ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet74a12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL844847.6| Zebrafish DNA sequence from clone DKEY-13A21 in ... 42 0.50
2gb|AC148693.1| Macaca mulatta Major Histocompatibility Complex B... 42 0.50
3gb|AC164100.2| Mus musculus BAC clone RP23-11E1 from chromosome ... 40 2.0
4gb|L49462.1|NIAMTZB Catenotaenia lobata 12S ribosomal RNA gene, ... 40 2.0
5gb|AC148706.1| Macaca mulatta Major Histocompatibility Complex B... 40 2.0
6emb|CR933820.6| Zebrafish DNA sequence from clone DKEY-183J2 in ... 40 2.0
7gb|AC134987.5| Mus musculus BAC clone RP23-117E24 from 14, compl... 40 2.0
8dbj|AP004493.1| Lotus japonicus genomic DNA, chromosome 4, clone... 40 2.0
9ref|NM_002315.1| Homo sapiens LIM domain only 1 (rhombotin 1) (L... 38 7.8
10ref|XM_516184.1| PREDICTED: Pan troglodytes similar to NEDD8-con... 38 7.8
11gb|BC079734.1| Xenopus laevis cDNA clone MGC:83983 IMAGE:6945638... 38 7.8
12ref|XM_605541.2| PREDICTED: Bos taurus similar to Rhombotin-1 (C... 38 7.8
13emb|CT025560.9| Mouse DNA sequence from clone RP23-432N22 on chr... 38 7.8
14ref|XM_846106.1| PREDICTED: Canis familiaris similar to Rhomboti... 38 7.8
15ref|XM_858172.1| PREDICTED: Canis familiaris similar to Rhomboti... 38 7.8
16ref|XM_745772.1| Aspergillus fumigatus Af293 cytochrome P450 (Af... 38 7.8
17gb|AC078888.22| Homo sapiens 12q BAC RP11-49G17 (Roswell Park Ca... 38 7.8
18gb|BC096058.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRN... 38 7.8
19emb|AL513445.1|NCB7A16 Neurospora crassa DNA linkage group V BAC... 38 7.8
20emb|AL513463.1|NC9G6 Neurospora crassa DNA linkage group V Cosmi... 38 7.8
21emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, ... 38 7.8
22emb|AL035527.1|ATF17L22 Arabidopsis thaliana DNA chromosome 4, B... 38 7.8
23emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BA... 38 7.8
24emb|AJ277662.1|HSA277662 Homo sapiens partial TUB gene for tubby... 38 7.8
25emb|BX470065.7| Zebrafish DNA sequence from clone DKEY-105H11 in... 38 7.8
26gb|BC096057.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRN... 38 7.8
27gb|BC096056.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRN... 38 7.8
28gb|AC091013.7| Homo sapiens chromosome 11, clone RP11-379P15, co... 38 7.8
29emb|CR620417.1| full-length cDNA clone CS0DN004YA19 of Adult bra... 38 7.8
30emb|CR615230.1| full-length cDNA clone CS0DI069YB02 of Placenta ... 38 7.8
31dbj|AK002119.1| Homo sapiens cDNA FLJ11257 fis, clone PLACE10090... 38 7.8
32gb|AC105343.4| Homo sapiens BAC clone RP11-423J7 from 4, complet... 38 7.8
33ref|XM_697568.1| PREDICTED: Danio rerio hypothetical protein LOC... 38 7.8
34gb|AF310723.1|AF310723 Homo sapiens NEDD8-conjugating enzyme NCE... 38 7.8
35emb|BX470196.6| Zebrafish DNA sequence from clone CH211-157J23 i... 38 7.8
36dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 38 7.8
37gb|AC008192.8|AC008192 Drosophila melanogaster, chromosome 3R, r... 38 7.8
38gb|AC016776.6| Homo sapiens BAC clone RP11-574K22 from 2, comple... 38 7.8
39dbj|AP003767.3| Oryza sativa (japonica cultivar-group) genomic D... 38 7.8
40dbj|AP003487.2| Oryza sativa (japonica cultivar-group) genomic D... 38 7.8
41emb|BX088587.6| Zebrafish DNA sequence from clone DKEY-71B9 in l... 38 7.8
42gb|AC103387.11| Mus musculus chromosome 3, clone RP24-383D8, com... 38 7.8
43gb|BC069673.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRN... 38 7.8
44gb|BC069752.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRN... 38 7.8
45gb|BC069793.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRN... 38 7.8
46emb|X64247.1|HS11P15GG H.sapiens RNA for 11p15 gene, exon4 38 7.8
47emb|X64244.1|HA11P15EG H.sapiens RNA of 11p15 gene 38 7.8
48emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 i... 38 7.8
49gb|AE003726.3| Drosophila melanogaster chromosome 3R, section 64... 38 7.8
50emb|AL160314.7|CNS01RH3 Human chromosome 14 DNA sequence BAC C-2... 38 7.8
51gb|U94991.1|XLU94991 Xenopus laevis transcription facotr XLMO1 (... 38 7.8
52gb|BC010549.1| Homo sapiens ubiquitin-conjugating enzyme E2F (pu... 38 7.8
53gb|AC164412.9| Mus musculus chromosome 3, clone RP24-360M7, comp... 38 7.8
54ref|NM_080678.1| Homo sapiens ubiquitin-conjugating enzyme E2F (... 38 7.8
55gb|AC154414.2| Mus musculus BAC clone RP24-231D24 from 16, compl... 38 7.8
56gb|BC052768.1| Danio rerio Sec23 homolog A (S. cerevisiae), mRNA... 38 7.8
57ref|NM_213465.1| Danio rerio Sec23 homolog A (S. cerevisiae) (se... 38 7.8
58gb|M26682.1|HUMZNFBPAA Human T-cell translocation gene 1 (Ttg-1)... 38 7.8
59gb|BC039512.1| Homo sapiens, LIM domain only 1 (rhombotin 1), cl... 38 7.8

