ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet74h05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chrom... 44 0.27
2emb|AL513304.27| Human DNA sequence from clone RP11-398B16 on ch... 44 0.27
3ref|XM_627409.1| Cryptosporidium parvum Iowa II hypothetical pro... 44 0.27
4ref|NM_027149.2| Mus musculus RIKEN cDNA 2310040A13 gene (231004... 42 1.1
5gb|BC064773.1| Mus musculus RIKEN cDNA 2310040A13 gene, mRNA (cD... 42 1.1
6gb|BC026761.1| Mus musculus RIKEN cDNA 2310040A13 gene, mRNA (cD... 42 1.1
7gb|L77746.1|BACAPRA Bacillus thuringiensis alkaline protease A (... 42 1.1
8gb|AC101875.7| Mus musculus chromosome 12, clone RP23-367G12, co... 42 1.1
9gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell ... 42 1.1
10ref|NM_131941.2| Drosophila melanogaster CG11436-RA (CG11436), mRNA 42 1.1
11dbj|AK145389.1| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN fu... 42 1.1
12dbj|AK136417.1| Mus musculus adult male colon cDNA, RIKEN full-l... 42 1.1
13gb|AY061262.1| Drosophila melanogaster LD19190 full length cDNA 42 1.1
14dbj|AK052481.1| Mus musculus 13 days embryo lung cDNA, RIKEN ful... 42 1.1
15gb|AF170567.1|AF170567 Bacillus thuringiensis alkaline protease ... 42 1.1
16gb|AF466200.2| Sorghum bicolor putative protein kinase gene, par... 42 1.1
17gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 ... 42 1.1
18emb|AL596265.12| Mouse DNA sequence from clone RP23-134O19 on ch... 42 1.1
19gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 42 1.1
20gb|BT016071.1| Drosophila melanogaster LP06554 full insert cDNA 40 4.2
21gb|AC120159.9| Mus musculus chromosome 19, clone RP24-408B13, co... 40 4.2
22gb|AC154523.2| Mus musculus BAC clone RP24-65H12 from chromosome... 40 4.2
23gb|AC162459.2| Mus musculus chromosome 3, clone RP23-80A8, compl... 40 4.2
24gb|AC139941.9| Mus musculus chromosome 13, clone RP23-78M22, com... 40 4.2
25emb|CR392350.11| Zebrafish DNA sequence from clone DKEY-61N21 in... 40 4.2
26emb|AL603625.11| Human DNA sequence from clone RP11-385E2 on chr... 40 4.2
27emb|AL445430.15| Human DNA sequence from clone RP11-716O23 on ch... 40 4.2
28ref|NM_166027.1| Drosophila melanogaster Cysteine proteinase-1 C... 40 4.2
29ref|NM_166026.1| Drosophila melanogaster Cysteine proteinase-1 C... 40 4.2
30ref|NM_079011.2| Drosophila melanogaster Cysteine proteinase-1 C... 40 4.2
31gb|AC161372.2| Mus musculus BAC clone RP23-326G14 from chromosom... 40 4.2
32gb|AC022486.4|AC022486 Homo sapiens BAC clone RP11-569J3 from Y,... 40 4.2
33gb|AC007851.6|AC007851 Drosophila melanogaster, chromosome 2R, r... 40 4.2
34dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.2
35gb|U75652.1|DMU75652 Drosophila melanogaster cysteine proteinase... 40 4.2
36gb|AC007379.2|AC007379 Homo sapiens BAC clone RP11-143C1 from Y,... 40 4.2
37emb|Y14798.1|MCY14798 Morinda citrifolia mRNA for 3-deoxy-D-arab... 40 4.2
38ref|NG_004636.1| Homo sapiens chromosome Y palindromes P4 and P5... 40 4.2
39emb|CR381614.10| Zebrafish DNA sequence from clone DKEY-72G4 in ... 40 4.2
40gb|AC102012.7| Mus musculus chromosome 3, clone RP24-542B2, comp... 40 4.2
41gb|AF012089.1|AF012089 Drosophila melanogaster cysteine proteina... 40 4.2
42emb|CR925754.15| Zebrafish DNA sequence from clone CH211-148J16 ... 40 4.2
43gb|AE003816.4| Drosophila melanogaster chromosome 2R, section 34... 40 4.2
44gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 4.2
45emb|AL731739.4|CNS08C7O Oryza sativa chromosome 12, . BAC OSJNBa... 40 4.2
46emb|AL732642.4|CNS08C9H Oryza sativa chromosome 12, . BAC OSJNBb... 40 4.2
47gb|AC123862.5| Mus musculus BAC clone RP23-356A24 from 16, compl... 40 4.2
48emb|AJ851868.2| Mus musculus immunoglobulin heavy chain locus co... 40 4.2
49emb|AL163194.5|CNS01RIG Human chromosome 14 DNA sequence BAC R-1... 40 4.2
50emb|AL772224.2| Mouse DNA sequence from clone RP23-131N18 on chr... 40 4.2
51emb|AL445384.3|CNS07ED0 Human chromosome 14 DNA sequence BAC R-4... 40 4.2
52dbj|D31970.1|DROCP Fruitfly DNA for cysteine proteinase-1, parti... 40 4.2 
>gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chromosome unknown, complete
              sequence
          Length = 199482

