ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet74c09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY377991.1| Triticum aestivum chloroplast-localized Ptr ToxA-... 186 2e-44
2gb|AE016826.1| Buchnera aphidicola str. Bp (Baizongia pistaciae)... 42 0.65
3emb|AL161624.7| Human DNA sequence from clone RP11-487I9 on chro... 40 2.6
4emb|BX842632.1| Neurospora crassa DNA linkage group I BAC contig... 40 2.6
5gb|AC073531.22| Homo sapiens 12 BAC RP11-802J22 (Roswell Park Ca... 40 2.6
6dbj|AK113914.1| Ciona intestinalis cDNA, clone:cicl016f10, full ... 40 2.6

>gb|AY377991.1| Triticum aestivum chloroplast-localized Ptr ToxA-binding protein1
            (TaThf1) mRNA, complete cds; nuclear gene for chloroplast
            product
          Length = 1130

 Score =  186 bits (94), Expect = 2e-44
 Identities = 146/161 (90%), Gaps = 8/161 (4%)
 Strand = Plus / Minus

                                                                        
Query: 51   cattcgaacacagagaaggagaaattacaaaataccaac-----tactgcgaataatctg 105
            |||||||||||||| |||||||||||||||||||||||      |||| |||||||||||
Sbjct: 1065 cattcgaacacagacaaggagaaattacaaaataccaaactcaatactacgaataatctg 1006

                                                                        
Query: 106  gatctttttgtaccgccgagtactacac-cacgctaagagcagccaaagatgcccccgat 164
            ||||||||||||| || ||||||||||| | ||| |||||||||||||||||||||||||
Sbjct: 1005 gatctttttgtacggcggagtactacactcgcgcgaagagcagccaaagatgcccccgat 946

                                                     
Query: 165  agttctcaacgctatccaga--tgtataactgttaatatct 203
            ||||||||||||||||||||  |||||||||||||||||||
Sbjct: 945  agttctcaacgctatccagatgtgtataactgttaatatct 905



to top

>gb|AE016826.1| Buchnera aphidicola str. Bp (Baizongia pistaciae), complete genome
          Length = 615980

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 5      accaaataactcttcatatat 25
              |||||||||||||||||||||
Sbjct: 446416 accaaataactcttcatatat 446436



to top

>emb|AL161624.7| Human DNA sequence from clone RP11-487I9 on chromosome X Contains part
             of the DIAPH2 gene for Drosophila diaphanous homolog 2 and
             the 3' end of a novel gene (EPAG), complete sequence
          Length = 133021

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 184   atgtataactgttaatatct 203
             ||||||||||||||||||||
Sbjct: 49628 atgtataactgttaatatct 49609



to top

>emb|BX842632.1| Neurospora crassa DNA linkage group I BAC contig B5K2
          Length = 86737

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 130   acaccacgctaagagcagcc 149
             ||||||||||||||||||||
Sbjct: 41587 acaccacgctaagagcagcc 41568



to top

>gb|AC073531.22| Homo sapiens 12 BAC RP11-802J22 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 212172

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    gaacacagagaaggagaaat 75
             ||||||||||||||||||||
Sbjct: 65255 gaacacagagaaggagaaat 65236



to top

>dbj|AK113914.1| Ciona intestinalis cDNA, clone:cicl016f10, full insert sequence
          Length = 2013

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 8    aaataactcttcatatattgtcaa 31
            |||||||||||||||| |||||||
Sbjct: 1687 aaataactcttcatattttgtcaa 1664


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,746,562
Number of Sequences: 3902068
Number of extensions: 1746562
Number of successful extensions: 125239
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 125220
Number of HSP's gapped (non-prelim): 17
length of query: 203
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 181
effective length of database: 17,147,199,772
effective search space: 3103643158732
effective search space used: 3103643158732
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top