clone TBAES2001751 Length = 1915 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 945 cactcacatgcatgcaca 962
>gb|AC093452.50| Mus musculus strain C57BL/6J clone rp23-458j13 map 1, complete sequence Length = 199859 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 104167 cacatgcatgcacaaaca 104150
>gb|AC096920.2| Homo sapiens chromosome 3 clone RP11-804H8, complete sequence Length = 192324 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 184305 cacatgcatgcacaaaca 184288
>gb|AF407166.1| Homo sapiens PKC-potentiated PP1 inhibitory protein (KEPI) gene, complete cds Length = 168856 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 94638 cactcacatgcatgcaca 94621
>gb|AC109600.2| Homo sapiens chromosome 16 clone RP11-7O14, complete sequence Length = 142464 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 24267 acatgcatgcacaaacac 24284
>dbj|AK141760.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length enriched library, clone:D030055L06 product:prostaglandin F receptor, full insert sequence Length = 4083 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 3992 cactcacatgcatgcaca 3975
>gb|AC015804.14| Homo sapiens chromosome 17, clone RP11-637C24, complete sequence Length = 200452 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 33690 cacatgcatgcacaaaca 33673
>gb|AC084834.4| Homo sapiens chromosome 8, clone RP11-107M13, complete sequence Length = 153304 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 61698 acatgcatgcacaaacac 61715
>gb|AC022681.8| Homo sapiens chromosome 8, clone RP11-731D24, complete sequence Length = 219658 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 165939 cactcacatgcatgcaca 165956
>gb|AC115811.12| Mus musculus chromosome 5, clone RP23-429M21, complete sequence Length = 180812 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 3766 cacatgcatgcacaaaca 3749
>gb|AC118231.9| Mus musculus chromosome 5, clone RP23-462J24, complete sequence Length = 186083 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 51050 cactcacatgcatgcaca 51067
>dbj|AK171868.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830015K11 product:calnexin, full insert sequence Length = 4035 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 3316 cacatgcatgcacaaaca 3299
>gb|AC020908.7| Homo sapiens chromosome 19 clone CTD-2528A14, complete sequence Length = 174034 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 163824 cactcacatgcatgcaca 163807
>gb|AC127352.5| Mus musculus BAC clone RP23-81P4 from chromosome 7, complete sequence Length = 196031 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 142444 cactcacatgcatgcaca 142461
>emb|BX571880.6| Zebrafish DNA sequence from clone DKEY-29L4 in linkage group 15, complete sequence Length = 194220 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Minus Query: 13 tgcacaaacactgaacgaggcc 34 |||||| ||||||||||||||| Sbjct: 177715 tgcacatacactgaacgaggcc 177694
>gb|AC152502.5| Mus musculus BAC clone RP23-415D12 from chromosome 16, complete sequence Length = 180876 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 162186 cacatgcatgcacaaaca 162169
>emb|BX813308.4| Mouse DNA sequence from clone RP23-34G12 on chromosome 2, complete sequence Length = 133963 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 49699 acatgcatgcacaaacac 49682
>gb|AC136636.6| Mus musculus BAC clone RP24-183E22 from chromosome 1, complete sequence Length = 182542 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 143852 acatgcatgcacaaacac 143835
>dbj|AK081035.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:B930072I05 product:unclassifiable, full insert sequence Length = 2927 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 2146 cactcacatgcatgcaca 2129
>dbj|AK079309.1| Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:9630004F09 product:unclassifiable, full insert sequence Length = 3833 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 426 cactcacatgcatgcaca 409
>dbj|AK086563.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:D930037F10 product:unclassifiable, full insert sequence Length = 1787 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 257 cactcacatgcatgcaca 240
>gb|AC163028.5| Mus musculus chromosome 1, clone RP23-393I22, complete sequence Length = 206399 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 40871 cactcacatgcatgcaca 40854
>gb|AC127185.3| Rattus norvegicus BAC CH230-28E5 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 233648 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 206463 acatgcatgcacaaacac 206480
>emb|AL512362.4|CNS07EFB Human chromosome 14 DNA sequence BAC R-716K17 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 168744 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 37270 cactcacatgcatgcaca 37253