>emb|AL844847.6| Zebrafish DNA sequence from clone DKEY-13A21 in linkage group 11 Contains
              three novel genes, the opn1lw1 gene for opsin 1 (cone
              pigments), long-wave-sensitive, 1, a gene for novel protein
              similar to human and rodent member RAS oncogene family RAB7
              (RAB7), a gene for novel protein remotely similar to human
              host cell factor 1 (VP16-accessory protein) (HCFC1), the
              opn1sw2 gene for opsin 1 (cone pigments),
              short-wave-sensitive 1, a gene for novel protein similar to
              human and mouse CpG binding protein (CGBP), a gene for
              novel protein similar to vertebrate
              microphthalmia-associated transcription factor (MITF) and
              zebrafish transcription factor binding to IGHM enhancer 3a
              (tfe3a), a gene for novel protein similar to human and
              rodent catechol-O-methyltransferase (COMT), the flj10613l
              gene for hypothetical protein FLJ10613-like (H. sapiens), a
              gene for novel protein similar to human and mouse
              methyl-CpG binding domain protein 1 (MBD1), a gene for
              novel protein similar to zebrafish red-sensitive opsin
              (rdops), a gene for novel protein similar to mouse and
              human host cell factor C1 (VP16-accessory protein) (HCFC1),
              a gene for novel protein similar to human and rodent
              metabotropic glutamate receptors (GRM) and two CpG islands,
              complete sequence
          Length = 235174

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 121    cattcacttgttgcaaacttg 141
              |||||||||||||||||||||
Sbjct: 180442 cattcacttgttgcaaacttg 180462



to top

>gb|AC148693.1| Macaca mulatta Major Histocompatibility Complex BAC MMU240D05, complete
              sequence
          Length = 161692

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 136    aacttgaccaaacaccaaagaagcc 160
              ||||||||||| |||||||||||||
Sbjct: 104000 aacttgaccaatcaccaaagaagcc 103976



to top

>gb|AC164100.2| Mus musculus BAC clone RP23-11E1 from chromosome 14, complete sequence
          Length = 214128

