>gb|AC091463.9| Mus musculus chromosome 16, clone RP23-301D7, complete sequence
          Length = 232419

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 45    cttctacgagaaaacacaccgaagt 69
             |||||| ||||||||||||||||||
Sbjct: 58233 cttctatgagaaaacacaccgaagt 58209

>ref|XM_715464.1| Candida albicans SC5314 putative phospholipase/carboxylesterase
           (CaO19_4248), mRNA
          Length = 906

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 71  acaaaatcttgataaagcaacaca 94
           |||||||| |||||||||||||||
Sbjct: 654 acaaaatcctgataaagcaacaca 631

>emb|BX572091.1| Prochlorococcus marinus MED4 complete genome; segment 2/5
          Length = 349082

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 24     ttatttgattcataaataca 43
              ||||||||||||||||||||
Sbjct: 267937 ttatttgattcataaataca 267918

>gb|AC159234.2| Mus musculus BAC clone RP24-432D6 from chromosome 12, complete sequence
          Length = 152905

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 13    acttgattcacttatttgattcat 36
             ||||||||||||||| ||||||||
Sbjct: 55996 acttgattcacttatatgattcat 56019

>gb|AC170864.2| Mus musculus BAC clone RP24-576D1 from chromosome 7, complete sequence
          Length = 208952

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 84     aaagcaacacaccaaccaca 103
              ||||||||||||||||||||
Sbjct: 109202 aaagcaacacaccaaccaca 109183


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,239,322
Number of Sequences: 3902068
Number of extensions: 2239322
Number of successful extensions: 52498
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52489
Number of HSP's gapped (non-prelim): 9
length of query: 282
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 260
effective length of database: 17,147,199,772
effective search space: 4458271940720
effective search space used: 4458271940720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)