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 134    aaaatggatggatctggaattctaga 159
              |||||||||||| |||||||||||||
Sbjct: 179522 aaaatggatggacctggaattctaga 179547
to top
>emb|AL513304.27| Human DNA sequence from clone RP11-398B16 on chromosome 10 Contains
            part of the gene for double-stranded RNA specific
            adenosine deaminase (ADAR3), a novel gene and two CpG
            islands, complete sequence
          Length = 163243

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 26   acagatccttattttcaagatg 47
            ||||||||||||||||||||||
Sbjct: 8499 acagatccttattttcaagatg 8520
to top
>ref|XM_627409.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd8_5310),
            partial mRNA
          Length = 3126

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 107  ggccaatattacaaactttgac 128
            ||||||||||||||||||||||
Sbjct: 1043 ggccaatattacaaactttgac 1064
to top
>ref|NM_027149.2| Mus musculus RIKEN cDNA 2310040A13 gene (2310040A13Rik), mRNA
          Length = 2427

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 240  ccctgatgaatgctttgttcc 260
            |||||||||||||||||||||
Sbjct: 2303 ccctgatgaatgctttgttcc 2283
to top
>gb|BC064773.1| Mus musculus RIKEN cDNA 2310040A13 gene, mRNA (cDNA clone
            IMAGE:30051454), partial cds
          Length = 2413

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 240  ccctgatgaatgctttgttcc 260
            |||||||||||||||||||||
Sbjct: 2260 ccctgatgaatgctttgttcc 2240
to top
>gb|BC026761.1| Mus musculus RIKEN cDNA 2310040A13 gene, mRNA (cDNA clone MGC:30262
            IMAGE:4221717), complete cds
          Length = 2290

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 240  ccctgatgaatgctttgttcc 260
            |||||||||||||||||||||
Sbjct: 2153 ccctgatgaatgctttgttcc 2133
to top
>gb|L77746.1|BACAPRA Bacillus thuringiensis alkaline protease A (aprA[Bt]) gene, complete
            cds
          Length = 1750

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 175  ctttaatcagtcgatctacca 195
            |||||||||||||||||||||
Sbjct: 1424 ctttaatcagtcgatctacca 1444
to top
>gb|AC101875.7| Mus musculus chromosome 12, clone RP23-367G12, complete sequence
          Length = 184813

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 240   ccctgatgaatgctttgttcc 260
             |||||||||||||||||||||
Sbjct: 14212 ccctgatgaatgctttgttcc 14192
to top
>gb|AC023747.4| Drosophila melanogaster X BAC RP98-38L1 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 167097

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 266    tcattagtatgtagcctttgtcgcc 290
              |||||| ||||||||||||||||||
Sbjct: 112768 tcattactatgtagcctttgtcgcc 112744
to top
>ref|NM_131941.2| Drosophila melanogaster CG11436-RA (CG11436), mRNA
          Length = 1996

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 266  tcattagtatgtagcctttgtcgcc 290
            |||||| ||||||||||||||||||
Sbjct: 1477 tcattactatgtagcctttgtcgcc 1453
to top
>dbj|AK145389.1| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN full-length enriched
            library, clone:I0C0032E22 product:WD-repeat protein 20
            (DMR protein) homolog [Homo sapiens], full insert
            sequence
          Length = 2344

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 240  ccctgatgaatgctttgttcc 260
            |||||||||||||||||||||
Sbjct: 2226 ccctgatgaatgctttgttcc 2206
to top
>dbj|AK136417.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched
            library, clone:9030014L17 product:WD-repeat protein 20
            (DMR protein) homolog [Homo sapiens], full insert
            sequence
          Length = 2381

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 240  ccctgatgaatgctttgttcc 260
            |||||||||||||||||||||
Sbjct: 2263 ccctgatgaatgctttgttcc 2243
to top
>gb|AY061262.1| Drosophila melanogaster LD19190 full length cDNA
          Length = 1987