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 26     caagattgtaccttgacatt 45
              ||||||||||||||||||||
Sbjct: 213791 caagattgtaccttgacatt 213772



to top

>gb|L49462.1|NIAMTZB Catenotaenia lobata 12S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 290

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 52  caatttgtctcccacacaaa 71
           ||||||||||||||||||||
Sbjct: 250 caatttgtctcccacacaaa 231



to top

>gb|AC148706.1| Macaca mulatta Major Histocompatibility Complex BAC MMU370O02, complete
             sequence
          Length = 181896

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 138   cttgaccaaacaccaaagaagcct 161
             ||||||||| ||||||||||||||
Sbjct: 94324 cttgaccaatcaccaaagaagcct 94301



to top

>emb|CR933820.6| Zebrafish DNA sequence from clone DKEY-183J2 in linkage group 11,
              complete sequence
          Length = 230267

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 122    attcacttgttgcaaacttg 141
              ||||||||||||||||||||
Sbjct: 188480 attcacttgttgcaaacttg 188461



to top

>gb|AC134987.5| Mus musculus BAC clone RP23-117E24 from 14, complete sequence
          Length = 196751

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 26  caagattgtaccttgacatt 45
           ||||||||||||||||||||
Sbjct: 283 caagattgtaccttgacatt 264



to top

>dbj|AP004493.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT08D16, TM0025b,
            complete sequence
          Length = 36100

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 4    tgtgaatattattactacca 23
            ||||||||||||||||||||
Sbjct: 3051 tgtgaatattattactacca 3070



to top

>ref|NM_002315.1| Homo sapiens LIM domain only 1 (rhombotin 1) (LMO1), mRNA
          Length = 1274

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 883 aatttgtctcccacacaaa 865



to top

>ref|XM_516184.1| PREDICTED: Pan troglodytes similar to NEDD8-conjugating enzyme
           (LOC460054), mRNA
          Length = 902

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 47  acaagcaatttgtctcccacacaaacc 73
           |||||||||||||||| |||| |||||
Sbjct: 307 acaagcaatttgtctctcacagaaacc 281



to top

>gb|BC079734.1| Xenopus laevis cDNA clone MGC:83983 IMAGE:6945638, complete cds
          Length = 1871

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 683 aatttgtctcccacacaaa 665



to top

>ref|XM_605541.2| PREDICTED: Bos taurus similar to Rhombotin-1 (Cysteine-rich protein
           TTG-1) (T-cell translocation protein 1) (LIM-only
           protein 1) (LOC527152), mRNA
          Length = 1248

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 893 aatttgtctcccacacaaa 875



to top

>emb|CT025560.9| Mouse DNA sequence from clone RP23-432N22 on chromosome 16, complete
              sequence
          Length = 212903

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      cgtgtgaatattattacta 20
              |||||||||||||||||||
Sbjct: 110789 cgtgtgaatattattacta 110807



to top

>ref|XM_846106.1| PREDICTED: Canis familiaris similar to Rhombotin-1 (Cysteine-rich
           protein TTG-1) (T-cell translocation protein 1)
           (LIM-only protein 1), transcript variant 1 (LOC610473),
           mRNA
          Length = 1259

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 893 aatttgtctcccacacaaa 875



to top

>ref|XM_858172.1| PREDICTED: Canis familiaris similar to Rhombotin-1 (Cysteine-rich
           protein TTG-1) (T-cell translocation protein 1)
           (LIM-only protein 1), transcript variant 2 (LOC610473),
           mRNA
          Length = 1090

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 965 aatttgtctcccacacaaa 947



to top

>ref|XM_745772.1| Aspergillus fumigatus Af293 cytochrome P450 (Afu6g09760) partial mRNA
          Length = 1476

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 60   ctcccacacaaaccgtttc 78
            |||||||||||||||||||
Sbjct: 1404 ctcccacacaaaccgtttc 1386



to top

>gb|AC078888.22| Homo sapiens 12q BAC RP11-49G17 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 154210

