ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet74d09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC020646.2|AC020646 Genomic sequence for Arabidopsis thaliana... 42 1.1
2gb|AC152495.1| Zea mays BAC clone Z486N13, complete sequence 40 4.5
3gb|AC131303.8| Mus musculus chromosome 1, clone RP24-119O19, com... 40 4.5
4gb|AC099582.7| Mus musculus chromosome 1, clone RP23-188D7, comp... 40 4.5
5ref|XM_323460.1| Neurospora crassa OR74A hypothetical protein ( ... 40 4.5
6ref|XM_956184.1| Neurospora crassa OR74A hypothetical protein ( ... 40 4.5
7gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 40 4.5
8emb|AL365185.11| Human DNA sequence from clone RP11-416C17 on ch... 40 4.5
9emb|Y10847.1|BJY10847 Brassica juncea mRNA for O-acetylserine(th... 40 4.5
10gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome 40 4.5
11emb|AL807366.1|NC94C8 Neurospora crassa DNA linkage group V cosm... 40 4.5
12emb|AL513463.1|NC9G6 Neurospora crassa DNA linkage group V Cosmi... 40 4.5
13emb|AL670928.7| Mouse DNA sequence from clone RP23-459G6 on chro... 40 4.5
14emb|BX957273.10| Zebrafish DNA sequence from clone CH211-210P17 ... 40 4.5
15emb|AL833777.11| Mouse DNA sequence from clone RP23-150D10 on ch... 40 4.5

>gb|AC020646.2|AC020646 Genomic sequence for Arabidopsis thaliana BAC T32E20 from chromosome I,
             complete sequence
          Length = 103931

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 71    aattgggtattaaaactccaa 91
             |||||||||||||||||||||
Sbjct: 43816 aattgggtattaaaactccaa 43836



to top

>gb|AC152495.1| Zea mays BAC clone Z486N13, complete sequence
          Length = 169348

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 84     aactccaaccttccggcctg 103
              ||||||||||||||||||||
Sbjct: 124716 aactccaaccttccggcctg 124697



to top

>gb|AC131303.8| Mus musculus chromosome 1, clone RP24-119O19, complete sequence
          Length = 187110

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 149    gaatttctttcctatgtaca 168
              ||||||||||||||||||||
Sbjct: 161521 gaatttctttcctatgtaca 161540



to top

>gb|AC099582.7| Mus musculus chromosome 1, clone RP23-188D7, complete sequence
          Length = 192016

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 149  gaatttctttcctatgtaca 168
            ||||||||||||||||||||
Sbjct: 9638 gaatttctttcctatgtaca 9657



to top

>ref|XM_323460.1| Neurospora crassa OR74A hypothetical protein ( (AL513463) probable
            gamma-adaptin precursor [Neurospora crassa OR74A] )
            (NCU04121.1) partial mRNA
          Length = 2529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 231  gctgctgcggccggccatgc 250
            ||||||||||||||||||||
Sbjct: 2188 gctgctgcggccggccatgc 2207



to top

>ref|XM_956184.1| Neurospora crassa OR74A hypothetical protein ( (AL513463) probable
            gamma-adaptin precursor [Neurospora crassa OR74A] )
            (NCU04121.1) partial mRNA
          Length = 2529

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 231  gctgctgcggccggccatgc 250
            ||||||||||||||||||||
Sbjct: 2188 gctgctgcggccggccatgc 2207



to top

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     tcgaattgggtattaaaact 87
              ||||||||||||||||||||
Sbjct: 848538 tcgaattgggtattaaaact 848557



to top

>emb|AL365185.11| Human DNA sequence from clone RP11-416C17 on chromosome 10 Contains
             part of gene FLJ11218, complete sequence
          Length = 150635

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 78    tattaaaactccaaccttcc 97
             ||||||||||||||||||||
Sbjct: 98381 tattaaaactccaaccttcc 98362



to top

>emb|Y10847.1|BJY10847 Brassica juncea mRNA for O-acetylserine(thiol) lyase, clone OAS-TL6
          Length = 1238

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 319 tgctgcagctgctgcaccgg 338
           ||||||||||||||||||||
Sbjct: 851 tgctgcagctgctgcaccgg 832



to top

>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome
          Length = 3665893

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 207     tgtcgacggtgttgttcttt 226
               ||||||||||||||||||||
Sbjct: 2881894 tgtcgacggtgttgttcttt 2881875



to top

>emb|AL807366.1|NC94C8 Neurospora crassa DNA linkage group V cosmid contig 94C8
          Length = 80503

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 231   gctgctgcggccggccatgc 250
             ||||||||||||||||||||
Sbjct: 68223 gctgctgcggccggccatgc 68242



to top

>emb|AL513463.1|NC9G6 Neurospora crassa DNA linkage group V Cosmid contig 9G6
          Length = 125561

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 231    gctgctgcggccggccatgc 250
              ||||||||||||||||||||
Sbjct: 121381 gctgctgcggccggccatgc 121362



to top

>emb|AL670928.7| Mouse DNA sequence from clone RP23-459G6 on chromosome 4, complete
             sequence
          Length = 125713

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   attcggggaatttctttcct 161
             ||||||||||||||||||||
Sbjct: 25213 attcggggaatttctttcct 25194



to top

>emb|BX957273.10| Zebrafish DNA sequence from clone CH211-210P17 in linkage group 9,
             complete sequence
          Length = 150430

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 162   atgtacacacagtatgttca 181
             ||||||||||||||||||||
Sbjct: 17949 atgtacacacagtatgttca 17968



to top

>emb|AL833777.11| Mouse DNA sequence from clone RP23-150D10 on chromosome X, complete
             sequence
          Length = 189554

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   ttctttcctatgtacacaca 172
             ||||||||||||||||||||
Sbjct: 66109 ttctttcctatgtacacaca 66090


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,550,652
Number of Sequences: 3902068
Number of extensions: 2550652
Number of successful extensions: 65771
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65729
Number of HSP's gapped (non-prelim): 42
length of query: 338
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 316
effective length of database: 17,147,199,772
effective search space: 5418515127952
effective search space used: 5418515127952
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top