ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet71f10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC034110.13| Homo sapiens chromosome 18, clone RP11-111H3, co... 44 0.37
2emb|AL627127.20| Mouse DNA sequence from clone RP23-360O1 on chr... 44 0.37
3gb|AC157472.3| Medicago truncatula chromosome 7 BAC clone mth2-4... 44 0.37
4gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, c... 42 1.5
5gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosom... 42 1.5
6gb|AC113600.19| Mus musculus chromosome 6, clone RP23-110A19, co... 42 1.5
7gb|AC116130.15| Mus musculus chromosome 17, clone RP23-98F21, co... 42 1.5
8gb|AY935269.1| Antirrhinum majus plena (PLE) gene, complete sequ... 42 1.5
9emb|AL359815.26| Human DNA sequence from clone RP11-63N8 on chro... 42 1.5
10ref|XM_785201.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.5
11emb|AL626770.9| Mouse DNA sequence from clone RP23-379J18 on chr... 42 1.5
12emb|BX548160.13| Zebrafish DNA sequence from clone DKEY-25G11 in... 42 1.5
13ref|XM_944129.1| PREDICTED: Homo sapiens hypothetical protein LO... 42 1.5
14gb|AF532114.1| Mus musculus strain 129/SvJ BAC clone citb544e14 ... 42 1.5
15gb|AF532112.1| Mus musculus strain 129/SvJ BAC clone citb20h22 f... 42 1.5
16gb|AF230340.1|AF230340 Mus musculus nuclear RNA polymerase I sma... 42 1.5
17emb|AJ334742.1|HSA334742 Homo sapiens genomic sequence surroundi... 42 1.5
18emb|AJ326348.1|HSA326348 Homo sapiens genomic sequence surroundi... 42 1.5
19gb|AC005960.1|AC005960 Mus musculus chromosome 17 BAC citb20h22 ... 42 1.5
20emb|Z81549.2|CEF55C9 Caenorhabditis elegans Cosmid F55C9, comple... 42 1.5
21gb|AC145116.3| Mus musculus BAC clone RP23-434H14 from 6, comple... 42 1.5
22emb|CR956641.9| Mouse DNA sequence from clone RP23-77N9 on chrom... 42 1.5
23gb|AC170594.2| Mus musculus BAC clone RP24-425N5 from chromosome... 42 1.5
24emb|AL772292.10| Mouse DNA sequence from clone RP23-109C16 on ch... 42 1.5
25emb|AL807380.6| Mouse DNA sequence from clone RP23-192G18 on chr... 42 1.5
26gb|AY846301.1| Armillariella tabescens clone EST2000177 unknown ... 40 5.8
27ref|NM_105060.1| Arabidopsis thaliana protein binding AT1G63850 ... 40 5.8
28ref|XM_478609.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.8
29gb|AY611148.1| Melanohalea olivacea voucher Vitikainen 16196 sma... 40 5.8
30gb|AF411339.1| Homo sapiens brain-derived neurotrophic factor op... 40 5.8
31gb|AC120859.12| Mus musculus chromosome 18, clone RP24-200D2, co... 40 5.8
32gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 40 5.8
33gb|AC172160.3| Pan troglodytes chromosome X clone PTB-96F20 map ... 40 5.8
34gb|AY392893.1| Homo sapiens clone RA702-A2-21.fa immunoglobulin ... 40 5.8
35ref|NM_001039590.1| Homo sapiens ubiquitin specific peptidase 9,... 40 5.8
36ref|NM_001039591.1| Homo sapiens ubiquitin specific peptidase 9,... 40 5.8
37gb|AY435216.1| Sus scrofa T-box 21 (TBX21) mRNA, partial cds 40 5.8
38ref|NM_170735.4| Homo sapiens brain-derived neurotrophic factor ... 40 5.8
39ref|NM_170732.3| Homo sapiens brain-derived neurotrophic factor ... 40 5.8