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 43    attcacaagcaatttgtct 61
             |||||||||||||||||||
Sbjct: 86585 attcacaagcaatttgtct 86567



to top

>gb|BC096058.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone
           MGC:116692 IMAGE:40000078), complete cds
          Length = 785

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 533 aatttgtctcccacacaaa 515



to top

>emb|AL513445.1|NCB7A16 Neurospora crassa DNA linkage group V BAC clone B7A16
          Length = 74014

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 129   tgttgcaaacttgaccaaa 147
             |||||||||||||||||||
Sbjct: 67846 tgttgcaaacttgaccaaa 67864



to top

>emb|AL513463.1|NC9G6 Neurospora crassa DNA linkage group V Cosmid contig 9G6
          Length = 125561

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 129  tgttgcaaacttgaccaaa 147
            |||||||||||||||||||
Sbjct: 4395 tgttgcaaacttgaccaaa 4413



to top

>emb|AL161555.2|ATCHRIV55 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 55
          Length = 194916

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 23     aggcaagattgtaccttga 41
              |||||||||||||||||||
Sbjct: 104565 aggcaagattgtaccttga 104547



to top

>emb|AL035527.1|ATF17L22 Arabidopsis thaliana DNA chromosome 4, BAC clone F17L22 (ESSAII
             project)
          Length = 107702

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 23    aggcaagattgtaccttga 41
             |||||||||||||||||||
Sbjct: 18508 aggcaagattgtaccttga 18490



to top

>emb|AL022603.1|ATF18E5 Arabidopsis thaliana DNA chromosome 4, BAC clone F18E5 (ESSAII project)
          Length = 95266

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 23    aggcaagattgtaccttga 41
             |||||||||||||||||||
Sbjct: 91557 aggcaagattgtaccttga 91539



to top

>emb|AJ277662.1|HSA277662 Homo sapiens partial TUB gene for tubby (mouse) homolog and LMO1 gene for
              LIM domain only 1 protein
          Length = 174986

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 53     aatttgtctcccacacaaa 71
              |||||||||||||||||||
Sbjct: 133515 aatttgtctcccacacaaa 133533



to top

>emb|BX470065.7| Zebrafish DNA sequence from clone DKEY-105H11 in linkage group 24,
             complete sequence
          Length = 198444

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 121   cattcacttgttgcaaacttgac 143
             |||||||||||| ||||||||||
Sbjct: 38773 cattcacttgtttcaaacttgac 38795



to top

>gb|BC096057.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone
           MGC:116691 IMAGE:40000076), complete cds
          Length = 663

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 411 aatttgtctcccacacaaa 393



to top

>gb|BC096056.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone
           MGC:116690 IMAGE:40000075), complete cds
          Length = 664

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 412 aatttgtctcccacacaaa 394



to top

>gb|AC091013.7| Homo sapiens chromosome 11, clone RP11-379P15, complete sequence
          Length = 223741

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 53     aatttgtctcccacacaaa 71
              |||||||||||||||||||
Sbjct: 165551 aatttgtctcccacacaaa 165533



to top

>emb|CR620417.1| full-length cDNA clone CS0DN004YA19 of Adult brain of Homo sapiens
           (human)
          Length = 1342

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 47  acaagcaatttgtctcccacacaaacc 73
           |||||||||||||||| |||| |||||
Sbjct: 218 acaagcaatttgtctctcacagaaacc 192



to top

>emb|CR615230.1| full-length cDNA clone CS0DI069YB02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1292

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 47  acaagcaatttgtctcccacacaaacc 73
           |||||||||||||||| |||| |||||
Sbjct: 187 acaagcaatttgtctctcacagaaacc 161



to top

>dbj|AK002119.1| Homo sapiens cDNA FLJ11257 fis, clone PLACE1009020, weakly similar
           to NIFS PROTEIN
          Length = 2971