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 266  tcattagtatgtagcctttgtcgcc 290
            |||||| ||||||||||||||||||
Sbjct: 1448 tcattactatgtagcctttgtcgcc 1424
to top
>dbj|AK052481.1| Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched
            library, clone:D430033K12 product:DMR PROTEIN homolog
            [Homo sapiens], full insert sequence
          Length = 2285

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 240  ccctgatgaatgctttgttcc 260
            |||||||||||||||||||||
Sbjct: 2250 ccctgatgaatgctttgttcc 2230
to top
>gb|AF170567.1|AF170567 Bacillus thuringiensis alkaline protease A (aprA) gene, complete cds
          Length = 1500

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 175  ctttaatcagtcgatctacca 195
            |||||||||||||||||||||
Sbjct: 1424 ctttaatcagtcgatctacca 1444
to top
>gb|AF466200.2| Sorghum bicolor putative protein kinase gene, partial cds; putative
             Cf-2, fertilization-independent endosperm proteins,
             hypothetical protein, putative non-LTR retroelement
             reverse transcriptase, OCL5 protein, tryptophan synthase
             beta-subunit, hypothetical proteins, putative AP
             endonuclease, putative RNA polymerase II complex component
             SRB7, putative beta-1,3-glucanase, hypothetical protein,
             TNP2-like protein, hypothetical protein, putative
             phosphate/phosphoenolpyruvate translocator, putative
             protein, hypothetical proteins, putative
             galactosyltransferase family, hypothetical protein,
             putative cytochrome P450 family, putative lipid transfer
             protein, putative photoreceptor-interacting protein, and
             hypothetical protein genes, complete cds; and hypothetical
             protein gene, partial cds
          Length = 202197

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 151   aattctagatttaaagcaagt 171
             |||||||||||||||||||||
Sbjct: 64779 aattctagatttaaagcaagt 64759
to top
>gb|AE003431.5| Drosophila melanogaster chromosome X, section 15 of 74 of the complete
              sequence
          Length = 310993

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 266    tcattagtatgtagcctttgtcgcc 290
              |||||| ||||||||||||||||||
Sbjct: 160931 tcattactatgtagcctttgtcgcc 160955
to top
>emb|AL596265.12| Mouse DNA sequence from clone RP23-134O19 on chromosome 12, complete
            sequence
          Length = 205332

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 240  ccctgatgaatgctttgttcc 260
            |||||||||||||||||||||
Sbjct: 9728 ccctgatgaatgctttgttcc 9748
to top
>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 175     ctttaatcagtcgatctacca 195
               |||||||||||||||||||||
Sbjct: 2263425 ctttaatcagtcgatctacca 2263405
to top
>gb|BT016071.1| Drosophila melanogaster LP06554 full insert cDNA
          Length = 1514

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 278  agcctttgtcgccccatgtcatcccccacgagttcttcac 317
            |||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 1186 agcccttgtcgccccaggtggtgccccacgagttcttcac 1147
to top
>gb|AC120159.9| Mus musculus chromosome 19, clone RP24-408B13, complete sequence
          Length = 178918

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   ttaaaatggatggatctgga 151
             ||||||||||||||||||||
Sbjct: 72039 ttaaaatggatggatctgga 72058
to top
>gb|AC154523.2| Mus musculus BAC clone RP24-65H12 from chromosome 13, complete sequence
          Length = 196410

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 263   tcttcattagtatgtagcct 282
             ||||||||||||||||||||
Sbjct: 89755 tcttcattagtatgtagcct 89774
to top
>gb|AC162459.2| Mus musculus chromosome 3, clone RP23-80A8, complete sequence
          Length = 207515

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 132    ttaaaatggatggatctgga 151
              ||||||||||||||||||||
Sbjct: 131743 ttaaaatggatggatctgga 131762
to top
>gb|AC139941.9| Mus musculus chromosome 13, clone RP23-78M22, complete sequence
          Length = 236536

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   tcttcattagtatgtagcct 282
             ||||||||||||||||||||
Sbjct: 16740 tcttcattagtatgtagcct 16721
to top
>emb|CR392350.11| Zebrafish DNA sequence from clone DKEY-61N21 in linkage group 5,
             complete sequence
          Length = 230648

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   caatattacaaactttgaca 129
             ||||||||||||||||||||
Sbjct: 19867 caatattacaaactttgaca 19848
to top
>emb|AL603625.11| Human DNA sequence from clone RP11-385E2 on chromosome 9, complete
            sequence
          Length = 13392