>gb|AC003099.1| Homo sapiens chromosome 4, BAC clone B284B3, complete sequence Length = 95129 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 79909 acatgcatgcacaaacac 79892
>emb|BX255948.4| Zebrafish DNA sequence from clone CH211-250J1, complete sequence Length = 194257 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 138294 cacatgcatgcacaaaca 138311
>emb|BX248087.9| Zebrafish DNA sequence from clone CH211-191J22, complete sequence Length = 150181 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 99918 cacatgcatgcacaaaca 99935
>gb|AC157363.6| Mus musculus chromosome 1, clone RP23-478L14, complete sequence Length = 209942 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 153570 cactcacatgcatgcaca 153587
>gb|AC124829.10| Mus musculus chromosome 1, clone RP24-131G15, complete sequence Length = 189923 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 22947 cacatgcatgcacaaaca 22930
>gb|AC158660.4| Mus musculus 6 BAC RP23-387H1 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 199439 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 175908 cactcacatgcatgcaca 175925
>gb|AC113303.16| Mus musculus chromosome 5, clone RP23-431E5, complete sequence Length = 221109 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 185192 acatgcatgcacaaacac 185175
>gb|AC093642.5| Homo sapiens BAC clone RP11-341N2 from 2, complete sequence Length = 158203 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 103123 cactcacatgcatgcaca 103140
>gb|AC005036.1| Homo sapiens BAC clone RP11-364H22 from 2, complete sequence Length = 199684 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Plus Query: 2 actcacatgcatgcacaaacac 23 ||||||||||||||||| |||| Sbjct: 100110 actcacatgcatgcacacacac 100131
>gb|AC027298.20|AC027298 Mus musculus 7 BAC RP23-266F22 (Roswell Park Cancer Institute Mouse BAC Library) complete sequence Length = 201467 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 5 cacatgcatgcacaaaca 22 |||||||||||||||||| Sbjct: 141458 cacatgcatgcacaaaca 141441
>gb|AC087593.6| Homo sapiens chromosome 15, clone RP11-247E14, complete sequence Length = 124394 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 2616 acatgcatgcacaaacac 2633
>gb|AC068120.6| Homo sapiens BAC clone RP11-12E9 from 2, complete sequence Length = 104268 Score = 36.2 bits (18), Expect = 6.0 Identities = 21/22 (95%) Strand = Plus / Plus Query: 2 actcacatgcatgcacaaacac 23 ||||||||||||||||| |||| Sbjct: 39932 actcacatgcatgcacacacac 39953
>gb|AC016683.7| Homo sapiens BAC clone RP11-65I12 from 2, complete sequence Length = 179937 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 105407 cactcacatgcatgcaca 105390
>gb|AC104981.9| Homo sapiens chromosome 17, clone RP11-316M20, complete sequence Length = 193181 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 36113 cactcacatgcatgcaca 36096
>emb|BX927359.1| Human chromosome 14 DNA sequence BAC R-614O9 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 173641 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 143040 cactcacatgcatgcaca 143057
>gb|AC104770.10| Homo sapiens chromosome 17, clone RP11-960B9, complete sequence Length = 188574 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 cactcacatgcatgcaca 18 |||||||||||||||||| Sbjct: 167692 cactcacatgcatgcaca 167709
>gb|AC126677.3| Mus musculus BAC clone RP24-156D14 from chromosome 9, complete sequence Length = 152468 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Minus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 6436 acatgcatgcacaaacac 6419
>emb|BX005248.13| Zebrafish DNA sequence from clone CH211-155H12 in linkage group 8, complete sequence Length = 185135 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 6 acatgcatgcacaaacac 23 |||||||||||||||||| Sbjct: 29585 acatgcatgcacaaacac 29602
>gb|AC113458.10| Mus musculus chromosome 3, clone RP23-372O21, complete sequence Length = 232529 Score = 36.2 bits (18), Expect = 6.0 Identities = 18/18 (100%) Strand = Plus / Plus Query: 11 catgcacaaacactgaac 28 |||||||||||||||||| Sbjct: 30053 catgcacaaacactgaac 30070 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 372,641 Number of Sequences: 3902068 Number of extensions: 372641 Number of successful extensions: 125251 Number of sequences better than 10.0: 308 Number of HSP's better than 10.0 without gapping: 308 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 124003 Number of HSP's gapped (non-prelim): 1248 length of query: 47 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 27 effective length of database: 17,155,003,908 effective search space: 463185105516 effective search space used: 463185105516 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)