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 47  acaagcaatttgtctcccacacaaacc 73
           |||||||||||||||| |||| |||||
Sbjct: 248 acaagcaatttgtctctcacagaaacc 222



to top

>gb|AC105343.4| Homo sapiens BAC clone RP11-423J7 from 4, complete sequence
          Length = 155217

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 112   tatattacacattcacttg 130
             |||||||||||||||||||
Sbjct: 51658 tatattacacattcacttg 51676



to top

>ref|XM_697568.1| PREDICTED: Danio rerio hypothetical protein LOC554815 (LOC554815),
            mRNA
          Length = 5521

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 122  attcacttgttgcaaactt 140
            |||||||||||||||||||
Sbjct: 4619 attcacttgttgcaaactt 4601



to top

>gb|AF310723.1|AF310723 Homo sapiens NEDD8-conjugating enzyme NCE2 (NCE2) mRNA, complete
           cds
          Length = 558

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 47  acaagcaatttgtctcccacacaaacc 73
           |||||||||||||||| |||| |||||
Sbjct: 113 acaagcaatttgtctctcacagaaacc 87



to top

>emb|BX470196.6| Zebrafish DNA sequence from clone CH211-157J23 in linkage group 24,
             complete sequence
          Length = 165383

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 121   cattcacttgttgcaaacttgac 143
             |||||||||||| ||||||||||
Sbjct: 76044 cattcacttgtttcaaacttgac 76022



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 127     cttgttgcaaacttgacca 145
               |||||||||||||||||||
Sbjct: 2400844 cttgttgcaaacttgacca 2400826



to top

>gb|AC008192.8|AC008192 Drosophila melanogaster, chromosome 3R, region 92A-92A, BAC clone
             BACR12P10, complete sequence
          Length = 186686

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 106   tcgaattatattacacatt 124
             |||||||||||||||||||
Sbjct: 66265 tcgaattatattacacatt 66247



to top

>gb|AC016776.6| Homo sapiens BAC clone RP11-574K22 from 2, complete sequence
          Length = 197425

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 47    acaagcaatttgtctcccacacaaacc 73
             |||||||||||||||| |||| |||||
Sbjct: 82865 acaagcaatttgtctctcacagaaacc 82839



to top

>dbj|AP003767.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0036F10
          Length = 149415

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 127   cttgttgcaaacttgacca 145
             |||||||||||||||||||
Sbjct: 32302 cttgttgcaaacttgacca 32284



to top

>dbj|AP003487.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0007O20
          Length = 147363

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 127    cttgttgcaaacttgacca 145
              |||||||||||||||||||
Sbjct: 122645 cttgttgcaaacttgacca 122627



to top

>emb|BX088587.6| Zebrafish DNA sequence from clone DKEY-71B9 in linkage group 17,
             complete sequence
          Length = 154682

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 122   attcacttgttgcaaactt 140
             |||||||||||||||||||
Sbjct: 96975 attcacttgttgcaaactt 96957



to top

>gb|AC103387.11| Mus musculus chromosome 3, clone RP24-383D8, complete sequence
          Length = 157053

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 5      gtgaatattattactacca 23
              |||||||||||||||||||
Sbjct: 122254 gtgaatattattactacca 122272



to top

>gb|BC069673.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone
           MGC:97380 IMAGE:7262648), complete cds
          Length = 813

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 444 aatttgtctcccacacaaa 426



to top

>gb|BC069752.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone
           MGC:97388 IMAGE:7262660), complete cds
          Length = 1147

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 778 aatttgtctcccacacaaa 760



to top

>gb|BC069793.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone
           MGC:97328 IMAGE:7262577), complete cds
          Length = 1149

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 778 aatttgtctcccacacaaa 760



to top

>emb|X64247.1|HS11P15GG H.sapiens RNA for 11p15 gene, exon4
          Length = 461

