ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet74c03 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 464 bits (234), Expect = e-128 Identities = 265/274 (96%), Gaps = 1/274 (0%) Strand = Plus / Minus Query: 10 taacaatgcttctccatagaattctcataatttacatcatggtagtacaaatcaaaccac 69 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 918 taacaatgcttctccatagaattctcataatctacatcatggtagtacaaatcaaaccac 859 Query: 70 acaacctcacacttcaacatgagtag-ctccaggacaccttatttgccggggacgaagtt 128 |||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||| Sbjct: 858 acaacctcacacttcaacatgactagtctccgggacaccttatttgccggggacgaagtt 799 Query: 129 ggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtggtcagcgaggttctc 188 |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 798 tgtggcaaatgcccaagcgttgttgttgacggggtcggcgatgtggtcagcgaggttctc 739 Query: 189 aagagggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggc 248 ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 738 aagagggcccttgccggtgactatggcctggacaagaaagccaaacatcgagaacatggc 679 Query: 249 aaggcggccgttcttgatctccttcaccttgagc 282 |||||||||||||||||||||||||||||||||| Sbjct: 678 aaggcggccgttcttgatctccttcaccttgagc 645
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 268 bits (135), Expect = 9e-69 Identities = 174/187 (93%) Strand = Plus / Minus Query: 102 gacaccttatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggg 161 ||||||||| ||||||||||| ||||||||||| |||||||| || |||||||||||||| Sbjct: 816 gacaccttacttgccggggacaaagttggtggcgaatgcccatgcattgttgttgacggg 757 Query: 162 gtcgacgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggac 221 |||| ||||||||||||||||||||||||| ||||||||||| ||||| || || ||||| Sbjct: 756 gtcggcgatgtggtcagcgaggttctcaagtgggcccttgcccgtgacgatagcttggac 697 Query: 222 aaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgag 281 ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 696 aaagaagccaaacattgagaacatggcaaggcgaccgttcttgatctccttcaccttgag 637 Query: 282 ctcggcg 288 ||||||| Sbjct: 636 ctcggcg 630
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 782 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgagg 723 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 722 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 663 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 662 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 610
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 10793778 ttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgagg 10793719 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 10793718 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 10793659 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 10793658 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 10793606 Score = 50.1 bits (25), Expect = 0.004 Identities = 28/29 (96%) Strand = Plus / Minus Query: 250 aggcggccgttcttgatctccttcacctt 278 ||||| ||||||||||||||||||||||| Sbjct: 7133593 aggcgaccgttcttgatctccttcacctt 7133565 Score = 40.1 bits (20), Expect = 3.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 144 ggcgttgttgttgacggggtcgacgatg 171 ||||||||||||| ||| |||||||||| Sbjct: 20970980 ggcgttgttgttgccggtgtcgacgatg 20971007
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 23604325 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgagg 23604266 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 23604265 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 23604206 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 23604205 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 23604153 Score = 216 bits (109), Expect = 3e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 30025131 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgagg 30025072 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || |||||||| || || |||||||||||||| ||||||||||| ||||| || Sbjct: 30025071 tggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccg 30025012 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 30025011 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 30024955
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 17501 ttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgagg 17442 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 17441 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 17382 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 17381 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 17329
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 67024 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgagg 66965 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 66964 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 66905 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 66904 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 66852
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 130396 ttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgagg 130337 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 130336 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 130277 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 130276 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 130224
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 853 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgagg 794 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 793 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 734 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 733 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 681
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 852 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgagg 793 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 792 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 733 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 732 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 680
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 1282 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgagg 1223 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 1222 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 1163 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 1162 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 1110
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 846 ttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgagg 787 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 786 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 727 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 726 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 674
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 851 ttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgagg 792 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 791 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 732 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 731 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 679
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 853 ttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgagg 794 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 793 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 734 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 733 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 681
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 851 ttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgagg 792 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 791 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 732 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 731 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 679
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 240 bits (121), Expect = 2e-60 Identities = 160/173 (92%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 851 ttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgagg 792 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 791 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 732 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 731 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 679
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 232 bits (117), Expect = 5e-58 Identities = 159/173 (91%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 1243 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgagg 1184 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 1183 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 1124 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||||||||||||||||| ||||||||||||||| Sbjct: 1123 aacatggagaacatggcgaggcggccgttcttgatcttcttcaccttgagctc 1071
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 232 bits (117), Expect = 5e-58 Identities = 159/173 (91%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 832 ttgccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgagg 773 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 772 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 713 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| |||||||| |||||||||||||||||||||||||| Sbjct: 712 aacatggagaacatggcgaggcggcctttcttgatctccttcaccttgagctc 660
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 226 bits (114), Expect = 3e-56 Identities = 162/178 (91%) Strand = Plus / Minus Query: 107 cttatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcga 166 |||| |||||||| |||||||||||||| || ||||||||||||||||||||||||||| Sbjct: 865 cttacttgccgggcacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcgg 806 Query: 167 cgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaaga 226 || |||||| ||||||||||| || ||||||||||||||||| |||||||| || |||| Sbjct: 805 agaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctgcacgaaga 746 Query: 227 agccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 |||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 745 agccgaacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 688
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 226 bits (114), Expect = 3e-56 Identities = 165/182 (90%) Strand = Plus / Minus Query: 107 cttatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcga 166 |||| ||||||||||||||||||||||| | ||||| |||||||||||||| ||||| Sbjct: 1681 cttagttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcag 1622 Query: 167 cgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaaga 226 |||||||||||||||||||||| || ||||||||||||||||| ||||||||||| |||| Sbjct: 1621 cgatgtggtcagcgaggttctcgagcgggcccttgccggtgacgatggcctggacgaaga 1562 Query: 227 agccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcgg 286 |||| ||||| || |||||||| |||||||||||||||| |||||||||||||||||||| Sbjct: 1561 agccgaacatggaaaacatggcgaggcggccgttcttgagctccttcaccttgagctcgg 1502 Query: 287 cg 288 || Sbjct: 1501 cg 1500
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 224 bits (113), Expect = 1e-55 Identities = 158/173 (91%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||| | Sbjct: 382 ttgccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgagg 323 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| ||| |||| Sbjct: 322 tggtcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagcagccg 263 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||| | ||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 262 aacctggagaacatggcgaggcggccgttcttgatctccttcaccttgagctc 210
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 216 bits (109), Expect = 3e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 794 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgagg 735 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || |||||||| || || |||||||||||||| ||||||||||| ||||| || Sbjct: 734 tggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccg 675 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 674 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 618
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 216 bits (109), Expect = 3e-53 Identities = 160/177 (90%) Strand = Plus / Plus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 13880 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgagg 13939 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || |||||||| || || |||||||||||||| ||||||||||| ||||| || Sbjct: 13940 tggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccg 13999 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 14000 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 14056
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 216 bits (109), Expect = 3e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 21121 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgagg 21062 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || |||||||| || || |||||||||||||| ||||||||||| ||||| || Sbjct: 21061 tggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccg 21002 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 21001 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 20945
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 216 bits (109), Expect = 3e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||||||||||||||| || | Sbjct: 2717 ttgccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggtgagg 2658 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| | ||||||||||||||||| || ||||| || |||||||| Sbjct: 2657 tggtcggcgaggttctcgatggggcccttgccggtgacgatagcctgcacgaagaagccg 2598 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 2597 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 2541
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 216 bits (109), Expect = 3e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 875 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgagg 816 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || |||||||| || || |||||||||||||| ||||||||||| ||||| || Sbjct: 815 tggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccg 756 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 755 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 699
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 216 bits (109), Expect = 3e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 875 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgagg 816 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || |||||||| || || |||||||||||||| ||||||||||| ||||| || Sbjct: 815 tggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccg 756 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 755 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 699
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 216 bits (109), Expect = 3e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 877 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgagg 818 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || |||||||| || || |||||||||||||| ||||||||||| ||||| || Sbjct: 817 tggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccg 758 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 757 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 701
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 216 bits (109), Expect = 3e-53 Identities = 160/177 (90%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 877 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgagg 818 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || |||||||| || || |||||||||||||| ||||||||||| ||||| || Sbjct: 817 tggtcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccg 758 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 757 aacatggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 701
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 208 bits (105), Expect = 7e-51 Identities = 159/177 (89%) Strand = Plus / Plus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||| | Sbjct: 78976 ttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 79035 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||| | ||||||||||||||||| ||||||||||| |||||||| Sbjct: 79036 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 79095 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| Sbjct: 79096 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcg 79152
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 208 bits (105), Expect = 7e-51 Identities = 159/177 (89%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||| | Sbjct: 21808840 ttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 21808781 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||| | ||||||||||||||||| ||||||||||| |||||||| Sbjct: 21808780 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 21808721 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| Sbjct: 21808720 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcg 21808664
