>ref|XM_730364.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000041.05.0)
           partial mRNA
          Length = 378

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 107 acatagttcatacatcaaatatgtc 131
           ||||| |||||||||||||||||||
Sbjct: 307 acatatttcatacatcaaatatgtc 331

>gb|AC116713.8| Mus musculus chromosome 9, clone RP23-118M23, complete sequence
          Length = 275731

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 207    ctctgtctagagcttgaaga 226
              ||||||||||||||||||||
Sbjct: 119026 ctctgtctagagcttgaaga 119007

>gb|AC164556.2| Mus musculus BAC clone RP23-334L9 from chromosome 12, complete sequence
          Length = 182308

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   catcaaatatgtccccagat 138
             ||||||||||||||||||||
Sbjct: 54456 catcaaatatgtccccagat 54437

>gb|AF281078.1| Anopheles gambiae vitellogenin 1 (VgT1) gene, complete cds; and
            vitellogenin 2 (VgT2) gene, partial cds
          Length = 12312

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 4    tcaagaaaagatgttgtctt 23
            ||||||||||||||||||||
Sbjct: 7592 tcaagaaaagatgttgtctt 7573

>emb|AL049873.3|CNS0000T Human chromosome 14 DNA sequence BAC R-112J1 of library RPCI-11 from
            chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 148133

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 6    aagaaaagatgttgtcttgg 25
            ||||||||||||||||||||
Sbjct: 1311 aagaaaagatgttgtcttgg 1292

>emb|AL121819.6|CNS01DSL Human chromosome 14 DNA sequence BAC C-3201O4 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 143883

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      aagaaaagatgttgtcttgg 25
              ||||||||||||||||||||
Sbjct: 143268 aagaaaagatgttgtcttgg 143249


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,854,018
Number of Sequences: 3902068
Number of extensions: 1854018
Number of successful extensions: 25983
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25976
Number of HSP's gapped (non-prelim): 7
length of query: 230
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 208
effective length of database: 17,147,199,772
effective search space: 3566617552576
effective search space used: 3566617552576
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)