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 53 aatttgtctcccacacaaa 71
          |||||||||||||||||||
Sbjct: 37 aatttgtctcccacacaaa 19



to top

>emb|X64244.1|HA11P15EG H.sapiens RNA of 11p15 gene
          Length = 786

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 386 aatttgtctcccacacaaa 368



to top

>emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 in linkage group 19,
             complete sequence
          Length = 182182

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 121   cattcacttgttgcaaact 139
             |||||||||||||||||||
Sbjct: 77837 cattcacttgttgcaaact 77855



to top

>gb|AE003726.3| Drosophila melanogaster chromosome 3R, section 64 of 118 of the complete
              sequence
          Length = 247876

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 106    tcgaattatattacacatt 124
              |||||||||||||||||||
Sbjct: 124424 tcgaattatattacacatt 124406



to top

>emb|AL160314.7|CNS01RH3 Human chromosome 14 DNA sequence BAC C-2555K7 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 208953

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 19     taccaggcaagattgtacc 37
              |||||||||||||||||||
Sbjct: 158541 taccaggcaagattgtacc 158523



to top

>gb|U94991.1|XLU94991 Xenopus laevis transcription facotr XLMO1 (XLMO1) mRNA, complete
           cds
          Length = 471

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 386 aatttgtctcccacacaaa 368



to top

>gb|BC010549.1| Homo sapiens ubiquitin-conjugating enzyme E2F (putative), mRNA
           (cDNA clone MGC:18120 IMAGE:4153270), complete cds
          Length = 1366

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 47  acaagcaatttgtctcccacacaaacc 73
           |||||||||||||||| |||| |||||
Sbjct: 204 acaagcaatttgtctctcacagaaacc 178



to top

>gb|AC164412.9| Mus musculus chromosome 3, clone RP24-360M7, complete sequence
          Length = 172583

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     gtgaatattattactacca 23
             |||||||||||||||||||
Sbjct: 31279 gtgaatattattactacca 31297



to top

>ref|NM_080678.1| Homo sapiens ubiquitin-conjugating enzyme E2F (putative) (UBE2F),
           mRNA
          Length = 1366

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 47  acaagcaatttgtctcccacacaaacc 73
           |||||||||||||||| |||| |||||
Sbjct: 204 acaagcaatttgtctctcacagaaacc 178



to top

>gb|AC154414.2| Mus musculus BAC clone RP24-231D24 from 16, complete sequence
          Length = 157232

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 2     cgtgtgaatattattacta 20
             |||||||||||||||||||
Sbjct: 99183 cgtgtgaatattattacta 99165



to top

>gb|BC052768.1| Danio rerio Sec23 homolog A (S. cerevisiae), mRNA (cDNA clone
            MGC:55534 IMAGE:2642128), complete cds
          Length = 5556

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 122  attcacttgttgcaaactt 140
            |||||||||||||||||||
Sbjct: 4635 attcacttgttgcaaactt 4617



to top

>ref|NM_213465.1| Danio rerio Sec23 homolog A (S. cerevisiae) (sec23a), mRNA
          Length = 5556

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 122  attcacttgttgcaaactt 140
            |||||||||||||||||||
Sbjct: 4635 attcacttgttgcaaactt 4617



to top

>gb|M26682.1|HUMZNFBPAA Human T-cell translocation gene 1 (Ttg-1) mRNA, complete cds
          Length = 1274

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 883 aatttgtctcccacacaaa 865



to top

>gb|BC039512.1| Homo sapiens, LIM domain only 1 (rhombotin 1), clone IMAGE:5580838,
           mRNA, partial cds
          Length = 985

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  aatttgtctcccacacaaa 71
           |||||||||||||||||||
Sbjct: 570 aatttgtctcccacacaaa 552


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,347,796
Number of Sequences: 3902068
Number of extensions: 1347796
Number of successful extensions: 89215
Number of sequences better than 10.0: 59
Number of HSP's better than 10.0 without gapping: 59
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89089
Number of HSP's gapped (non-prelim): 126
length of query: 161
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 139
effective length of database: 17,147,199,772
effective search space: 2383460768308
effective search space used: 2383460768308
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top