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 188  atctaccacctttcataaga 207
            ||||||||||||||||||||
Sbjct: 6035 atctaccacctttcataaga 6016
to top
>emb|AL445430.15| Human DNA sequence from clone RP11-716O23 on chromosome 6 Contains one
             or two novel genes, a repressor of protein-kinase
             (interferon-inducible double stranded RNA dependent
             inhibitor) (P58 repressor) (PRKRIR) pseudogene and a CpG
             island, complete sequence
          Length = 127862

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    acatacgtaggcacagtgca 100
             ||||||||||||||||||||
Sbjct: 77118 acatacgtaggcacagtgca 77137
to top
>ref|NM_166027.1| Drosophila melanogaster Cysteine proteinase-1 CG6692-RB, transcript
            variant B (Cp1), mRNA
          Length = 1505

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 278  agcctttgtcgccccatgtcatcccccacgagttcttcac 317
            |||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 1184 agcccttgtcgccccaggtggtgccccacgagttcttcac 1145
to top
>ref|NM_166026.1| Drosophila melanogaster Cysteine proteinase-1 CG6692-RA, transcript
            variant A (Cp1), mRNA
          Length = 1512

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 278  agcctttgtcgccccatgtcatcccccacgagttcttcac 317
            |||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 1191 agcccttgtcgccccaggtggtgccccacgagttcttcac 1152
to top
>ref|NM_079011.2| Drosophila melanogaster Cysteine proteinase-1 CG6692-RC, transcript
            variant C (Cp1), mRNA
          Length = 1379

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 278  agcctttgtcgccccatgtcatcccccacgagttcttcac 317
            |||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 1058 agcccttgtcgccccaggtggtgccccacgagttcttcac 1019
to top
>gb|AC161372.2| Mus musculus BAC clone RP23-326G14 from chromosome 16, complete sequence
          Length = 208994

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 134    aaaatggatggatctggaat 153
              ||||||||||||||||||||
Sbjct: 153146 aaaatggatggatctggaat 153165
to top
>gb|AC022486.4|AC022486 Homo sapiens BAC clone RP11-569J3 from Y, complete sequence
          Length = 156357

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 115   ttacaaactttgacaaattaaaat 138
             |||||||||||||||||| |||||
Sbjct: 50214 ttacaaactttgacaaatcaaaat 50237
to top
>gb|AC007851.6|AC007851 Drosophila melanogaster, chromosome 2R, region 50C-50D, BAC clone
             BACR06M19, complete sequence
          Length = 183161

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 278   agcctttgtcgccccatgtcatcccccacgagttcttcac 317
             |||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 63348 agcccttgtcgccccaggtggtgccccacgagttcttcac 63387
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 286      tcgccccatgtcatcccccacgagttcttcac 317
                |||||||| ||| | |||||||||||||||||
Sbjct: 10054131 tcgccccacgtcgtgccccacgagttcttcac 10054100
to top
>gb|U75652.1|DMU75652 Drosophila melanogaster cysteine proteinase 1 (CP1) mRNA, complete
            cds
          Length = 1435

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 278  agcctttgtcgccccatgtcatcccccacgagttcttcac 317
            |||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 1102 agcccttgtcgccccaggtggtgccccacgagttcttcac 1063
to top
>gb|AC007379.2|AC007379 Homo sapiens BAC clone RP11-143C1 from Y, complete sequence
          Length = 174082

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 115   ttacaaactttgacaaattaaaat 138
             |||||||||||||||||| |||||
Sbjct: 88154 ttacaaactttgacaaatcaaaat 88131
to top
>emb|Y14798.1|MCY14798 Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate
           7-phosphate synthase, DS2
          Length = 1944

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 ggatctggaattctagattt 162
           ||||||||||||||||||||
Sbjct: 698 ggatctggaattctagattt 679
to top
>ref|NG_004636.1| Homo sapiens chromosome Y palindromes P4 and P5 (P4-P5@) on chromosome Y
          Length = 1351786

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 115     ttacaaactttgacaaattaaaat 138
               |||||||||||||||||| |||||
Sbjct: 1241155 ttacaaactttgacaaatcaaaat 1241132



 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 115     ttacaaactttgacaaattaaaat 138
               |||||||||||||||||| |||||
Sbjct: 1047058 ttacaaactttgacaaatcaaaat 1047081
to top
>emb|CR381614.10| Zebrafish DNA sequence from clone DKEY-72G4 in linkage group 20,
             complete sequence
          Length = 153083