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 208 bits (105), Expect = 7e-51 Identities = 156/173 (90%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| | ||| Sbjct: 1806 ttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatg 1747 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||||||||||||||| || |||||||| |||||||| ||||||||||| ||||| || Sbjct: 1746 tggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccg 1687 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| |||||||| ||||||| |||||||||||||||||| Sbjct: 1686 aacatggagaacatggcgaggcggcccttcttgagctccttcaccttgagctc 1634
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 208 bits (105), Expect = 7e-51 Identities = 159/177 (89%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||| | Sbjct: 21801869 ttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 21801810 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||| | ||||||||||||||||| ||||||||||| |||||||| Sbjct: 21801809 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 21801750 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| Sbjct: 21801749 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcg 21801693
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 208 bits (105), Expect = 7e-51 Identities = 159/177 (89%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||| | Sbjct: 839 ttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 780 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||| | ||||||||||||||||| ||||||||||| |||||||| Sbjct: 779 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 720 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| Sbjct: 719 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcg 663
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 208 bits (105), Expect = 7e-51 Identities = 159/177 (89%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||| | Sbjct: 414 ttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 355 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||| | ||||||||||||||||| ||||||||||| |||||||| Sbjct: 354 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 295 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| Sbjct: 294 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcg 238
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 208 bits (105), Expect = 7e-51 Identities = 156/173 (90%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| | ||| Sbjct: 1806 ttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatg 1747 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||||||||||||||| || |||||||| |||||||| ||||||||||| ||||| || Sbjct: 1746 tggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccg 1687 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| |||||||| ||||||| |||||||||||||||||| Sbjct: 1686 aacatggagaacatggcgaggcggcccttcttgagctccttcaccttgagctc 1634
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 208 bits (105), Expect = 7e-51 Identities = 159/177 (89%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||| | Sbjct: 828 ttgccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 769 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||| | ||||||||||||||||| ||||||||||| |||||||| Sbjct: 768 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 709 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| Sbjct: 708 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcg 652
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 204 bits (103), Expect = 1e-49 Identities = 160/179 (89%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 ||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||| Sbjct: 869 atttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcga 810 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 |||||| ||||||||||| | ||||| ||||||||||| ||||||||||| ||||| | Sbjct: 809 ggtggtcggcgaggttctcgatggggcctttgccggtgacgatggcctggacgaagaaac 750 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 | ||||| ||||||||||| |||||||||||||||| |||||| ||||| || |||||| Sbjct: 749 cgaacatggagaacatggccaggcggccgttcttgagctccttaaccttcagttcggcg 691
>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding protein Length = 1126 Score = 200 bits (101), Expect = 2e-48 Identities = 158/177 (89%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||| ||||| ||||||||||||||||| |||||||||| ||| | Sbjct: 824 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 765 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||| | ||||||||||||||||| |||||||| || |||||||| Sbjct: 764 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctgcacgaagaagccg 705 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 704 aacatggagaacatggcaaggcggccgttcttgagctccttcaccttgagctcggcg 648
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 200 bits (101), Expect = 2e-48 Identities = 152/169 (89%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 |||||||| || |||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 806 ttgccgggcacaaagttggtggcataggcccatgcgttgttgttgacggggtcggcgagg 747 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| || ||||||||||||||||| ||||||||||| ||||| || Sbjct: 746 tggtcggcgaggttctcgagcgggcccttgccggtgacgatggcctggacgaagaacccg 687 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttga 280 ||||| ||||||||||| |||||||||||||||| |||||||||||||| Sbjct: 686 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttga 638
>gb|AY112240.1| Zea mays CL187_6 mRNA sequence Length = 770 Score = 200 bits (101), Expect = 2e-48 Identities = 158/177 (89%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||| ||||| ||||||||||||||||| |||||||||| ||| | Sbjct: 472 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 413 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||| | ||||||||||||||||| |||||||| || |||||||| Sbjct: 412 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctgcacgaagaagccg 353 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 352 aacatggagaacatggcaaggcggccgttcttgagctccttcaccttgagctcggcg 296
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 194 bits (98), Expect = 1e-46 Identities = 155/174 (89%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| | ||| Sbjct: 858 ttgccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatg 799 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||||||||||||||| || |||||||| |||||||| ||||||||||| ||||| || Sbjct: 798 tggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccg 739 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcg 285 ||||| || |||||||| |||||||| ||||||| |||||| |||||||||||| Sbjct: 738 aacatggacaacatggcgaggcggcccttcttgagctccttgaccttgagctcg 685
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 194 bits (98), Expect = 1e-46 Identities = 160/178 (89%), Gaps = 2/178 (1%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 860 ttgccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgagg 801 Query: 172 tggtc-agcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcc 230 ||||| ||| |||||||| | ||||||||||||||||| ||||||||||| |||||||| Sbjct: 800 tggtcgagc-aggttctccaaggggcccttgccggtgacgatggcctggacgaagaagcc 742 Query: 231 aaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| |||||||| |||||||||||||| ||||||||||||||| Sbjct: 741 gaacatggagaacatggcgaggcggccattcttgatctccttgaccttgagctcggcg 684
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 192 bits (97), Expect = 4e-46 Identities = 157/177 (88%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||| ||||||||||| | ||||| ||||||||||||||||||||| ||| | Sbjct: 836 ttgccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgagg 777 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| | || |||||| || || |||||||||||||| |||||||||||||| || || Sbjct: 776 tggtctgtgatgttctccagtggccccttgccggtgacgatggcctggacaaaaaacccg 717 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| || |||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 716 aacatggataacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 660
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 192 bits (97), Expect = 4e-46 Identities = 154/173 (89%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| || ||||||||||||||| |||||||||| ||||| Sbjct: 1530 ttgccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcgatg 1471 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || |||||||| | ||||||||||||||||| |||||||| || |||||||| Sbjct: 1470 tggtcggccaggttctcgatggggcccttgccggtgacgatggcctgaacgaagaagccg 1411 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| || || ||||||||||||||||||||||| ||||| Sbjct: 1410 aacatggagaacatggccagccgcccgttcttgatctccttcaccttcagctc 1358
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 184 bits (93), Expect = 1e-43 Identities = 153/173 (88%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||| Sbjct: 1191 ttgccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgaga 1132 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || | |||||| || |||||||| |||||||| |||||||| || ||||| || Sbjct: 1131 tggtccgccaagttctcgagggggcccttcccggtgacgatggcctgcacgaagaacccg 1072 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| ||||| ||||||||||||||||||||||| ||||| Sbjct: 1071 aacatggagaacatggccaggcgtccgttcttgatctccttcaccttcagctc 1019
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 184 bits (93), Expect = 1e-43 Identities = 156/177 (88%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| ||| ||||||||||||| |||||||||| || | Sbjct: 820 ttgccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcggtgacg 761 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||| | ||||||||||||||||| ||||||||||| ||||| || Sbjct: 760 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaatccg 701 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| Sbjct: 700 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcg 644
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 176 bits (89), Expect = 3e-41 Identities = 155/177 (87%) Strand = Plus / Minus Query: 108 ttatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgac 167 |||||| ||||| |||||||||||||||| ||| |||||||||||||| |||||| | Sbjct: 1001 ttatttcccgggcacgaagttggtggcaatgagccacgcgttgttgttgacagggtcggc 942 Query: 168 gatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaa 227 |||||||| || |||| ||| | ||||||||||||||||| |||||||| |||||||| Sbjct: 941 aatgtggtcggcaaggtcctccaatgggcccttgccggtgacaatggcctgcacaaagaa 882 Query: 228 gccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||||||| ||||||||||| |||||||| |||||||||||||| ||||||||||| Sbjct: 881 gccaaacatggagaacatggcgaggcggccattcttgatctccttaaccttgagctc 825 Score = 61.9 bits (31), Expect = 1e-06 Identities = 63/71 (88%), Gaps = 2/71 (2%) Strand = Plus / Plus Query: 202 ccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttc 261 |||||||| |||||||| |||| |||||||| ||| ||||||||||| |||||||| || Sbjct: 1108 ccggtgacaatggcctgcacaa-gaagccaa-catggagaacatggcgaggcggccatta 1165 Query: 262 ttgatctcctt 272 ||||||||||| Sbjct: 1166 ttgatctcctt 1176
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 168 bits (85), Expect = 6e-39 Identities = 151/173 (87%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | ||||||||||||||| ||||||||| ||| Sbjct: 574 ttgccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgaca 515 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||| | || |||||||||||||| ||||||||||| ||||| ||| Sbjct: 514 tggtcgaagaggttctcgatgggtcccttgccggtgacgatggcctggacgaagaaccca 455 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| |||||||||||||||| |||||||||||||||||| Sbjct: 454 aacatggagaacatggcgaggcggccgttcttgagctccttcaccttgagctc 402
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b binding protein (cab gene) Length = 760 Score = 167 bits (84), Expect = 2e-38 Identities = 126/140 (90%) Strand = Plus / Minus Query: 145 gcgttgttgttgacggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccg 204 |||||||||||||| |||||| | |||||||| || |||||||| | |||||||||||| Sbjct: 759 gcgttgttgttgacagggtcggcaatgtggtcggcaaggttctccaatgggcccttgccg 700 Query: 205 gtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttg 264 ||||| |||||||| ||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 699 gtgacaatggcctgcacaaagaagccaaacatggagaacatggcgaggcggccattcttg 640 Query: 265 atctccttcaccttgagctc 284 |||||||| ||||||||||| Sbjct: 639 atctccttaaccttgagctc 620
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 161 bits (81), Expect = 1e-36 Identities = 153/177 (86%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| || |||||||| |||||||| ||||||||| ||| Sbjct: 971 ttgccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggcgaga 912 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| || | |||||| || || ||||| |||||||| |||||||| || ||||| || Sbjct: 911 tggtccgccaagttctcgaggggccccttcccggtgacgatggcctgcacgaagaatccg 852 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| ||||||||||| ||||| ||||||||||||||||| ||||| ||||||||| Sbjct: 851 aacatggagaacatggccaggcgtccgttcttgatctccttgaccttcagctcggcg 795
>ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA Length = 972 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 803 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 745 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 744 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 685 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 684 ttcttgatctccttgaccttgagctcggcg 655
>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 995 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 827 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 769 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 768 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 709 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 708 ttcttgatctccttgaccttgagctcggcg 679
>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1007 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 827 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 769 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 768 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 709 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 708 ttcttgatctccttgaccttgagctcggcg 679
>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1108 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 829 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 771 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 770 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 711 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 710 ttcttgatctccttgaccttgagctcggcg 681
>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1000 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 774 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 713 ttcttgatctccttgaccttgagctcggcg 684
>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1012 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 774 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 713 ttcttgatctccttgaccttgagctcggcg 684
>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1032 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 834 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 776 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 775 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 716 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 715 ttcttgatctccttgaccttgagctcggcg 686
>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1159 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 867 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 809 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 808 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 749 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 748 ttcttgatctccttgaccttgagctcggcg 719
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 22434840 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 22434782 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 22434781 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 22434722 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 22434721 ttcttgatctccttgaccttgagctcggcg 22434692
>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0406F06 Length = 144533 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 95907 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 95849 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 95848 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 95789 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 95788 ttcttgatctccttgaccttgagctcggcg 95759
>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full insert sequence Length = 1012 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 774 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 713 ttcttgatctccttgaccttgagctcggcg 684
>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full insert sequence Length = 1000 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 774 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 713 ttcttgatctccttgaccttgagctcggcg 684
>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full insert sequence Length = 973 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 803 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 745 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 744 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 685 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 684 ttcttgatctccttgaccttgagctcggcg 655