40ref|NM_170731.3| Homo sapiens brain-derived neurotrophic factor ... 40 5.8
41ref|NM_170734.2| Homo sapiens brain-derived neurotrophic factor ... 40 5.8
42ref|NM_170733.2| Homo sapiens brain-derived neurotrophic factor ... 40 5.8
43ref|NM_001709.3| Homo sapiens brain-derived neurotrophic factor ... 40 5.8
44gb|AC147047.2| Mus musculus BAC clone RP23-97D19 from chromosome... 40 5.8
45gb|AC166570.2| Mus musculus chromosome 18, clone RP24-74O22, com... 40 5.8
46gb|DQ132236.1| Arabidopsis thaliana ecotype Bs-1 At5g63850 gene,... 40 5.8
47gb|DQ132235.1| Arabidopsis thaliana ecotype Te-0 At5g63850 gene,... 40 5.8
48gb|DQ132231.1| Arabidopsis thaliana ecotype Tu-1 At5g63850 gene,... 40 5.8
49gb|DQ132230.1| Arabidopsis thaliana ecotype Cvi-0 At5g63850 gene... 40 5.8
50gb|DQ132229.1| Arabidopsis thaliana ecotype Nok-0 At5g63850 gene... 40 5.8
51gb|DQ132228.1| Arabidopsis thaliana ecotype Lisse-1 At5g63850 ge... 40 5.8
52gb|DQ132227.1| Arabidopsis thaliana ecotype Ler-0 At5g63850 gene... 40 5.8
53gb|DQ132226.1| Arabidopsis thaliana ecotype Ita-0 At5g63850 gene... 40 5.8
54gb|DQ132225.1| Arabidopsis thaliana ecotype Ma-2 At5g63850 gene,... 40 5.8
55gb|DQ132224.1| Arabidopsis thaliana ecotype Bla-10 At5g63850 gen... 40 5.8
56gb|DQ132223.1| Arabidopsis thaliana ecotype Me-0 At5g63850 gene,... 40 5.8
57gb|DQ132222.1| Arabidopsis thaliana ecotype Da (1)-12 At5g63850 ... 40 5.8
58gb|DQ132221.1| Arabidopsis thaliana ecotype Kas-1 At5g63850 gene... 40 5.8
59gb|DQ132220.1| Arabidopsis thaliana ecotype Ag-0 At5g63850 gene,... 40 5.8
60emb|CT009551.8| Pig DNA sequence from clone CH242-214G8 on chrom... 40 5.8
61emb|CT010521.4| M.truncatula DNA sequence from clone MTH2-34D24 ... 40 5.8
62gb|AC123810.4| Mus musculus BAC clone RP24-178B17 from chromosom... 40 5.8
63gb|AC130821.3| Mus musculus BAC clone RP23-205K12 from chromosom... 40 5.8
64emb|Z81503.1|CEF14F7 Caenorhabditis elegans Cosmid F14F7, comple... 40 5.8
65gb|AY368473.1| Sus scrofa isolate LWH006 natural resistance asso... 40 5.8
66gb|AF462604.1| Mus musculus HMG-L6 (Hmgl6), T2R6 (T2r6), and can... 40 5.8
67gb|AC144644.3| Medicago truncatula clone mth2-14l3, complete seq... 40 5.8
68gb|AC165244.2| Mus musculus BAC clone RP24-498C9 from chromosome... 40 5.8
69emb|AL691455.20| Human DNA sequence from clone CTD-2411I11 on ch... 40 5.8
70emb|AL591214.8| Human DNA sequence from clone RP11-18I23 on chro... 40 5.8
71emb|AL353650.5| Human DNA sequence from clone RP11-344N19 on chr... 40 5.8
72emb|AL158047.9| Human DNA sequence from clone RP11-388B24 on chr... 40 5.8
73gb|AC087446.13| Homo sapiens chromosome 11, clone RP11-651M4, co... 40 5.8
74emb|AL117348.26|HSDJ559A3 Human DNA sequence from clone RP4-559A... 40 5.8
75emb|AL109797.18|HS1172N10 Human DNA sequence from clone RP5-1172... 40 5.8
76gb|AC158633.7| Mus musculus 10 BAC RP23-407I4 (Roswell Park Canc... 40 5.8
77emb|AL731792.12| Mouse DNA sequence from clone RP23-189P1 on chr... 40 5.8
78gb|AC079851.14| Homo sapiens 12 BAC RP11-349L8 (Roswell Park Can... 40 5.8
79emb|BX324130.5| Zebrafish DNA sequence from clone DKEY-30J16 in ... 40 5.8
