| Clone Name | rbaet74d01 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|BC020139.1| Mus musculus thymidylate synthase, mRNA (cDNA clo... | 42 | 0.95 | 2 | ref|XM_746998.1| Aspergillus fumigatus Af293 hypothetical protei... | 40 | 3.8 |
|---|
>gb|BC020139.1| Mus musculus thymidylate synthase, mRNA (cDNA clone MGC:28246 IMAGE:3994204), complete cds Length = 986 Score = 42.1 bits (21), Expect = 0.95 Identities = 21/21 (100%) Strand = Plus / Minus Query: 231 acggagcagtacgacagcagt 251 ||||||||||||||||||||| Sbjct: 48 acggagcagtacgacagcagt 28
>ref|XM_746998.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g07350) partial mRNA Length = 1155 Score = 40.1 bits (20), Expect = 3.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 ccatgcatgcgtccgtcgtc 210 |||||||||||||||||||| Sbjct: 383 ccatgcatgcgtccgtcgtc 402 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,239,209 Number of Sequences: 3902068 Number of extensions: 1239209 Number of successful extensions: 19266 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 19264 Number of HSP's gapped (non-prelim): 2 length of query: 288 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 266 effective length of database: 17,147,199,772 effective search space: 4561155139352 effective search space used: 4561155139352 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)