>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full insert sequence Length = 1012 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 774 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 713 ttcttgatctccttgaccttgagctcggcg 684
>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full insert sequence Length = 995 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 827 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 769 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 768 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 709 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 708 ttcttgatctccttgaccttgagctcggcg 679
>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full insert sequence Length = 1007 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 827 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 769 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 768 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 709 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 708 ttcttgatctccttgaccttgagctcggcg 679
>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full insert sequence Length = 1000 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 774 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 713 ttcttgatctccttgaccttgagctcggcg 684
>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full insert sequence Length = 1032 Score = 155 bits (78), Expect = 9e-35 Identities = 134/150 (89%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 834 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 776 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 775 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 716 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 715 ttcttgatctccttgaccttgagctcggcg 686
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 153 bits (77), Expect = 4e-34 Identities = 152/177 (85%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||| |||||||||||||| |||||||| |||||||||||||||||| ||| | Sbjct: 468 ttgccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggcgagg 409 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 || || || | |||||| | || ||||||||||| || || |||||||| |||||||| Sbjct: 408 tgatcggccaagttctccaatggccccttgccggtcacgatcgcctggacgaagaagccg 349 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 ||||| || |||||||| || | ||| |||||||||||||||||||| ||||||||| Sbjct: 348 aacatggataacatggccagcctgccattcttgatctccttcaccttcagctcggcg 292
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 149 bits (75), Expect = 6e-33 Identities = 141/163 (86%) Strand = Plus / Minus Query: 122 cgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtggtcagcga 181 ||||||||||||| || |||||||||||||||||||||||||| ||| |||||| || | Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcggcca 636 Query: 182 ggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaacatcgaga 241 |||||| || || ||||||||||| || ||||||||||| ||||| || ||||| |||| Sbjct: 635 agttctcgaggggtcccttgccggtcacgatggcctggacgaagaatccgaacatggaga 576 Query: 242 acatggcaaggcggccgttcttgatctccttcaccttgagctc 284 |||| || || || ||||||||||||||||||||||| ||||| Sbjct: 575 acatcgccagccgtccgttcttgatctccttcaccttcagctc 533
>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full insert sequence Length = 1111 Score = 147 bits (74), Expect = 2e-32 Identities = 133/150 (88%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 832 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 774 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 773 ttgccggtgacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggcca 714 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| |||||||||| |||| Sbjct: 713 ttcttgatctccttgaccttgagcttggcg 684
>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full insert sequence Length = 1107 Score = 147 bits (74), Expect = 2e-32 Identities = 133/150 (88%), Gaps = 2/150 (1%) Strand = Plus / Minus Query: 140 cccaggcgttgttgttgacggggtcgacgatgtggtc-agcgaggttctcaagagggccc 198 |||||||||||||| |||||||||| ||| |||||| ||| |||||||| | |||||| Sbjct: 828 cccaggcgttgttggcgacggggtcggcgaggtggtcgagc-aggttctccaaggggccc 770 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||||||||| |||| |||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 769 ttgccggtgacgatggtctggacgaagaagccgaacatggagaacatggcgaggcggcca 710 Query: 259 ttcttgatctccttcaccttgagctcggcg 288 |||||||||||||| ||||||||||||||| Sbjct: 709 ttcttgatctccttgaccttgagctcggcg 680
>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1100 Score = 145 bits (73), Expect = 9e-32 Identities = 145/169 (85%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||| || |||||||| ||||||||||||||||| |||||||||| ||| | Sbjct: 835 ttgccggggacaaaattggtggcgtatgcccaggcgttgttggcgacggggtcggcgacg 776 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| | |||||| | ||||||||||||||||| ||||||||||| ||||| || Sbjct: 775 tggtcgaaaaagttctcgatggggcccttgccggtgacgatggcctggacgaagaaaccc 716 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttga 280 ||||| ||||||||||| ||||||||||| |||| |||||||||||||| Sbjct: 715 aacatggagaacatggcgaggcggccgttattgaactccttcaccttga 667
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 141 bits (71), Expect = 1e-30 Identities = 149/175 (85%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||||||||||||||||||||||||| | ||||||||||||||| | ||||||||| | | Sbjct: 886 atttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggcca 827 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||| |||||||||||||| | || || || |||||||| |||||||| || ||||| | Sbjct: 826 ggtgatcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatc 767 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 | ||||| || |||||||| | || ||||||||||||||||||||||| ||||| Sbjct: 766 cgaacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctc 712
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 141 bits (71), Expect = 1e-30 Identities = 149/175 (85%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||||||||||||||||||||||||| | ||||||||||||||| | ||||||||| | | Sbjct: 1964 atttgccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggcca 1905 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||| |||||||||||||| | || || || |||||||| |||||||| || ||||| | Sbjct: 1904 ggtgatcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatc 1845 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 | ||||| || |||||||| | || ||||||||||||||||||||||| ||||| Sbjct: 1844 cgaacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctc 1790
>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end Length = 351 Score = 139 bits (70), Expect = 5e-30 Identities = 145/170 (85%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||||| ||||||||||||||||| || |||||| | |||||| Sbjct: 344 ccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcggcaatgtgg 285 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || || |||||||| | || ||||| |||||||| || || || |||||||| |||||| Sbjct: 284 tcggcaaggttctccaatggaccctttccggtgacaatagcttgaacaaagaatccaaac 225 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||| ||||| | |||||||||||||||||| ||||||||||| Sbjct: 224 atggagaacatagcaagtctgccgttcttgatctcctttaccttgagctc 175
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1 gene) Length = 688 Score = 133 bits (67), Expect = 3e-28 Identities = 146/171 (85%), Gaps = 1/171 (0%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatg-cccaggcgttgttgttgacggggtcgacgatgtg 173 ||||| |||||||| |||||||| | |||| ||||||||||| |||||||| | | ||| Sbjct: 684 ccgggaacgaagtttgtggcaaaaggcccaagcgttgttgttaacggggtctgctaggtg 625 Query: 174 gtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaa 233 |||||| |||||||| | |||||||| |||||||| || |||||||| ||||| || || Sbjct: 624 gtcagcaaggttctccaacgggccctttccggtgacgatagcctggacgaagaatccgaa 565 Query: 234 catcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||| |||||||||||||| | ||||||||||| |||||| ||||||||||| Sbjct: 564 catggagaacatggcaagcctgccgttcttgagctccttaaccttgagctc 514
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 133 bits (67), Expect = 3e-28 Identities = 148/175 (84%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 ||||||||||||||||||||||||| | ||||||||||||||||| |||||||| | | Sbjct: 871 atttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagcca 812 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||| |||||||||||||| | || || || |||||||| |||||||| || ||||| | Sbjct: 811 ggtgatcagcgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatc 752 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 | ||||| || |||||||| | || ||||||||||||||||||||||| ||||| Sbjct: 751 cgaacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctc 697
>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb1) mRNA, partial cds Length = 414 Score = 133 bits (67), Expect = 3e-28 Identities = 148/175 (84%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 ||||||| || ||||||||||||||| | ||||||||||||||||| ||||||||| | | Sbjct: 287 atttgccaggtacgaagttggtggcataggcccaggcgttgttgttaacggggtcggcca 228 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||| |||||||||||||| | || || || |||||||| |||||||| || ||||| | Sbjct: 227 ggtgatcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatc 168 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 | ||||| || |||||||| | || ||||||||||||||||||||||| ||||| Sbjct: 167 cgaacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctc 113
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 131 bits (66), Expect = 1e-27 Identities = 144/170 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||||||| | |||||||||||||||||||| || | | | ||| Sbjct: 1035 ccggggacgaagttggtggcataggcccaggcgttgttgttgacaggtccagcaaggtga 976 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| ||||||||||||||| Sbjct: 975 tcggcgaggttctccaatggaccctttccggtgacaatggcctgaacaaagaagccaaac 916 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || ||||||||||| | || |||||||||| ||||||||||| ||||| Sbjct: 915 atagagaacatggccaatcgtccgttcttgagttccttcaccttaagctc 866
>gb|M30616.1|TOMCBPC2 Tomato chlorophyll a/b-binding protein Cab-1A gene , 3' end Length = 351 Score = 131 bits (66), Expect = 1e-27 Identities = 144/170 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||||||||||||||||||||||| || ||||| | | ||| Sbjct: 344 ccgggaacaaagtttgtggcaaatgcccaggcgttgttgtttacagggtctgcaaggtga 285 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| |||||||| | || ||||| ||||| || |||||||| |||||||| |||||| Sbjct: 284 tcagcaaggttctccaatggaccctttccggtaacaatggcctgaacaaagaacccaaac 225 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||| ||||| | |||||||||||||||||| ||||| ||||| Sbjct: 224 atagagaacatagcaagtctgccgttcttgatctccttaaccttaagctc 175
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial cds Length = 551 Score = 129 bits (65), Expect = 5e-27 Identities = 148/176 (84%) Strand = Plus / Minus Query: 109 tatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacg 168 ||||| |||||||||||||||||||| | ||||||||||||||||||||||||||| | Sbjct: 395 tatttaccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggcc 336 Query: 169 atgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaag 228 | ||| || |||||||| || || || || ||||| || || ||||||||||| ||||| Sbjct: 335 aggtgatcggcgaggttntcgaggggtcctttgcccgtcacgatggcctggacgaagaac 276 Query: 229 ccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || ||||| ||||||||||| | || |||||||| | |||||||||||| ||||| Sbjct: 275 ccgaacatggagaacatggccaaccgcccgttctttagctccttcaccttcagctc 220
>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb3) mRNA, complete cds Length = 1314 Score = 127 bits (64), Expect = 2e-26 Identities = 85/92 (92%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| ||||||||||| ||| Sbjct: 761 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccagg 702 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 701 cggccgttcttgatctccttcaccttcagctc 670
>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m7 (Lhcbm7) mRNA, complete cds Length = 1016 Score = 127 bits (64), Expect = 2e-26 Identities = 85/92 (92%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| ||||||||||| ||| Sbjct: 706 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccagg 647 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 646 cggccgttcttgatctccttcaccttcagctc 615
>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m10 (Lhcbm10) mRNA, complete cds Length = 1077 Score = 127 bits (64), Expect = 2e-26 Identities = 85/92 (92%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| ||||||||||| ||| Sbjct: 707 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccagg 648 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 647 cggccgttcttgatctccttcaccttcagctc 616
>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b binding protein (LhcII-1.3) mRNA, complete cds; nuclear gene for chloroplast product Length = 1100 Score = 127 bits (64), Expect = 2e-26 Identities = 85/92 (92%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| ||||||||||| ||| Sbjct: 701 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccagg 642 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 641 cggccgttcttgatctccttcaccttcagctc 610
>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-1.3, complete cds Length = 1107 Score = 127 bits (64), Expect = 2e-26 Identities = 85/92 (92%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| ||||||||||| ||| Sbjct: 735 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccagg 676 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 675 cggccgttcttgatctccttcaccttcagctc 644
>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-1.3, complete cds Length = 1835 Score = 127 bits (64), Expect = 2e-26 Identities = 85/92 (92%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| ||||||||||| ||| Sbjct: 1577 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccagg 1518 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 1517 cggccgttcttgatctccttcaccttcagctc 1486
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 125 bits (63), Expect = 8e-26 Identities = 141/167 (84%) Strand = Plus / Minus Query: 121 acgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtggtcagcg 180 ||||||||||||||||| |||||||| |||||||||||||| ||| | | ||| || || Sbjct: 661 acgaagttggtggcaaacgcccaggcattgttgttgacgggatcggcaaggtgatcggcc 602 Query: 181 aggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaacatcgag 240 | |||||| || || |||||||| || || || ||||| |||||||| || ||||||||| Sbjct: 601 aagttctccagtggccccttgcccgtcacgatcgcctgaacaaagaacccgaacatcgag 542 Query: 241 aacatggcaaggcggccgttcttgatctccttcaccttgagctcggc 287 ||||| || || | ||| |||||||||||||||||||| |||||||| Sbjct: 541 aacatagccagcctgccattcttgatctccttcaccttcagctcggc 495
>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence Length = 958 Score = 125 bits (63), Expect = 8e-26 Identities = 147/175 (84%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| |||||||| ||||| ||||| || |||||||| |||||||| |||||||| | | Sbjct: 840 attttccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaa 781 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||||||||| |||||||| | || ||||| |||||||| || || || |||||||| | Sbjct: 780 ggtggtcagcaaggttctccaatggaccctttccggtgacaatagcttgaacaaagaatc 721 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||||| |||||||| ||||| | ||||||||||||||||| ||||||||||| Sbjct: 720 caaacatagagaacatagcaagtctaccgttcttgatctcctttaccttgagctc 666
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 125 bits (63), Expect = 8e-26 Identities = 147/175 (84%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 ||||||||||||||||||||||||| | ||||||||||||||||| |||||||| | | Sbjct: 862 atttgccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagcca 803 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||| |||| ||||||||| | || || || |||||||| |||||||| || ||||| | Sbjct: 802 ggtgatcagtgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatc 743 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 | ||||| || |||||||| | || ||||||||||||||||||||||| ||||| Sbjct: 742 cgaacatggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctc 688
>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 125 bits (63), Expect = 8e-26 Identities = 147/175 (84%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| |||||||| ||||| ||||| || ||||| ||||||||||| |||||||| | | Sbjct: 796 attttccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtctgcaa 737 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||||||||| |||||||| | || ||||| ||||| || |||||||| || ||||| | Sbjct: 736 ggtggtcagcaaggttctccaatggaccctttccggtaacaatggcctgaacgaagaatc 677 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||||| |||||||| ||||| | ||||||||| |||||||| ||||||||||| Sbjct: 676 caaacatagagaacatagcaagtctgccgttcttaatctcctttaccttgagctc 622