80emb|CR859589.1| Pongo pygmaeus mRNA; cDNA DKFZp459O184 (from clo... 40 5.8
81gb|DQ421402.1| Ictalurus punctatus clone BM1-31 microsatellite s... 40 5.8
82emb|BX470113.8| Zebrafish DNA sequence from clone DKEY-246M15 in... 40 5.8
83dbj|AP007174.1| Aspergillus oryzae RIB40 genomic DNA, SC103 40 5.8
84gb|AC159910.6| Mus musculus 10 BAC RP23-353C6 (Roswell Park Canc... 40 5.8
85gb|AC023738.3| Drosophila melanogaster X BAC RP98-6F4 (Roswell P... 40 5.8
86gb|AC099569.2| Homo sapiens chromosome 1 clone RP5-1007M22, comp... 40 5.8
87gb|AY054400.2| Homo sapiens brain-derived neurotrophic factor BD... 40 5.8
88gb|AY054399.2| Homo sapiens brain-derived neurotrophic factor BD... 40 5.8
89gb|AY054398.2| Homo sapiens brain-derived neurotrophic factor BD... 40 5.8
90gb|AY054397.2| Homo sapiens brain-derived neurotrophic factor BD... 40 5.8
91gb|AY054396.2| Homo sapiens brain-derived neurotrophic factor BD... 40 5.8
92gb|AY054395.2| Homo sapiens brain-derived neurotrophic factor BD... 40 5.8
93gb|AY054394.2| Homo sapiens brain-derived neurotrophic factor BD... 40 5.8
94gb|AY054393.2| Homo sapiens brain-derived neurotrophic factor BD... 40 5.8
95gb|AY054392.2| Homo sapiens brain-derived neurotrophic factor BD... 40 5.8
96dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
97gb|AC114785.5| Homo sapiens BAC clone RP11-607G14 from 2, comple... 40 5.8
98gb|AC010852.7|AC010852 Arabidopsis thaliana chromosome 1 BAC T12... 40 5.8
99gb|AC140204.3| Mus musculus BAC clone RP24-342N5 from chromosome... 40 5.8
100gb|AC160568.2| Pan troglodytes BAC clone CH251-293A11 from chrom... 40 5.8
101gb|AC012665.8| Homo sapiens BAC clone RP11-19E11 from 2, complet... 40 5.8
102gb|AC104563.14| Homo sapiens chromosome 11, clone RP11-587D21, c... 40 5.8
103dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome 40 5.8
104dbj|AP005156.4| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
105dbj|AP003515.1| Clostridium perfringens str. 13 plasmid pCP13 DN... 40 5.8
106dbj|AB001684.1| Chlorella vulgaris C-27 chloroplast DNA, complet... 40 5.8
107gb|AC154790.2| Mus musculus BAC clone RP24-481A4 from 17, comple... 40 5.8
108emb|BX548024.4| Zebrafish DNA sequence from clone DKEY-218H11 in... 40 5.8
109emb|BX088564.10| Zebrafish DNA sequence from clone CH211-239H19 ... 40 5.8
110gb|AY108292.1| Zea mays PCO081562 mRNA sequence 40 5.8
111gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 ... 40 5.8
112emb|AL845473.7| Mouse DNA sequence from clone RP23-212E8 on chro... 40 5.8
113emb|BX004791.6| Mouse DNA sequence from clone RP24-233L10 on chr... 40 5.8
114gb|AC149051.4| Mus musculus BAC clone RP24-325F10 from 8, comple... 40 5.8
115gb|AC151476.1| Mus musculus BAC clone RP23-287H13 from 8, comple... 40 5.8
116emb|CT033752.6| Mouse DNA sequence from clone RP23-140I20 on chr... 40 5.8
117emb|AL136038.5|CNS01DVT Human chromosome 14 DNA sequence BAC C-2... 40 5.8
118emb|AL606918.9| Mouse DNA sequence from clone RP23-327O13 on chr... 40 5.8
119gb|M13420.1|HUM18BPD Human bcl-2 gene (chromosome 18) translocat... 40 5.8
120dbj|D63338.1| Aspergillus oryzae DNA for tannase, complete cds 40 5.8