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 198   tttcataagaggaaagactg 217
             ||||||||||||||||||||
Sbjct: 52432 tttcataagaggaaagactg 52451
to top
>gb|AC102012.7| Mus musculus chromosome 3, clone RP24-542B2, complete sequence
          Length = 155366

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   ttaaaatggatggatctgga 151
             ||||||||||||||||||||
Sbjct: 32731 ttaaaatggatggatctgga 32750
to top
>gb|AF012089.1|AF012089 Drosophila melanogaster cysteine proteinase-1 (CP1) and phenylalanyl
            tRNA synthetase genes, complete cds
          Length = 10772

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 278  agcctttgtcgccccatgtcatcccccacgagttcttcac 317
            |||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 7391 agcccttgtcgccccaggtggtgccccacgagttcttcac 7352
to top
>emb|CR925754.15| Zebrafish DNA sequence from clone CH211-148J16 in linkage group 6,
             complete sequence
          Length = 150312

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   tttgacaaattaaaatggat 142
             ||||||||||||||||||||
Sbjct: 89612 tttgacaaattaaaatggat 89593
to top
>gb|AE003816.4| Drosophila melanogaster chromosome 2R, section 34 of 73 of the complete
              sequence
          Length = 287287

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                      
Query: 278    agcctttgtcgccccatgtcatcccccacgagttcttcac 317
              |||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 108892 agcccttgtcgccccaggtggtgccccacgagttcttcac 108853
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 286      tcgccccatgtcatcccccacgagttcttcac 317
                |||||||| ||| | |||||||||||||||||
Sbjct: 10054016 tcgccccacgtcgtgccccacgagttcttcac 10053985
to top
>emb|AL731739.4|CNS08C7O Oryza sativa chromosome 12, . BAC OSJNBa0056I18 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 145890

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 286    tcgccccatgtcatcccccacgagttcttcac 317
              |||||||| ||| | |||||||||||||||||
Sbjct: 108490 tcgccccacgtcgtgccccacgagttcttcac 108521
to top
>emb|AL732642.4|CNS08C9H Oryza sativa chromosome 12, . BAC OSJNBb0071E08 of library OSJNBb
            from chromosome 12 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 132906

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 286  tcgccccatgtcatcccccacgagttcttcac 317
            |||||||| ||| | |||||||||||||||||
Sbjct: 3943 tcgccccacgtcgtgccccacgagttcttcac 3974
to top
>gb|AC123862.5| Mus musculus BAC clone RP23-356A24 from 16, complete sequence
          Length = 223030

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 134   aaaatggatggatctggaat 153
             ||||||||||||||||||||
Sbjct: 23421 aaaatggatggatctggaat 23440
to top
>emb|AJ851868.2| Mus musculus immunoglobulin heavy chain locus constant region and partial
              variable region, strain 129/Sv
          Length = 1382053

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 132    ttaaaatggatggatctgga 151
              ||||||||||||||||||||
Sbjct: 796562 ttaaaatggatggatctgga 796543
to top
>emb|AL163194.5|CNS01RIG Human chromosome 14 DNA sequence BAC R-120I18 of library RPCI-11
           from chromosome 14 of Homo sapiens (Human), complete
           sequence
          Length = 161813

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 127 acaaattaaaatggatggat 146
           ||||||||||||||||||||
Sbjct: 521 acaaattaaaatggatggat 540
to top
>emb|AL772224.2| Mouse DNA sequence from clone RP23-131N18 on chromosome 2, complete
             sequence
          Length = 182544

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 246   tgaatgctttgttcccctct 265
             ||||||||||||||||||||
Sbjct: 86538 tgaatgctttgttcccctct 86557
to top
>emb|AL445384.3|CNS07ED0 Human chromosome 14 DNA sequence BAC R-460A13 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 160750

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    acaaattaaaatggatggat 146
              ||||||||||||||||||||
Sbjct: 101005 acaaattaaaatggatggat 100986
to top
>dbj|D31970.1|DROCP Fruitfly DNA for cysteine proteinase-1, partial cds
          Length = 1980

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                    
Query: 278  agcctttgtcgccccatgtcatcccccacgagttcttcac 317
            |||| ||||||||||| ||  | |||||||||||||||||
Sbjct: 1526 agcccttgtcgccccaggtggtgccccacgagttcttcac 1487


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,944,172
Number of Sequences: 3902068
Number of extensions: 2944172
Number of successful extensions: 83427
Number of sequences better than 10.0: 52
Number of HSP's better than 10.0 without gapping: 52
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83307
Number of HSP's gapped (non-prelim): 120
length of query: 317
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 295
effective length of database: 17,147,199,772
effective search space: 5058423932740
effective search space used: 5058423932740
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top