>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein (Lhcb) mRNA, complete cds; nuclear gene for chloroplast product Length = 1024 Score = 123 bits (62), Expect = 3e-25 Identities = 122/142 (85%) Strand = Plus / Minus Query: 143 aggcgttgttgttgacggggtcgacgatgtggtcagcgaggttctcaagagggcccttgc 202 ||||||||||| || |||||| | | | |||||| | ||||||| || |||||||||| Sbjct: 759 aggcgttgttggtgccggggttggccaggtggtcggacaggttctgcagggggcccttgc 700 Query: 203 cggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttct 262 |||| || |||||||| || |||||||| ||||| ||||||||||| ||||||||||||| Sbjct: 699 cggtcacgatggcctgaacgaagaagccgaacatggagaacatggccaggcggccgttct 640 Query: 263 tgatctccttcaccttgagctc 284 |||||||||||||||| ||||| Sbjct: 639 tgatctccttcaccttcagctc 618
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 123 bits (62), Expect = 3e-25 Identities = 146/174 (83%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| | |||||||||||||||||||| ||||| | | |||| Sbjct: 843 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcagcaaggtgg 784 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| ||||||||||| ||||| || ||| Sbjct: 783 tcggcgaggttctccaatggtccctttccggtgacaatggcctggacgaagaacccgaac 724 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 | ||||||||||| | | |||||||||| ||||| ||||||||||||||| Sbjct: 723 acggagaacatggccaacctaccgttcttgagttccttgaccttgagctcggcg 670
>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein Length = 1011 Score = 123 bits (62), Expect = 3e-25 Identities = 122/142 (85%) Strand = Plus / Minus Query: 143 aggcgttgttgttgacggggtcgacgatgtggtcagcgaggttctcaagagggcccttgc 202 ||||||||||| || ||||||| | | ||||||||| ||||||| | |||||||||| Sbjct: 768 aggcgttgttggtgccggggtcagccaggtggtcagccaggttctggatggggcccttgc 709 Query: 203 cggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttct 262 |||| || |||||||| || |||||||| || ||||||||||||||||||||||||| Sbjct: 708 cggtcacgatggcctgcacgaagaagccgaagcaggagaacatggcaaggcggccgttct 649 Query: 263 tgatctccttcaccttgagctc 284 |||||||||||||||||||||| Sbjct: 648 tgatctccttcaccttgagctc 627
>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end Length = 351 Score = 123 bits (62), Expect = 3e-25 Identities = 143/170 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||||| ||||||||||||||||| || ||||| | |||||| Sbjct: 344 ccgggaacaaagtttgtggcaaaggcccaggcgttgttgttaactgggtcagcaatgtgg 285 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || || || ||||| | || ||||| || ||||| || || || ||||||||||||||| Sbjct: 284 tcggcaagattctccaatggaccctttccagtgacaatagcttgaacaaagaagccaaac 225 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||| ||||| | ||||||||||||||||||||| |||||||| Sbjct: 224 atggagaacatagcaagtctgccgttcttgatctccttcactttgagctc 175
>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 988 Score = 123 bits (62), Expect = 3e-25 Identities = 122/142 (85%) Strand = Plus / Minus Query: 143 aggcgttgttgttgacggggtcgacgatgtggtcagcgaggttctcaagagggcccttgc 202 ||||||||||| || |||||| | | | |||||| | ||||||| || |||||||||| Sbjct: 743 aggcgttgttggtgccggggttggccaggtggtcggacaggttctgcagggggcccttgc 684 Query: 203 cggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttct 262 |||| || |||||||| || |||||||| ||||| ||||||||||| ||||||||||||| Sbjct: 683 cggtcacgatggcctgaacgaagaagccgaacatggagaacatggccaggcggccgttct 624 Query: 263 tgatctccttcaccttgagctc 284 |||||||||||||||| ||||| Sbjct: 623 tgatctccttcaccttcagctc 602
>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev Length = 326 Score = 121 bits (61), Expect = 1e-24 Identities = 103/117 (88%) Strand = Plus / Plus Query: 171 gtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcc 230 |||||||||||||||||| || |||||||| || ||||| ||||| || |||||| | || Sbjct: 9 gtggtcagcgaggttctcgagcgggcccttaccagtgacgatggcttgcacaaagtatcc 68 Query: 231 aaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggc 287 |||||| || ||||| ||||| || |||||||||||||||||||||||||||||||| Sbjct: 69 aaacatggaaaacattgcaagacgaccgttcttgatctccttcaccttgagctcggc 125
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 121 bits (61), Expect = 1e-24 Identities = 145/173 (83%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||||||||| | |||||||| ||||||||||| ||||| | | | Sbjct: 819 ttgccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtccgcaagg 760 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 || ||||| |||||||| | || ||||| |||||||| |||||||| |||||||| ||| Sbjct: 759 tgatcagcaaggttctccaatggacccttaccggtgacaatggcctgaacaaagaaccca 700 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| ||||||||||| | | |||||||||| ||||||||||| ||||| Sbjct: 699 aacatagagaacatggccaatctcccgttcttgagttccttcaccttaagctc 647
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Plus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 2492 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 2551 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 2552 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 2611 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 2612 atagagaacatagccaaccttccgttcttgagctccttcacctt 2655
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Plus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 2492 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 2551 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 2552 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 2611 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 2612 atagagaacatagccaaccttccgttcttgagctccttcacctt 2655
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 846 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 787 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 786 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 727 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 726 atagagaacatagccaaccttccgttcttgagctccttcacctt 683
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 804 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 745 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 744 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 685 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 684 atagagaacatagccaaccttccgttcttgagctccttcacctt 641
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 791 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 732 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 731 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 672 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 671 atagagaacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 846 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 787 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 786 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 727 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 726 atagagaacatagccaaccttccgttcttgagctccttcacctt 683
>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m1 gene, complete cds; nuclear gene for chloroplast product Length = 1934 Score = 119 bits (60), Expect = 5e-24 Identities = 84/92 (91%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || |||||||| || |||||||| ||||| ||||||||||| ||| Sbjct: 1417 gggcccttgccggtcacgatggcctgaacgaagaagccgaacatggagaacatggccagg 1358 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 1357 cggccgttcttgatctccttcaccttcagctc 1326
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Plus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 93210 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 93269 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 93270 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 93329 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 93330 atagagaacatagccaaccttccgttcttgagctccttcacctt 93373 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 96098 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 96039 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 96038 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 95979 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 95978 atagagaacatagccaaccttccgttcttgagctccttcacctt 95935
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 80992 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 80933 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 80932 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 80873 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 80872 atagagaacatagccaaccttccgttcttgagctccttcacctt 80829 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Plus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 78104 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 78163 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 78164 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 78223 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 78224 atagagaacatagccaaccttccgttcttgagctccttcacctt 78267
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 791 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 732 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 731 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 672 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 671 atagagaacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 791 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 732 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 731 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 672 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 671 atagagaacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 791 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 732 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 731 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 672 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 671 atagagaacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 842 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 783 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 782 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 723 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 722 atagagaacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 842 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 783 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 782 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 723 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 722 atagagaacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 842 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 783 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 782 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 723 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 722 atagagaacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 842 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 783 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 782 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 723 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 722 atagagaacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 842 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 783 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 782 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 723 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 722 atagagaacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 842 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 783 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 782 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 723 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 722 atagagaacatagccaaccttccgttcttgagctccttcacctt 679
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 823 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 764 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 763 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 704 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 703 atagagaacatagccaaccttccgttcttgagctccttcacctt 660
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 826 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 767 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 766 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 707 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 706 atagagaacatagccaaccttccgttcttgagctccttcacctt 663
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Plus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 93 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 152 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 153 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 212 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 213 atagagaacatagccaaccttccgttcttgagctccttcacctt 256
>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein precursor (cabII-2) mRNA, complete cds Length = 1068 Score = 119 bits (60), Expect = 5e-24 Identities = 84/92 (91%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| |||||||| || ||| Sbjct: 689 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatagccagg 630 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 629 cggccgttcttgatctccttcaccttcagctc 598
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 119 bits (60), Expect = 5e-24 Identities = 138/164 (84%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 1091 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 1032 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 1031 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 972 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 971 atagagaacatagccaaccttccgttcttgagctccttcacctt 928
>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene, complete cds Length = 2095 Score = 119 bits (60), Expect = 5e-24 Identities = 93/104 (89%) Strand = Plus / Minus Query: 183 gttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaa 242 |||||||| ||||||||||||||||| |||||||| || ||||| |||||||| ||||| Sbjct: 1671 gttctcaacggggcccttgccggtgacaatggcctgcacgaagaacccaaacatggagaa 1612 Query: 243 catggcaaggcggccgttcttgatctccttcaccttgagctcgg 286 ||| || || || ||||||||||||||||||||||||||||||| Sbjct: 1611 catagcgagacgcccgttcttgatctccttcaccttgagctcgg 1568
>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1256 Score = 119 bits (60), Expect = 5e-24 Identities = 84/92 (91%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| |||||||| || ||| Sbjct: 705 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatagccagg 646 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 645 cggccgttcttgatctccttcaccttcagctc 614
>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 1781 Score = 119 bits (60), Expect = 5e-24 Identities = 84/92 (91%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || |||||||| || |||||||| ||||| ||||||||||| ||| Sbjct: 1330 gggcccttgccggtcacgatggcctgaacgaagaagccgaacatggagaacatggccagg 1271 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 1270 cggccgttcttgatctccttcaccttcagctc 1239
>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1508 Score = 119 bits (60), Expect = 5e-24 Identities = 84/92 (91%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| |||||||| || ||| Sbjct: 1386 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatagccagg 1327 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 1326 cggccgttcttgatctccttcaccttcagctc 1295
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 117 bits (59), Expect = 2e-23 Identities = 146/175 (83%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 ||||||| ||||| ||||||||||| | |||||||||||||||||||| ||||| ||| Sbjct: 836 atttgccagggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcagcga 777 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||| || ||||||||||| || || || ||||| || || ||||||||||| ||||| | Sbjct: 776 ggtgatcggcgaggttctctaggggtcctttgcctgtcacgatggcctggacgaagaacc 717 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 | ||||| ||||||||||| | || |||||||| | |||||||||||| ||||| Sbjct: 716 cgaacatggagaacatggccaaccgcccgttctttagctccttcaccttcagctc 662
>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds Length = 1253 Score = 117 bits (59), Expect = 2e-23 Identities = 146/175 (83%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| |||||||| ||||| ||||| || |||||||| |||||||| |||||||| | | Sbjct: 986 attttccggggacaaagtttgtggcgaaagcccaggcattgttgtttacggggtctgcaa 927 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||| ||||| |||||||| | || ||||| |||||||| || || || |||||||| | Sbjct: 926 ggtgatcagcaaggttctccaatggaccctttccggtgacaatagcttgaacaaagaatc 867 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||||| |||||||| ||||| | ||||||||||||||||| ||||||||||| Sbjct: 866 caaacatagagaacatagcaagtctaccgttcttgatctcctttaccttgagctc 812