>gb|AC034110.13| Homo sapiens chromosome 18, clone RP11-111H3, complete sequence
          Length = 167954

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 204    tagttattttttgttgttttct 225
              ||||||||||||||||||||||
Sbjct: 141009 tagttattttttgttgttttct 140988



to top

>emb|AL627127.20| Mouse DNA sequence from clone RP23-360O1 on chromosome 4, complete
              sequence
          Length = 188629

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 202    tctagttattttttgttgtttt 223
              ||||||||||||||||||||||
Sbjct: 127552 tctagttattttttgttgtttt 127573



to top

>gb|AC157472.3| Medicago truncatula chromosome 7 BAC clone mth2-41h16, complete
             sequence
          Length = 114287

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 387   ctagtagtagtagtagtcttct 408
             ||||||||||||||||||||||
Sbjct: 38908 ctagtagtagtagtagtcttct 38887



to top

>gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, complete sequence
          Length = 178820

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 205    agttattttttgttgttttct 225
              |||||||||||||||||||||
Sbjct: 154381 agttattttttgttgttttct 154361



to top

>gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosome 17, complete
             sequence
          Length = 216585

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 205   agttattttttgttgttttct 225
             |||||||||||||||||||||
Sbjct: 79529 agttattttttgttgttttct 79549



to top

>gb|AC113600.19| Mus musculus chromosome 6, clone RP23-110A19, complete sequence
          Length = 212705

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 205   agttattttttgttgttttcttctt 229
             |||||||||||||||||| ||||||
Sbjct: 36993 agttattttttgttgtttccttctt 36969



to top

>gb|AC116130.15| Mus musculus chromosome 17, clone RP23-98F21, complete sequence
          Length = 228842

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    tttttgttgttttcttcttgg 231
              |||||||||||||||||||||
Sbjct: 198151 tttttgttgttttcttcttgg 198171



to top

>gb|AY935269.1| Antirrhinum majus plena (PLE) gene, complete sequence
          Length = 85060

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 389   agtagtagtagtagtcttctt 409
             |||||||||||||||||||||
Sbjct: 39262 agtagtagtagtagtcttctt 39282



to top

>emb|AL359815.26| Human DNA sequence from clone RP11-63N8 on chromosome 1 Contains the 3'
             end of the ALPL gene for alkaline phosphatase,
             liver/bone/kidney, the RAP1GA1 gene for RAP1, GTPase
             activating protein 1, a novel gene, the 3' end of the
             USP31 gene for ubiquitin specific protease 31 and a CpG
             island, complete sequence
          Length = 149651

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 414   gggagcggcgccggggaagga 434
             |||||||||||||||||||||
Sbjct: 94196 gggagcggcgccggggaagga 94176



to top

>ref|XM_785201.1| PREDICTED: Strongylocentrotus purpuratus similar to guanine
           nucleotide binding protein-like 2 (nucleolar)
           (LOC585370), mRNA
          Length = 2328

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 73  tcctccatcatcgaacaccaa 93
           |||||||||||||||||||||
Sbjct: 711 tcctccatcatcgaacaccaa 691



to top

>emb|AL626770.9| Mouse DNA sequence from clone RP23-379J18 on chromosome 11 Contains a
             novel gene and a serine/arginine repetitive matrix 1
             (Srrm1) pseudogene, complete sequence
          Length = 188854

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   tttttgttgttttcttcttgg 231
             |||||||||||||||||||||
Sbjct: 41382 tttttgttgttttcttcttgg 41402



to top

>emb|BX548160.13| Zebrafish DNA sequence from clone DKEY-25G11 in linkage group 11,
              complete sequence
          Length = 237930

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 383    ctcactagtagtagtagtagt 403
              |||||||||||||||||||||
Sbjct: 151499 ctcactagtagtagtagtagt 151519



to top

>ref|XM_944129.1| PREDICTED: Homo sapiens hypothetical protein LOC650278 (LOC650278),
            mRNA
          Length = 1866

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 414  gggagcggcgccggggaagga 434
            |||||||||||||||||||||
Sbjct: 1587 gggagcggcgccggggaagga 1567



to top

>gb|AF532114.1| Mus musculus strain 129/SvJ BAC clone citb544e14 from the MHC region,
             complete sequence
          Length = 153869

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tttttgttgttttcttcttgg 231
             |||||||||||||||||||||
Sbjct: 29740 tttttgttgttttcttcttgg 29720



to top

>gb|AF532112.1| Mus musculus strain 129/SvJ BAC clone citb20h22 from the MHC region,
              complete sequence
          Length = 172199

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    tttttgttgttttcttcttgg 231
              |||||||||||||||||||||
Sbjct: 124156 tttttgttgttttcttcttgg 124136



to top

>gb|AF230340.1|AF230340 Mus musculus nuclear RNA polymerase I small specific subunit Rpa12
            gene, complete cds
          Length = 4591

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  tttttgttgttttcttcttgg 231
            |||||||||||||||||||||
Sbjct: 2253 tttttgttgttttcttcttgg 2273



to top

>emb|AJ334742.1|HSA334742 Homo sapiens genomic sequence surrounding NotI site, clone NR3-155R
          Length = 769

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 414 gggagcggcgccggggaagga 434
           |||||||||||||||||||||
Sbjct: 110 gggagcggcgccggggaagga 90



to top

>emb|AJ326348.1|HSA326348 Homo sapiens genomic sequence surrounding NotI site, clone NL1-GE6C
          Length = 631