>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7965 Score = 117 bits (59), Expect = 2e-23 Identities = 146/175 (83%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| |||||||| ||||| |||||| | | ||||||||||||||| || ||||| | | Sbjct: 5130 attttccggggacaaagtttgtggcataggaccaggcgttgttgttaacagggtctgcaa 5071 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||||||||| |||||||| | |||||||| ||||| || |||||||| |||||||| | Sbjct: 5070 ggtggtcagcaaggttctccaatgggccctttccggtaacaatggcctgaacaaagaatc 5011 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 | ||||| |||||||||||||| | || |||||||||||||| || |||||||| Sbjct: 5010 cgaacatagagaacatggcaagtctcccattcttgatctcctttactttgagctc 4956 Score = 85.7 bits (43), Expect = 7e-14 Identities = 145/179 (81%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| |||||||| ||||| ||||| | ||||| || |||||||| || ||||| | | Sbjct: 7670 attttccggggacaaagtttgtggcgtaggcccaagcattgttgttaactgggtctgcaa 7611 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||||||||| |||||||| | |||||||| || || || ||||| || |||||||| | Sbjct: 7610 ggtggtcagcaaggttctctaatgggccctttccagtaacaatggcttgaacaaagaatc 7551 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 | ||||| ||||||||||| || | |||||||| ||||| || ||||||||||||||| Sbjct: 7550 cgaacatagagaacatggcgagtcttccgttcttaatctcttttaccttgagctcggcg 7492 Score = 79.8 bits (40), Expect = 4e-12 Identities = 118/144 (81%) Strand = Plus / Minus Query: 141 ccaggcgttgttgttgacggggtcgacgatgtggtcagcgaggttctcaagagggccctt 200 ||||||||||||||| || ||||| | | |||||||| |||||||| | || || || Sbjct: 2646 ccaggcgttgttgttaactgggtcagcaagatggtcagcaaggttctccaatggaccttt 2587 Query: 201 gccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgtt 260 || || || |||||||| |||||||| || ||||| |||||||||||||| | ||| || Sbjct: 2586 tccagtaacaatggcctgaacaaagaatccgaacatagagaacatggcaagcctgccatt 2527 Query: 261 cttgatctccttcaccttgagctc 284 |||||||||||| || |||||||| Sbjct: 2526 cttgatctcctttactttgagctc 2503
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZE01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 291 Score = 115 bits (58), Expect = 8e-23 Identities = 136/162 (83%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 162 ccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 103 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 102 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 43 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacc 276 || |||||||| || | | |||||||||| |||||||||| Sbjct: 42 atagagaacatagccaaccttccgttcttgagctccttcacc 1
>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 115 bits (58), Expect = 8e-23 Identities = 124/146 (84%) Strand = Plus / Minus Query: 139 gcccaggcgttgttgttgacggggtcgacgatgtggtcagcgaggttctcaagagggccc 198 |||||||| |||||||| |||||||| | | ||||||||| |||||||| | || ||| Sbjct: 767 gcccaggcattgttgttaacggggtctgcaaggtggtcagcaaggttctccaatggaccc 708 Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 || ||||| || |||||||| |||||||| |||||||| |||||||| ||||| | ||| Sbjct: 707 tttccggtaacaatggcctgaacaaagaatccaaacatagagaacatagcaagtctaccg 648 Query: 259 ttcttgatctccttcaccttgagctc 284 |||||||||||||| ||||||||||| Sbjct: 647 ttcttgatctcctttaccttgagctc 622
>gb|M30618.1|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-1C gene, 3' end Length = 351 Score = 115 bits (58), Expect = 8e-23 Identities = 142/170 (83%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||||| ||||||||||||||||| || ||||| | | ||| Sbjct: 344 ccgggaacaaagtttgtggcaaaagcccaggcgttgttgtttactgggtctgcaaggtga 285 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| |||||||| | || ||||| ||||| || ||||| || |||||||| |||||| Sbjct: 284 tcagcaaggttctccaatggaccctttccggtaacaatggcttgaacaaagaatccaaac 225 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||| ||||| | ||||||||||||||||| ||||||||||| Sbjct: 224 atagagaacatagcaagtctaccgttcttgatctcctttaccttgagctc 175
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7299 Score = 115 bits (58), Expect = 8e-23 Identities = 142/170 (83%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||| |||||||||| |||||||| || ||||| | | |||| Sbjct: 5156 ccgggaacaaagttagtggcatatgcccaggcattgttgttaactgggtcagcaaggtgg 5097 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || || |||||||| | || || || |||||||| || ||||| |||||||| |||||| Sbjct: 5096 tcggcaaggttctccaatggaccttttccggtgacgatagcctgaacaaagaatccaaac 5037 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||||||||| | ||| |||||||||||||| ||||||||||| Sbjct: 5036 atggagaacatggcaagtctgccattcttgatctcctttaccttgagctc 4987 Score = 75.8 bits (38), Expect = 7e-11 Identities = 137/170 (80%) Strand = Plus / Plus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||| | ||||| ||||||||||| || ||||| | | ||| Sbjct: 1877 ccgggaacaaagtttgtggcataggcccaagcgttgttgttaactgggtcagcaagatgg 1936 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || || |||||||| | || ||||| |||||||| || || || || ||||| |||||| Sbjct: 1937 tcggcaaggttctccaatggaccctttccggtgacgatagcttgaacgaagaaaccaaac 1996 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||| ||||| | || |||||||||||||| ||||||||||| Sbjct: 1997 atggagaacatagcaagtctaccattcttgatctcctttaccttgagctc 2046
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 113 bits (57), Expect = 3e-22 Identities = 144/173 (83%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||||| ||||| || |||||||| |||||||| | | ||| Sbjct: 1024 ccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaaggtga 965 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 |||||||||||||| | || || || || ||||| || || || |||||||| |||||| Sbjct: 964 tcagcgaggttctccaatggaccttttccagtgacaatagcttgtacaaagaatccaaac 905 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggc 287 || |||||||| ||||| | ||| ||||||||||||||||||||||||||||| Sbjct: 904 atggagaacatagcaagtctgccattcttgatctccttcaccttgagctcggc 852
>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m9 (Lhcbm9) mRNA, complete cds Length = 1221 Score = 111 bits (56), Expect = 1e-21 Identities = 83/92 (90%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| || |||||||||||| ||| Sbjct: 708 gggcccttgccggtcacaatggcctggacgaagaagccgaaggacgagaacatggccagg 649 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 648 cggccgttcttgatctccttcaccttcagctc 617
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 109 bits (55), Expect = 5e-21 Identities = 112/131 (85%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || |||||||||||||| |||||||||||||||||||| ||||| | | ||| Sbjct: 846 ccgggaacaaagttggtggcaaaagcccaggcgttgttgttgactgggtcagcaagatgg 787 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| |||||||| | ||| ||||| ||||| || || |||||||||||||| |||||| Sbjct: 786 tcagcaaggttctccaaaggaccctttccggtcacaatagcctggacaaagaatccaaac 727 Query: 235 atcgagaacat 245 || |||||||| Sbjct: 726 atagagaacat 716
>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence Length = 124732 Score = 109 bits (55), Expect = 5e-21 Identities = 112/131 (85%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||| ||||| |||||||| ||||| |||||||||||||||||||| ||| ||| Sbjct: 210 ccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtcagtgatatgg 151 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || || |||||||| ||||| ||||| ||||| || |||||||| || ||||| |||||| Sbjct: 150 tcggcaaggttctctagaggtccctttccggttacaatggcctgaacgaagaatccaaac 91 Query: 235 atcgagaacat 245 || |||||||| Sbjct: 90 atagagaacat 80 Score = 85.7 bits (43), Expect = 7e-14 Identities = 109/131 (83%) Strand = Plus / Plus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||| ||||| ||||| || ||||| ||||||||||| || ||||| |||||||| Sbjct: 8578 ccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtcagcgatgtgg 8637 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| ||||| | | ||| ||||| ||||| || ||||| || |||||||| |||||| Sbjct: 8638 tcagcaaggttttttaaaggtccctttccggtcacgatggcttgaacaaagaatccaaac 8697 Query: 235 atcgagaacat 245 || |||||||| Sbjct: 8698 atagagaacat 8708 Score = 85.7 bits (43), Expect = 7e-14 Identities = 109/131 (83%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||||| ||||| |||||| ||||||| || || |||||||| Sbjct: 2066 ccgggaacaaagtttgtggcaaaggcccaagcgttgctgttgactggatcagcgatgtgg 2007 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| |||||||| || || ||||| |||| || |||||||| || || || |||||| Sbjct: 2006 tcagcaaggttctctagtggtcccttttcggttacaatggcctgaacgaaaaatccaaac 1947 Query: 235 atcgagaacat 245 ||||||||||| Sbjct: 1946 atcgagaacat 1936
>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 109 bits (55), Expect = 5e-21 Identities = 145/175 (82%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| |||||||| ||||| |||||| | | ||||||||||||||| |||||||| | | Sbjct: 796 attttccggggacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaa 737 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||||||||| |||||||| | || ||||| ||||| || ||||| || || ||||| | Sbjct: 736 ggtggtcagcaaggttctccaatggaccctttccggtaacaatggcttgaacgaagaatc 677 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||||| |||||||| ||||| | || |||||||||||||| ||||||||||| Sbjct: 676 caaacatagagaacatagcaagtctaccattcttgatctcctttaccttgagctc 622
>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3386 Score = 109 bits (55), Expect = 5e-21 Identities = 130/155 (83%) Strand = Plus / Minus Query: 130 gtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtggtcagcgaggttctca 189 |||||| | ||||| ||||||||||| || |||||| | | ||||||||| |||||||| Sbjct: 2232 gtggcataggcccaagcgttgttgttaactgggtcggcaaggtggtcagcaaggttctct 2173 Query: 190 agagggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggca 249 | || ||||| ||||||||||| || || || ||||| |||||||| |||||||||||| Sbjct: 2172 aatggaccctttccggtgactatagcttgcacgaagaatccaaacatagagaacatggca 2113 Query: 250 aggcggccgttcttgatctccttcaccttgagctc 284 || | || |||||||| ||||||||||||||||| Sbjct: 2112 agtctaccattcttgatttccttcaccttgagctc 2078
>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 107 bits (54), Expect = 2e-20 Identities = 109/128 (85%) Strand = Plus / Minus Query: 157 acggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcc 216 ||||||||| ||| ||| |||||||||||||| | || ||||| |||||||| |||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacgatggcc 710 Query: 217 tggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctccttcacc 276 || || ||||| || ||||| || |||||||| | ||| ||||||||||||||||||||| Sbjct: 709 tgkacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcacc 650 Query: 277 ttgagctc 284 || ||||| Sbjct: 649 ttcagctc 642
>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II Length = 518 Score = 107 bits (54), Expect = 2e-20 Identities = 144/174 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| |||||||||||||| ||||| | | || Sbjct: 368 ccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtcagccaaatga 309 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 |||||||| ||||| | || ||||| |||||||| || ||||| |||||||| |||||| Sbjct: 308 tcagcgagattctccaacggtccctttccggtgacaatagcctgaacaaagaatccaaac 249 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 || |||||||| || | | ||||||||||||||||||||||| | ||||||| Sbjct: 248 atagagaacatagccaaccttccgttcttgatctccttcaccttcaactcggcg 195
>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein 3C-like mRNA, complete cds Length = 1055 Score = 107 bits (54), Expect = 2e-20 Identities = 141/170 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||||| ||||| ||||||||||| || ||||| | | |||| Sbjct: 832 ccgggaacaaagtttgtggcaaaggcccaagcgttgttgttaactgggtcagcaaggtgg 773 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || || |||||||| | || ||||| |||||||| || || ||||||||||| |||||| Sbjct: 772 tcggcaaggttctccaatggaccctttccggtgacaatagcttggacaaagaatccaaac 713 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||| ||||| | ||| |||||||| ||||| ||||||||||| Sbjct: 712 atagagaacatagcaagtctgccattcttgatttccttaaccttgagctc 663
>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb2) mRNA, complete cds Length = 1200 Score = 105 bits (53), Expect = 8e-20 Identities = 85/93 (91%), Gaps = 2/93 (2%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggc-aag 251 |||||||||||||| || ||||||||||| |||||||| ||||| ||||||||||| ||| Sbjct: 713 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaag 654 Query: 252 gcggccgttcttgatctccttcaccttgagctc 284 ||| ||||||||||||||||||||||| ||||| Sbjct: 653 gcg-ccgttcttgatctccttcaccttcagctc 622
>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m6 mRNA, complete cds; nuclear gene for chloroplast product Length = 1094 Score = 103 bits (52), Expect = 3e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| |||||| || ||| Sbjct: 716 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacgatgccagg 657 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 656 cggccgttcttgatctccttcaccttcagctc 625
>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 103 bits (52), Expect = 3e-19 Identities = 109/128 (85%) Strand = Plus / Minus Query: 157 acggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcc 216 ||||||||| ||| ||| |||||||||||||| | || ||||| |||||||| |||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcc 710 Query: 217 tggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctccttcacc 276 || || ||||| || ||||| || |||||||| | ||| ||||||||||||||||||||| Sbjct: 709 tgaacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcacc 650 Query: 277 ttgagctc 284 || ||||| Sbjct: 649 ttcagctc 642
>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 759 Score = 103 bits (52), Expect = 3e-19 Identities = 109/128 (85%) Strand = Plus / Minus Query: 157 acggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcc 216 ||||||||| ||| ||| |||||||||||||| | || ||||| |||||||| |||||| Sbjct: 758 acggggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacaatggcc 699 Query: 217 tggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctccttcacc 276 || || ||||| || ||||| || |||||||| | ||| ||||||||||||||||||||| Sbjct: 698 tgaacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcacc 639 Query: 277 ttgagctc 284 || ||||| Sbjct: 638 ttcagctc 631
>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 103 bits (52), Expect = 3e-19 Identities = 109/128 (85%) Strand = Plus / Minus Query: 157 acggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcc 216 ||||||||| ||| ||| |||||||||||||| | || ||||| |||||||| |||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtcccttcccggtgacgatggcc 710 Query: 217 tggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctccttcacc 276 || || ||||| || ||||| || |||||||| | ||| ||||||||||||||||||||| Sbjct: 709 tgaacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgatctccttcacc 650 Query: 277 ttgagctc 284 || ||||| Sbjct: 649 ttcagctc 642
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 103 bits (52), Expect = 3e-19 Identities = 136/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| | ||||| |||||||||| ||| |||||| | | ||| Sbjct: 833 ccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggccaaatgg 774 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 773 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 714 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 713 atagagaacatagccaaccttccgttcttgagctccttcacctt 670
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 103 bits (52), Expect = 3e-19 Identities = 137/164 (83%), Gaps = 1/164 (0%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||| |||||||| || ||||| |||||||||||||| |||||| | | ||| Sbjct: 825 ccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaatgg 767 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 766 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaac 707 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 706 atagagaacatagccaaccttccgttcttgagctccttcacctt 663
>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein Length = 1083 Score = 103 bits (52), Expect = 3e-19 Identities = 145/176 (82%) Strand = Plus / Minus Query: 109 tatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacg 168 ||||| ||||||||||| |||||||| | |||||||| |||||||| ||||||||| | Sbjct: 891 tatttaccggggacgaaattggtggcgtaggcccaggcattgttgttcacggggtcggcc 832 Query: 169 atgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaag 228 | ||| || ||||||||||| | || || ||||| || || || ||||| || |||||| Sbjct: 831 aggtgatcggcgaggttctcgatgggtcctttgcccgtcacgatcgcctgcacgaagaag 772 Query: 229 ccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || ||||| ||||||||||| | || |||||||||||||||||||| || ||||| Sbjct: 771 ccgaacatggagaacatggccaaccgtccgttcttgatctccttcactttcagctc 716
>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 986 Score = 103 bits (52), Expect = 3e-19 Identities = 145/176 (82%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 |||||||| |||||||| ||||| | ||||| ||||||||| || || || | ||| Sbjct: 845 ttgccgggaacgaagttagtggcgtaagcccaagcgttgttggcaacaggatcagcaatg 786 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| | |||||||||| ||||||||||||||||| ||||||||||| ||||| || Sbjct: 785 tggtcgactaggttctcaactgggcccttgccggtgacgatggcctggacgaagaatccg 726 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggc 287 ||||| |||||||| || || | || ||||||| ||||||||||||||||||||| Sbjct: 725 aacatggagaacatagctagccttccattcttgagctccttcaccttgagctcggc 670
>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1) gene, complete cds Length = 2290 Score = 103 bits (52), Expect = 3e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 |||||||||||||| || ||||||||||| |||||||| ||||| |||||| || ||| Sbjct: 1737 gggcccttgccggtcacgatggcctggacgaagaagccgaacatggagaacgatgccagg 1678 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| ||||| Sbjct: 1677 cggccgttcttgatctccttcaccttcagctc 1646
>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA, partial cds Length = 780 Score = 101 bits (51), Expect = 1e-18 Identities = 138/167 (82%) Strand = Plus / Minus Query: 118 gggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtggtca 177 ||||| ||||| |||||| | |||||||| |||||| |||| ||||| | | ||||||| Sbjct: 776 gggacaaagtttgtggcataagcccaggcattgttggtgactgggtcagcaaggtggtca 717 Query: 178 gcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaacatc 237 || |||||||||| || ||||| || || || ||||||||||||||||| |||||||| Sbjct: 716 gcaaggttctcaatgggtccctttccagtcacaatggcctggacaaagaaaccaaacata 657 Query: 238 gagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 |||||||| || || | || ||||||| |||||||||||| ||||| Sbjct: 656 gagaacatagccagtcttccattcttgagctccttcaccttaagctc 610
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 101 bits (51), Expect = 1e-18 Identities = 138/167 (82%) Strand = Plus / Minus Query: 109 tatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacg 168 ||||| |||||||||||||||||||| | |||||||| |||||||| ||||||||| | Sbjct: 898 tatttaccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggcc 839 Query: 169 atgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaag 228 | ||| || || |||||||| | || || ||||| || || || ||||| || |||||| Sbjct: 838 aggtgatcggcaaggttctcgatgggtcctttgcccgtcacgatcgcctgcacgaagaag 779 Query: 229 ccaaacatcgagaacatggcaaggcggccgttcttgatctccttcac 275 || ||||| ||||||||||| | || |||||||||||||||||||| Sbjct: 778 ccgaacatggagaacatggccaaccgtccgttcttgatctccttcac 732
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 101 bits (51), Expect = 1e-18 Identities = 138/167 (82%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 |||||||| |||||||||||||| || ||||| || ||||||||||| ||||| | | | Sbjct: 824 ttgccgggaacgaagttggtggcgaaggcccaagcattgttgttgactgggtcagcaagg 765 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| ||||||||||| | |||||||| || || || ||||| ||||||||||| || Sbjct: 764 tggtctgcgaggttctccaatgggccctttccagtcacaatggcttggacaaagaatccg 705 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 ||||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 704 aacatggagaacatagccaatctaccgttcttgatctccttgacctt 658
>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 101 bits (51), Expect = 1e-18 Identities = 144/175 (82%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| ||||| || ||||| |||||| | | ||||||||||||||| |||||||| | | Sbjct: 796 attttccgggaacaaagtttgtggcataagaccaggcgttgttgttaacggggtctgcaa 737 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 |||||| || |||||||| | || ||||| ||||| || || ||||| || ||||| | Sbjct: 736 ggtggtctgcaaggttctccaatggaccctttccggtaacaattgcctgaacgaagaatc 677 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||||| |||||||| ||||| | ||||||||| |||||||| ||||||||||| Sbjct: 676 caaacatagagaacatagcaagtctgccgttcttaatctcctttaccttgagctc 622
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 99.6 bits (50), Expect = 5e-18 Identities = 143/174 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| || || | | ||| Sbjct: 2369 ccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagccaaatgg 2310 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||| ||||| | || ||||| |||||||| || ||||| |||||||| |||||| Sbjct: 2309 tcggcgagattctccaacggtccctttccggtgacgatagcctgaacaaagaatccaaac 2250 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 || |||||||| || | | |||||||| |||||||||||||| | ||||||| Sbjct: 2249 atagagaacatagccaaccttccgttcttaatctccttcaccttcaactcggcg 2196
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13 Length = 1019 Score = 99.6 bits (50), Expect = 5e-18 Identities = 131/158 (82%) Strand = Plus / Minus Query: 130 gtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtggtcagcgaggttctca 189 |||||||| ||||| || |||||||| |||||||| | | ||| |||||||||||||| Sbjct: 900 gtggcaaaggcccacgcattgttgttaacggggtcagcaaggtgatcagcgaggttctcc 841 Query: 190 agagggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggca 249 | || || || |||||||| || || || |||||||| |||||||| |||||||| ||| Sbjct: 840 aatggaccttttccggtgacaatagcttgtacaaagaatccaaacatggagaacatagca 781 Query: 250 aggcggccgttcttgatctccttcaccttgagctcggc 287 || | || ||||||||||||||||||| ||||||||| Sbjct: 780 agtctaccattcttgatctccttcacctcgagctcggc 743
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 99.6 bits (50), Expect = 5e-18 Identities = 143/174 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| || || | | ||| Sbjct: 2370 ccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagccaaatgg 2311 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||| ||||| | || ||||| |||||||| || ||||| |||||||| |||||| Sbjct: 2310 tcggcgagattctccaacggtccctttccggtgacgatagcctgaacaaagaatccaaac 2251 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 || |||||||| || | | |||||||| |||||||||||||| | ||||||| Sbjct: 2250 atagagaacatagccaaccttccgttcttaatctccttcaccttcaactcggcg 2197
>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein Length = 1025 Score = 99.6 bits (50), Expect = 5e-18 Identities = 140/170 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||| | | ||||||||||||||| || ||||| | | |||| Sbjct: 852 ccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagcaaggtgg 793 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| |||||||| | || ||||| |||||||| || ||||| |||||||| |||||| Sbjct: 792 tcagcaaggttctccaatggaccctttccggtgacgatagcctgaacaaagaatccaaac 733 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||| ||||| | || |||||||| ||||| ||||||||||| Sbjct: 732 atggagaacatagcaagtctaccattcttgatttcctttaccttgagctc 683
>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase catalytic subunit B (ftrbpot gene) Length = 701 Score = 99.6 bits (50), Expect = 5e-18 Identities = 141/170 (82%), Gaps = 1/170 (0%) Strand = Plus / Plus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||| ||||| ||||| || ||| || |||||||||| |||||||| | | |||| Sbjct: 6 ccggggacaaagtttgtggcgaaagccaag-cgttgttgttaacggggtctgcaaggtgg 64 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| |||||||| | || ||||| ||||| || |||||||| || ||||| |||||| Sbjct: 65 tcagcaaggttctccaatggaccctttccggtaacaatggcctgaacgaagaatccaaac 124 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||| ||||| | ||||||||| |||||||| || |||||||| Sbjct: 125 atagagaacatagcaagtctgccgttcttaatctcctttactttgagctc 174
>emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC2-M14-017 Length = 330 Score = 97.6 bits (49), Expect = 2e-17 Identities = 79/89 (88%) Strand = Plus / Minus Query: 196 cccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcgg 255 ||||| |||||||| || ||||| || ||||| |||||||| |||||||||||||| | | Sbjct: 289 ccctttccggtgacgatagcctgaacgaagaatccaaacatggagaacatggcaagtctg 230 Query: 256 ccgttcttgatctccttcaccttgagctc 284 ||||||||||||||||| ||||||||||| Sbjct: 229 ccgttcttgatctcctttaccttgagctc 201
>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1050 Score = 97.6 bits (49), Expect = 2e-17 Identities = 145/177 (81%) Strand = Plus / Minus Query: 108 ttatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgac 167 ||||||||| ||||||||||| || || | ||||||||||||||| | || |||||| | Sbjct: 852 ttatttgcctgggacgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggc 793 Query: 168 gatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaa 227 | ||| |||||||| ||||| | || || || |||||||| ||||||||||| ||||| Sbjct: 792 caggtgatcagcgagattctcgatgggtcctttaccggtgacgatggcctggacgaagaa 733 Query: 228 gccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || ||||| || |||||||| | || |||||||||| |||||||||||| ||||| Sbjct: 732 tccgaacatagaaaacatggccaaccgcccgttcttgagctccttcaccttcagctc 676
>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1062 Score = 97.6 bits (49), Expect = 2e-17 Identities = 145/177 (81%) Strand = Plus / Minus Query: 108 ttatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgac 167 ||||||||| ||||||||||| || || | ||||||||||||||| | || |||||| | Sbjct: 849 ttatttgcctgggacgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggc 790 Query: 168 gatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaa 227 | ||| |||||||| ||||| | || || || |||||||| ||||||||||| ||||| Sbjct: 789 caggtgatcagcgagattctcgatgggtcctttaccggtgacgatggcctggacgaagaa 730 Query: 228 gccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || ||||| || |||||||| | || |||||||||| |||||||||||| ||||| Sbjct: 729 tccgaacatagaaaacatggccaaccgcccgttcttgagctccttcaccttcagctc 673
>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102, 3' end and flank Length = 302 Score = 97.6 bits (49), Expect = 2e-17 Identities = 142/173 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||||| ||||| || |||||||| |||||||| | | |||| Sbjct: 182 ccgggaacaaagtttgtggcaaaggcccacgcattgttgttaacggggtcagcaaggtgg 123 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 |||||||||||||| | || || || || ||||| || || || |||||||| |||||| Sbjct: 122 tcagcgaggttctccaatggaccttttccagtgacaatagcttgcacaaagaatccaaac 63 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggc 287 || |||||| ||||| | || ||||||||||||||||||||||||||||| Sbjct: 62 atggagaacgcagcaagtctaccattcttgatctccttcaccttgagctcggc 10
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 97.6 bits (49), Expect = 2e-17 Identities = 133/161 (82%) Strand = Plus / Minus Query: 124 aagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtggtcagcgagg 183 ||||| ||||| || ||||| || |||||||| || |||||| | | ||| ||||| ||| Sbjct: 800 aagtttgtggcgaaggcccaagcattgttgttaactgggtcggcaaggtgatcagcaagg 741 Query: 184 ttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaac 243 ||||| | || ||||| ||||| || ||||| ||||||||||| || ||||| |||||| Sbjct: 740 ttctccaatggaccctttccggtcacaatggcttggacaaagaacccgaacattgagaac 681 Query: 244 atggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| | | ||||||||||||||||||||||||||||| Sbjct: 680 atggctaatctaccgttcttgatctccttcaccttgagctc 640
>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds Length = 1240 Score = 97.6 bits (49), Expect = 2e-17 Identities = 79/89 (88%) Strand = Plus / Minus Query: 196 cccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcgg 255 ||||| |||||||| || ||||| || ||||| |||||||| |||||||||||||| | | Sbjct: 1152 ccctttccggtgacgatagcctgaacgaagaatccaaacatggagaacatggcaagtctg 1093 Query: 256 ccgttcttgatctccttcaccttgagctc 284 ||||||||||||||||| ||||||||||| Sbjct: 1092 ccgttcttgatctcctttaccttgagctc 1064
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 856 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 797 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 796 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 737 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 736 atagagaacatagccaaccttccgttcttgagctccttcacctt 693
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 794 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 735 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 734 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 675 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 674 atagagaacatagccaaccttccgttcttgagctccttcacctt 631
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 856 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 797 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 796 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 737 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 736 atagagaacatagccaaccttccgttcttgagctccttcacctt 693
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 856 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 797 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 796 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 737 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 736 atagagaacatagccaaccttccgttcttgagctccttcacctt 693
>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 95.6 bits (48), Expect = 7e-17 Identities = 108/128 (84%) Strand = Plus / Minus Query: 157 acggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcc 216 ||||||||| ||| ||| |||||||||||||| | || ||||| |||||||| |||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcc 710 Query: 217 tggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctccttcacc 276 || || ||||| || ||||| || |||||||| | ||| |||||||||| |||||||||| Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcacc 650 Query: 277 ttgagctc 284 || ||||| Sbjct: 649 ttcagctc 642
>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 95.6 bits (48), Expect = 7e-17 Identities = 108/128 (84%) Strand = Plus / Minus Query: 157 acggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcc 216 ||||||||| ||| ||| |||||||||||||| | || ||||| |||||||| |||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcc 710 Query: 217 tggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctccttcacc 276 || || ||||| || ||||| || |||||||| | ||| |||||||||| |||||||||| Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcacc 650 Query: 277 ttgagctc 284 || ||||| Sbjct: 649 ttcagctc 642
>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 95.6 bits (48), Expect = 7e-17 Identities = 108/128 (84%) Strand = Plus / Minus Query: 157 acggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcc 216 ||||||||| ||| ||| |||||||||||||| | || ||||| |||||||| |||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcc 710 Query: 217 tggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctccttcacc 276 || || ||||| || ||||| || |||||||| | ||| |||||||||| |||||||||| Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcacc 650 Query: 277 ttgagctc 284 || ||||| Sbjct: 649 ttcagctc 642
>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 95.6 bits (48), Expect = 7e-17 Identities = 108/128 (84%) Strand = Plus / Minus Query: 157 acggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcc 216 ||||||||| ||| ||| |||||||||||||| | || ||||| |||||||| |||||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgatggcc 710 Query: 217 tggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctccttcacc 276 || || ||||| || ||||| || |||||||| | ||| |||||||||| |||||||||| Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaagcgyccgttcttgagctccttcacc 650 Query: 277 ttgagctc 284 || ||||| Sbjct: 649 ttcagctc 642
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||||||||| ||||| || ||||||||||| || || | | ||| Sbjct: 836 ccggggacgaagttggtggcaaaggcccatgcattgttgttgactggatcagccaaatgg 777 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| || ||||| | || ||||| |||||||| || ||||| || ||||| |||||| Sbjct: 776 tcagcaagattctccaacggtccctttccggtgacgatagcctgaacgaagaatccaaac 717 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | ||||||||||||||||||||||| Sbjct: 716 atagagaacatagccaaccttccgttcttgatctccttcacctt 673
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 862 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 803 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 802 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 743 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 742 atagagaacatagccaaccttccgttcttgagctccttcacctt 699
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZH03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 638 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 514 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 455 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 454 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 395 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 394 atagagaacatagccaaccttccgttcttgagctccttcacctt 351
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 856 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 797 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 796 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 737 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 736 atagagaacatagccaaccttccgttcttgagctccttcacctt 693
>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein Length = 928 Score = 95.6 bits (48), Expect = 7e-17 Identities = 81/92 (88%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 ||||||||||||||||| || || || || ||||| || ||||| |||||||||||||| Sbjct: 752 gggcccttgccggtgacgatagcttgcacgaagaacccgaacatagagaacatggcaaga 693 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 ||||| |||||||||||||||||||| ||||| Sbjct: 692 cggccattcttgatctccttcaccttaagctc 661
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 1094 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 1035 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 1034 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 975 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 974 atagagaacatagccaaccttccgttcttgagctccttcacctt 931
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||||||||||||||| || || ||||| || ||||||||||| || || | | |||| Sbjct: 794 ccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagtgg 735 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| |||||||| || ||||| |||||| Sbjct: 734 tccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaaac 675 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 674 atagagaacatagccaaccttccgttcttgagctccttcacctt 631
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein precursor, complete cds Length = 964 Score = 95.6 bits (48), Expect = 7e-17 Identities = 135/164 (82%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| |||||||||||||| | ||||||||||||||| ||||||||| | | |||| Sbjct: 839 ccgggaacgaagttggtggcgtaggcccaggcgttgttggcaacggggtcggccaagtgg 780 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || | |||||| || || ||||| || || || ||||||||||| ||||| || ||| Sbjct: 779 tcgttcaagttctccaggggtccctttccagtcacgatggcctggacgaagaacccgaac 720 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || ||||||||||| | |||||||||||||||||||||||||| Sbjct: 719 attgagaacatggccaatcggccgttcttgatctccttcacctt 676
>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*2) mRNA, complete cds; nuclear gene for chloroplast product Length = 932 Score = 93.7 bits (47), Expect = 3e-16 Identities = 110/131 (83%) Strand = Plus / Minus Query: 118 gggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtggtca 177 ||||| ||||||||||| | |||||||||||||||||||| |||||| | | ||| || Sbjct: 841 gggacaaagttggtggcgtaggcccaggcgttgttgttgacagggtcggcaaggtgatcg 782 Query: 178 gcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaacatc 237 ||||||||||| | ||| |||||||| ||||| ||||| || || ||||| ||||| || Sbjct: 781 gcgaggttctccaaaggtcccttgccagtgacaatggcttgaacgaagaaaccaaatatg 722 Query: 238 gagaacatggc 248 ||||||||||| Sbjct: 721 gagaacatggc 711
>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting chlorophyll a/b-binding protein 1, complete cds Length = 1975 Score = 93.7 bits (47), Expect = 3e-16 Identities = 137/167 (82%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 |||||||| |||||||||||||| ||||||| ||||||||| |||||||| | | | Sbjct: 1848 ttgccgggaacgaagttggtggcgtatgcccatgcgttgttggcaacggggtctgccaag 1789 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 ||||| | |||||| | ||||||||||| || || || ||||| || ||||| || Sbjct: 1788 tggtcgttcaagttctccaaggggcccttgccagtcacaattgcctgcacgaagaatccg 1729 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 |||||||||||||| ||||| |||||||||||||| ||||||||||| Sbjct: 1728 aacatcgagaacatcgcaagtcggccgttcttgatttccttcacctt 1682
>gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b binding protein mRNA, partial cds; nuclear gene for chloroplast product Length = 600 Score = 93.7 bits (47), Expect = 3e-16 Identities = 92/107 (85%) Strand = Plus / Minus Query: 181 aggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaacatcgag 240 ||||||||||||||||| || |||||||| || || || |||||||| || ||||| ||| Sbjct: 527 aggttctcaagagggccttttccggtgacaatagcttgaacaaagaatccgaacatggag 468 Query: 241 aacatggcaaggcggccgttcttgatctccttcaccttgagctcggc 287 ||||| || | | |||||||||||||||||||||||||||||||| Sbjct: 467 aacatagccaatcttccgttcttgatctccttcaccttgagctcggc 421
>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds Length = 1135 Score = 93.7 bits (47), Expect = 3e-16 Identities = 143/175 (81%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| |||||||| ||||| ||||| || ||||| || ||||| ||||| ||||| ||| Sbjct: 1004 attttccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcga 945 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 |||||||| |||||||| | || ||||| |||||||| || || || |||||||||| Sbjct: 944 gatggtcagcaaggttctccaatggaccctttccggtgacgatagcttgaacaaagaagc 885 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 | ||||| |||||||| ||||| | || ||||| ||||| |||||||||||||| Sbjct: 884 cgaacatggagaacatagcaagtctaccattcttaatctctttcaccttgagctc 830
>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3659 Score = 93.7 bits (47), Expect = 3e-16 Identities = 146/179 (81%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| |||||||| ||||| ||||| | ||||| || |||||||| || ||||| | | Sbjct: 932 attttccggggacaaagtttgtggcgtacgcccaagcattgttgttaactgggtctgcaa 873 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||||||||| |||||||| | |||||||| ||||| || ||||| || |||||||| | Sbjct: 872 ggtggtcagcaaggttctctaatgggccctttccggtaacaatggcttgaacaaagaatc 813 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcggcg 288 | ||||| ||||||||||| || | |||||||| ||||| || ||||||||||||||| Sbjct: 812 cgaacatagagaacatggcgagtcttccgttcttaatctcttttaccttgagctcggcg 754
>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete cds Length = 1010 Score = 93.7 bits (47), Expect = 3e-16 Identities = 143/175 (81%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| |||||||| ||||| |||||| | ||||| || |||||| |||| ||||| | | Sbjct: 840 atttcccggggacaaagtttgtggcataagcccaagcattgttggtgactgggtcagcaa 781 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||||||||| |||||||||| || ||||| || || || |||||||| |||||||| | Sbjct: 780 ggtggtcagcaaggttctcaatgggtccctttccagtcacaatggcctgaacaaagaatc 721 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||||| |||||||| || || | || ||||||| |||||||||||| ||||| Sbjct: 720 caaacatagagaacatagccagtcttccattcttgagctccttcaccttaagctc 666
>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070 (LHCB2.2) mRNA, complete cds Length = 1060 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 755 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 696 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 695 ttcaccttcagctc 682
>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein-tyrosine kinase AT2G05060 transcript variant AT2G05060.2 mRNA, complete cds Length = 2130 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Plus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 1385 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 1444 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 1445 ttcaccttcagctc 1458
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 91.7 bits (46), Expect = 1e-15 Identities = 134/164 (81%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| |||||||||||||| || || | | ||| Sbjct: 625 ccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagccaaatgg 566 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | || ||||| |||||||| ||||| || || ||||| |||||| Sbjct: 565 tcggcgaggttctccaatggtccctttccggtgacgatggcttgaacgaagaatccaaac 506 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||| ||||||| Sbjct: 505 atagagaacatagccaaccttccgttcttgagctccktcacctt 462
>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 752 Score = 91.7 bits (46), Expect = 1e-15 Identities = 94/110 (85%) Strand = Plus / Minus Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 |||||||||||||| | || |||||||||||||| |||||||| || ||||| || ||| Sbjct: 748 tcagcgaggttctcgatgggtcccttgccggtgacgatggcctgcacgaagaatccgaac 689 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || || |||||||| | ||| |||||||||| |||||||||||| ||||| Sbjct: 688 atggaaaacatggccaagcgcccgttcttgagctccttcaccttcagctc 639
>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 760 Score = 91.7 bits (46), Expect = 1e-15 Identities = 94/110 (85%) Strand = Plus / Minus Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 |||||||||||||| | || ||||| |||||||| |||||||| || ||||| || ||| Sbjct: 751 tcagcgaggttctcgatgggtccctttccggtgacaatggcctgcacgaagaatccgaac 692 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || || |||||||| | ||| ||||||||||||||||||||||| ||||| Sbjct: 691 atggaaaacatggccaagcgcccgttcttgatctccttcaccttcagctc 642
>gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b binding protein (At2g05070) mRNA, complete cds Length = 881 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 695 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 636 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 635 ttcaccttcagctc 622
>gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genomic sequence, complete sequence Length = 103889 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Plus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 81108 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 81167 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 81168 ttcaccttcagctc 81181
>gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds Length = 798 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 695 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 636 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 635 ttcaccttcagctc 622
>gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b binding protein (At2g05070; F1O13.20) mRNA, complete cds Length = 958 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 755 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 696 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 695 ttcaccttcagctc 682
>gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds Length = 929 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 753 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 694 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 693 ttcaccttcagctc 680
>emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB70ZE07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 933 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 736 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 677 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 676 ttcaccttcagctc 663
>emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS92ZF11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 906 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 744 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 685 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 684 ttcaccttcagctc 671
>emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS92ZB05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 873 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 738 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 679 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 678 ttcaccttcagctc 665
>emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS14ZC11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 743 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 684 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 683 ttcaccttcagctc 670
>emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB85ZB03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 926 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 731 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 672 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 671 ttcaccttcagctc 658
>gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA, complete cds Length = 943 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 745 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 686 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 685 ttcaccttcagctc 672
>gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA, complete cds Length = 974 Score = 91.7 bits (46), Expect = 1e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||||| |||| Sbjct: 753 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttgagctcc 694 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 693 ttcaccttcagctc 680
>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb2) mRNA, partial cds Length = 873 Score = 91.7 bits (46), Expect = 1e-15 Identities = 145/178 (81%) Strand = Plus / Minus Query: 107 cttatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcga 166 ||||||||||||| ||||| |||||||| | |||||||| |||||| |||||||| Sbjct: 742 cttatttgccgggaacgaaattggtggcgtaggcccaggcattgttggcaacggggtccg 683 Query: 167 cgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaaga 226 | | |||||| ||| || |||| |||||||| ||||| || || ||||| || |||| Sbjct: 682 ccaagtggtcgtagagattttcaattgggcccttcccggtcacgattgcctgcacgaaga 623 Query: 227 agccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 |||| ||||| ||||||||||| || || |||||||| |||||||||||||| ||||| Sbjct: 622 agccgaacatggagaacatggccagccgcccgttctttatctccttcacctttagctc 565
>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds Length = 1815 Score = 91.7 bits (46), Expect = 1e-15 Identities = 139/170 (81%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||| | | ||||||||||||||| || ||||| | | |||| Sbjct: 1772 ccgggaacaaagttagtggcataagaccaggcgttgttgttaaccgggtcagcaaggtgg 1713 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| |||||||| | || ||||| |||||||| | ||||| |||||||| |||||| Sbjct: 1712 tcagcaaggttctccaatggaccctttccggtgacgagagcctgaacaaagaatccaaac 1653 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||| ||||| | || |||||||| ||||| ||||||||||| Sbjct: 1652 atggagaacatagcaagtctaccattcttgatttcctttaccttgagctc 1603
>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding protein mRNA, partial cds Length = 191 Score = 91.7 bits (46), Expect = 1e-15 Identities = 90/106 (84%) Strand = Plus / Minus Query: 112 ttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatg 171 ||||||||||||||||| ||||| ||||||||||||||||| |||||||||| | | Sbjct: 106 ttgccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggssacg 47 Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcct 217 ||||| ||||||||| | ||||||||||||||||| ||||||| Sbjct: 46 tggtcgaagaggttctcgatggggcccttgccggtgacgatggcct 1
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 91.7 bits (46), Expect = 1e-15 Identities = 139/170 (81%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||| |||||||||||| | ||||| || ||||||||||| ||||| | | |||| Sbjct: 985 ccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagcaaggtgg 926 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| | |||||| | || ||||| ||||| || |||||||| || ||||| || ||| Sbjct: 925 tcagccaagttctccaatggtccctttccggtcacgatggcctgaacgaagaacccgaac 866 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||| || | | |||||||||||||| |||||||||||||| Sbjct: 865 attgagaacatagccaacctaccgttcttgatctctttcaccttgagctc 816
>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10, 3' end and flank Length = 367 Score = 89.7 bits (45), Expect = 5e-15 Identities = 96/113 (84%) Strand = Plus / Minus Query: 172 tggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcca 231 |||||||| |||||||| | || ||||| |||||||| || ||||| ||||| || ||| Sbjct: 167 tggtcagcaaggttctccaatggaccctttccggtgacgatagcctgaacaaaaaatcca 108 Query: 232 aacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||| |||||||| ||||| | || |||||||||||||||||||||||||| Sbjct: 107 aacatggagaacatagcaagtctaccattcttgatctccttcaccttgagctc 55
>gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvesting complex II (Lhc II) mRNA, partial cds; nuclear gene for chloroplast product Length = 537 Score = 87.7 bits (44), Expect = 2e-14 Identities = 80/92 (86%) Strand = Plus / Minus Query: 193 gggcccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaagg 252 ||||||| |||||| || |||||||| || |||||||| ||||| ||||||||| || Sbjct: 479 gggccctggccggtcacgatggcctgcacgaagaagccgaacatgctgaacatggccaga 420 Query: 253 cggccgttcttgatctccttcaccttgagctc 284 || ||||||||||||||||||||||||||||| Sbjct: 419 cgaccgttcttgatctccttcaccttgagctc 388
>gb|DQ226725.1| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence Length = 452 Score = 87.7 bits (44), Expect = 2e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 205 gtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttg 264 ||||| ||||| ||||||||||| |||||||| |||||||||||||| || ||||||||| Sbjct: 299 gtgacaatggcttggacaaagaatccaaacatggagaacatggcaagacgaccgttcttg 240 Query: 265 atctccttcaccttgagctc 284 | |||||| ||||| ||||| Sbjct: 239 agctcctttaccttcagctc 220
>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 87.7 bits (44), Expect = 2e-14 Identities = 107/128 (83%) Strand = Plus / Minus Query: 157 acggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcc 216 ||||||||| ||| ||| |||||||||||||| | || ||||| |||||||| || ||| Sbjct: 769 acggggtcggcgaggtgatcagcgaggttctcgatgggtccctttccggtgacgattgcc 710 Query: 217 tggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctccttcacc 276 || || ||||| || ||||| || |||||||| | ||| |||||||||| |||||||||| Sbjct: 709 tgcacgaagaatccgaacatggaaaacatggccaagcgcccgttcttgagctccttcacc 650 Query: 277 ttgagctc 284 || ||||| Sbjct: 649 ttcagctc 642
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 87.7 bits (44), Expect = 2e-14 Identities = 134/164 (81%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||||||||||||||| || ||||| ||||||||||| || |||||| | | ||| Sbjct: 823 ccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggcaaaatgg 764 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || ||||||||||| | ||| ||||| |||||||| ||||| || || ||||| | ||| Sbjct: 763 tcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatcaaaaa 704 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || ||||| || || | | |||||||||| |||||||||||| Sbjct: 703 atagagaaaatagccacccttccgttcttgagctccttcacctt 660
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 87.7 bits (44), Expect = 2e-14 Identities = 134/164 (81%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || |||||||||||||| ||||| |||||||||||||| || ||| | | ||| Sbjct: 864 ccgggaacaaagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatgg 805 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| |||||||| | || ||||| || ||||| ||||| || || ||||| |||||| Sbjct: 804 tcagcaaggttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaac 745 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || |||||||| || | | |||||||||| |||||||||||| Sbjct: 744 atagagaacatagccaatcttccgttcttgagctccttcacctt 701
>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R Length = 1173 Score = 87.7 bits (44), Expect = 2e-14 Identities = 116/140 (82%) Strand = Plus / Minus Query: 145 gcgttgttgttgacggggtcgacgatgtggtcagcgaggttctcaagagggcccttgccg 204 ||||||||||| || |||||| | | ||| ||||| |||||||| | ||| ||||| || Sbjct: 997 gcgttgttgttaactgggtcggcaaggtgatcagcaaggttctccaaaggaccctttcca 938 Query: 205 gtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttg 264 || || |||||||| ||||| || |||||||| || ||||| ||||| | || |||||| Sbjct: 937 gtaacgatggcctgaacaaaaaatccaaacatggaaaacatagcaagtctaccattcttg 878 Query: 265 atctccttcaccttgagctc 284 |||||||||||||||||||| Sbjct: 877 atctccttcaccttgagctc 858
>gb|AY105650.1| Zea mays PCO135935 mRNA sequence Length = 1366 Score = 87.7 bits (44), Expect = 2e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 178 gcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaacatc 237 ||||||||||| | ||||| | ||||||||| |||||||| |||||| | ||||| Sbjct: 948 gcgaggttctcgacggggccttcgccggtgacgtaggcctggatgaagaaggcgaacatg 889 Query: 238 gagaacatggcaaggcggccgttcttgatctccttcaccttgag 281 ||||||||||| || ||||||||||||||||||||||||||||| Sbjct: 888 gagaacatggcgagccggccgttcttgatctccttcaccttgag 845
>gb|K00973.1|PETCAB3 Petunia major chlorophyll a/b binding protein (Cab) clone pCab3, 3' end and flank Length = 511 Score = 87.7 bits (44), Expect = 2e-14 Identities = 119/144 (82%) Strand = Plus / Minus Query: 141 ccaggcgttgttgttgacggggtcgacgatgtggtcagcgaggttctcaagagggccctt 200 |||||| |||||||| || ||||| | | ||||||||| || ||||||| || ||||| Sbjct: 378 ccaggcattgttgttaactgggtcagcaaggtggtcagcaagattctcaaatggcccctt 319 Query: 201 gccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgtt 260 |||||||| || || || ||||| || |||||||| || ||||||||||| | || || Sbjct: 318 tccggtgacgatagcttgaacaaaaaatccaaacatggaaaacatggcaagtctaccatt 259 Query: 261 cttgatctccttcaccttgagctc 284 |||||||||||||||||||||||| Sbjct: 258 cttgatctccttcaccttgagctc 235
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 87.7 bits (44), Expect = 2e-14 Identities = 134/164 (81%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || |||||||||||| | ||||| |||||||||||||| |||||| | | || Sbjct: 845 ccgggaacaaagttggtggcataggcccatgcgttgttgttgactgggtcggcaagatga 786 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| |||||||| | ||| ||||| ||||| || || ||||| |||||||| || ||| Sbjct: 785 tcagcaaggttctccaaaggtccctttccggtcacaatagcctgaacaaagaatccgaac 726 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcacctt 278 || ||||||||||| | | ||||||||||| ||||| ||||| Sbjct: 725 atagagaacatggctaatctgccgttcttgagttccttaacctt 682
>gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-1) mRNA, complete cds Length = 957 Score = 87.7 bits (44), Expect = 2e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 178 gcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaacatc 237 ||||||||||| | ||||| | ||||||||| |||||||| |||||| | ||||| Sbjct: 806 gcgaggttctcgacggggccttcgccggtgacgtaggcctggatgaagaaggcgaacatg 747 Query: 238 gagaacatggcaaggcggccgttcttgatctccttcaccttgag 281 ||||||||||| || ||||||||||||||||||||||||||||| Sbjct: 746 gagaacatggcgagccggccgttcttgatctccttcaccttgag 703
>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein Length = 1746 Score = 85.7 bits (43), Expect = 7e-14 Identities = 73/83 (87%) Strand = Plus / Minus Query: 196 cccttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcgg 255 ||||| || ||||| || |||||||| ||||| |||||||| |||||||| || |||||| Sbjct: 1253 ccctttccagtgacaatagcctggacgaagaacccaaacatggagaacattgccaggcgg 1194 Query: 256 ccgttcttgatctccttcacctt 278 ||||||||||||||||| ||||| Sbjct: 1193 ccgttcttgatctccttaacctt 1171
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 85.7 bits (43), Expect = 7e-14 Identities = 142/175 (81%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| ||||| || ||||| |||||||| ||||| || ||||||||||| || || | | Sbjct: 796 attttccgggaacaaagtttgtggcaaaggcccatgcattgttgttgactggatctgcaa 737 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 ||||||||| || ||||| | || ||||| ||||| || ||||| || || ||||| | Sbjct: 736 ggtggtcagcaagattctccaatggaccctttccggtaacaatggcttgaacgaagaatc 677 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 ||||||| |||||||| ||||| | ||||||||| |||||||| || |||||||| Sbjct: 676 caaacatagagaacatagcaagtctgccgttcttaatctcctttactttgagctc 622
>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3663 Score = 85.7 bits (43), Expect = 7e-14 Identities = 133/163 (81%) Strand = Plus / Minus Query: 110 atttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacga 169 |||| |||||||||||||| |||||| ||||||| || || ||||| |||||||| | | Sbjct: 3347 attttccggggacgaagtttgtggcatatgcccaagcattattgttaacggggtctgcaa 3288 Query: 170 tgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagc 229 |||||||| |||||||| | || ||||| || ||||| || || || |||||||| | Sbjct: 3287 gatggtcagcaaggttctccaatggaccctttccagtgacgatagcttgaacaaagaatc 3228 Query: 230 caaacatcgagaacatggcaaggcggccgttcttgatctcctt 272 ||||||| |||||||| ||||| | ||| |||||||| ||||| Sbjct: 3227 caaacatggagaacatagcaagtctgccattcttgatttcctt 3185
>ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll binding AT2G05100 (LHCB2.1) mRNA, complete cds Length = 1068 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 756 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 697 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 696 ttcaccttcagctc 683
>gb|DQ185425.1| Rosa roxburghii clone C40 defense-related mRNA, partial sequence Length = 304 Score = 83.8 bits (42), Expect = 3e-13 Identities = 75/86 (87%) Strand = Plus / Plus Query: 199 ttgccggtgactatggcctggacaaagaagccaaacatcgagaacatggcaaggcggccg 258 ||||| ||||| ||||||||||||||||| |||||||| | ||||||||| | | || Sbjct: 160 ttgccagtgacaatggcctggacaaagaaaccaaacatggcgaacatggctaatctccca 219 Query: 259 ttcttgatctccttcaccttgagctc 284 |||||||||||||||||||||||||| Sbjct: 220 ttcttgatctccttcaccttgagctc 245
>gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence Length = 1047 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 841 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 782 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 781 ttcaccttcagctc 768
>gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 map ve013, complete sequence Length = 13145 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Plus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 5106 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 5165 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 5166 ttcaccttcagctc 5179
>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene, complete cds; nuclear gene for chloroplast product Length = 1322 Score = 83.8 bits (42), Expect = 3e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 181 aggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaacatcgag 240 ||||||| || |||||||||||| ||||| |||||||| |||||||| |||||||| ||| Sbjct: 1040 aggttctgaatagggcccttgccagtgacaatggcctgaacaaagaaaccaaacatggag 981 Query: 241 aacatggcaaggcggccgttcttgatctccttcacctt 278 ||||| || | ||| |||||||||| ||||| ||||| Sbjct: 980 aacatagccaagcgaccgttcttgagttccttgacctt 943
>gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds Length = 1001 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 754 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 695 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 694 ttcaccttcagctc 681
>gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds Length = 943 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 749 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 690 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 689 ttcaccttcagctc 676
>emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS37ZB02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 980 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 734 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 675 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 674 ttcaccttcagctc 661
>emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS18ZH11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 912 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 717 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 658 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 657 ttcaccttcagctc 644
>emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB62ZB12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 937 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| ||||| || |||||||||||||| || |||||||||| |||| Sbjct: 726 atggcttggacaaagaatccaaaaatagagaacatggcaagacgaccgttcttgagctcc 667 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 666 ttcaccttcagctc 653
>emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL79ZE01 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 859 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 732 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 673 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 672 ttcaccttcagctc 659
>emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL18ZF10 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 941 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 732 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 673 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 672 ttcaccttcagctc 659
>emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS3ZD09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 964 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 746 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 687 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 686 ttcaccttcagctc 673
>emb|BX819751.1|CNS0A9F6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS22ZH04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 391 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 197 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 138 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 137 ttcaccttcagctc 124
>emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS17ZE08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 914 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 715 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 656 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 655 ttcaccttcagctc 642
>emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS17ZE07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 917 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 717 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 658 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 657 ttcaccttcagctc 644
>emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS17ZA01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 922 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 717 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 658 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 657 ttcaccttcagctc 644
>emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS22ZD11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 934 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 737 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 678 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 677 ttcaccttcagctc 664
>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding protein, complete cds Length = 1500 Score = 83.8 bits (42), Expect = 3e-13 Identities = 147/182 (80%) Strand = Plus / Minus Query: 107 cttatttgccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcga 166 |||||||||||||| |||||||||||| | ||||||||||||||| | ||| ||| Sbjct: 1395 cttatttgccgggggtgaagttggtggcgtaagcccaggcgttgttgacggtgggatcgg 1336 Query: 167 cgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaaga 226 | | |||||| | | |||||| | |||||||| |||||||| |||||||| ||||||| Sbjct: 1335 ccaagtggtcggacaagttctcgatggggccctttccggtgacaatggcctgaacaaaga 1276 Query: 227 agccaaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctcgg 286 | || ||||| |||||||| || || | |||||||| | |||||||||||| | ||||| Sbjct: 1275 aaccgaacatggagaacatagccagcctaccgttcttcaactccttcaccttcaactcgg 1216 Query: 287 cg 288 || Sbjct: 1215 cg 1214
>gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA, complete cds Length = 967 Score = 83.8 bits (42), Expect = 3e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 211 atggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcc 270 ||||| ||||||||||| |||||||| |||||||||||||| || |||||||| | |||| Sbjct: 744 atggcttggacaaagaatccaaacatagagaacatggcaagacgaccgttcttaagctcc 685 Query: 271 ttcaccttgagctc 284 |||||||| ||||| Sbjct: 684 ttcaccttcagctc 671
>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein Length = 1080 Score = 83.8 bits (42), Expect = 3e-13 Identities = 138/170 (81%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 ||||| || ||||| |||||| | |||||||| |||||||| || ||||| | | |||| Sbjct: 860 ccgggaacaaagtttgtggcataggcccaggcattgttgttaactgggtctgcaaggtgg 801 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 || || |||||||| | || ||||| || ||||| || ||||| |||||||| |||||| Sbjct: 800 tcggcaaggttctccaatggaccctttccagtgacgatagcctgaacaaagaatccaaac 741 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || || ||||| ||||| | || |||||||||||||| ||||||||||| Sbjct: 740 atggaaaacatagcaagtctaccattcttgatctcctttaccttgagctc 691
>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein Length = 953 Score = 83.8 bits (42), Expect = 3e-13 Identities = 138/170 (81%) Strand = Plus / Minus Query: 115 ccggggacgaagttggtggcaaatgcccaggcgttgttgttgacggggtcgacgatgtgg 174 |||||||| ||||| ||||| ||||||| || |||||||| || ||||| | | ||| Sbjct: 853 ccggggacaaagtttgtggcgtatgcccaagcattgttgttaactgggtctgcaagatgg 794 Query: 175 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagccaaac 234 ||||| |||||||| | || || || || || || |||||||| |||||||| || ||| Sbjct: 793 tcagcaaggttctccaatggaccttttccagtaacaatggcctgaacaaagaatccgaac 734 Query: 235 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 || |||||||||||||| | |||||||| |||||||| ||||||||||| Sbjct: 733 atagagaacatggcaagtcttccgttcttaatctcctttaccttgagctc 684
>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein mRNA, complete sequence; nuclear gene for chloroplast product Length = 643 Score = 83.8 bits (42), Expect = 3e-13 Identities = 96/114 (84%) Strand = Plus / Minus Query: 171 gtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcc 230 |||||||||||||||||| | || ||||| ||||| || ||||| || |||||||| || Sbjct: 567 gtggtcagcgaggttctccaatggtccctttccggtaacaatggcttgaacaaagaatcc 508 Query: 231 aaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 |||||| ||||||||||| || | |||||||||| ||||||||| || ||||| Sbjct: 507 aaacatagagaacatggctagtctaccgttcttgagctccttcactttcagctc 454
>gb|AY855171.1| Eleusine coracana subsp. coracana clone 1 light harvesting protein mRNA, partial cds Length = 364 Score = 83.8 bits (42), Expect = 3e-13 Identities = 63/70 (90%) Strand = Plus / Minus Query: 213 ggcctggacaaagaagccaaacatcgagaacatggcaaggcggccgttcttgatctcctt 272 |||||||| ||||||| | ||||| ||||||||||| || | |||||||||||||||||| Sbjct: 81 ggcctggataaagaaggcgaacatggagaacatggccagcctgccgttcttgatctcctt 22 Query: 273 caccttgagc 282 |||||||||| Sbjct: 21 caccttgagc 12
>gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding protein (Cab) clone pCab146, 3' end and flank Length = 498 Score = 83.8 bits (42), Expect = 3e-13 Identities = 96/114 (84%) Strand = Plus / Minus Query: 171 gtggtcagcgaggttctcaagagggcccttgccggtgactatggcctggacaaagaagcc 230 |||||| || |||||||| | || ||||| |||||||| || ||||| |||||||| || Sbjct: 315 gtggtcggcaaggttctccaatggaccctttccggtgacgatagcctgcacaaagaatcc 256 Query: 231 aaacatcgagaacatggcaaggcggccgttcttgatctccttcaccttgagctc 284 |||||| |||||||| ||||| | || ||||| |||||||||||||||||||| Sbjct: 255 aaacatagagaacatagcaagtctaccattcttaatctccttcaccttgagctc 202 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,367,845 Number of Sequences: 3902068 Number of extensions: 2367845 Number of successful extensions: 52768 Number of sequences better than 10.0: 491 Number of HSP's better than 10.0 without gapping: 487 Number of HSP's successfully gapped in prelim test: 7 Number of HSP's that attempted gapping in prelim test: 51882 Number of HSP's gapped (non-prelim): 757 length of query: 288 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 266 effective length of database: 17,147,199,772 effective search space: 4561155139352 effective search space used: 4561155139352 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