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 414 gggagcggcgccggggaagga 434
           |||||||||||||||||||||
Sbjct: 110 gggagcggcgccggggaagga 90



to top

>gb|AC005960.1|AC005960 Mus musculus chromosome 17 BAC citb20h22 from the MHC region, complete
              sequence
          Length = 158414

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    tttttgttgttttcttcttgg 231
              |||||||||||||||||||||
Sbjct: 124138 tttttgttgttttcttcttgg 124118



to top

>emb|Z81549.2|CEF55C9 Caenorhabditis elegans Cosmid F55C9, complete sequence
          Length = 29404

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 208   tattttttgttgttttcttct 228
             |||||||||||||||||||||
Sbjct: 10274 tattttttgttgttttcttct 10294



to top

>gb|AC145116.3| Mus musculus BAC clone RP23-434H14 from 6, complete sequence
          Length = 204134

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 205    agttattttttgttgttttcttctt 229
              |||||||||||||||||| ||||||
Sbjct: 203407 agttattttttgttgtttccttctt 203383



to top

>emb|CR956641.9| Mouse DNA sequence from clone RP23-77N9 on chromosome 17, complete
             sequence
          Length = 202624

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   tttttgttgttttcttcttgg 231
             |||||||||||||||||||||
Sbjct: 61646 tttttgttgttttcttcttgg 61666



to top

>gb|AC170594.2| Mus musculus BAC clone RP24-425N5 from chromosome 17, complete sequence
          Length = 161769

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 205   agttattttttgttgttttct 225
             |||||||||||||||||||||
Sbjct: 10508 agttattttttgttgttttct 10528



to top

>emb|AL772292.10| Mouse DNA sequence from clone RP23-109C16 on chromosome 2, complete
              sequence
          Length = 201671

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 203    ctagttattttttgttgtttt 223
              |||||||||||||||||||||
Sbjct: 108568 ctagttattttttgttgtttt 108588



to top

>emb|AL807380.6| Mouse DNA sequence from clone RP23-192G18 on chromosome 2, complete
              sequence
          Length = 208614

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 389    agtagtagtagtagtcttctt 409
              |||||||||||||||||||||
Sbjct: 191598 agtagtagtagtagtcttctt 191618



to top

>gb|AY846301.1| Armillariella tabescens clone EST2000177 unknown mRNA
          Length = 3416

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 200  cctctagttattttttgttg 219
            ||||||||||||||||||||
Sbjct: 1398 cctctagttattttttgttg 1417



to top

>ref|NM_105060.1| Arabidopsis thaliana protein binding AT1G63850 mRNA, complete cds
          Length = 1647

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 37   caagtacaacgactcattgctaagatca 64
            ||||||||||||||| || |||||||||
Sbjct: 1044 caagtacaacgactctttcctaagatca 1017



to top

>ref|XM_478609.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 597

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 414 gggagcggcgccggggaagg 433
           ||||||||||||||||||||
Sbjct: 437 gggagcggcgccggggaagg 418



to top

>gb|AY611148.1| Melanohalea olivacea voucher Vitikainen 16196 small subunit
           ribosomal RNA gene, partial sequence; mitochondrial
          Length = 911

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 210 ttttttgttgttttcttctt 229
           ||||||||||||||||||||
Sbjct: 616 ttttttgttgttttcttctt 635



to top

>gb|AF411339.1| Homo sapiens brain-derived neurotrophic factor opposite strand (BDNFOS)
             gene, partial sequence; and brain-derived neurotrophic
             factor (BDNF) gene, complete cds
          Length = 115886

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   gttattttttgttgttttct 225
             ||||||||||||||||||||
Sbjct: 97003 gttattttttgttgttttct 96984



to top

>gb|AC120859.12| Mus musculus chromosome 18, clone RP24-200D2, complete sequence
          Length = 184327

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 149  gggaggagaggagagtttac 168
            ||||||||||||||||||||
Sbjct: 2258 gggaggagaggagagtttac 2239



to top

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 414     gggagcggcgccggggaagg 433
               ||||||||||||||||||||
Sbjct: 2488324 gggagcggcgccggggaagg 2488305



to top

>gb|AC172160.3| Pan troglodytes chromosome X clone PTB-96F20 map human otholog p11.4,
              complete sequence
          Length = 203345

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 210    ttttttgttgttttcttctt 229
              ||||||||||||||||||||
Sbjct: 156782 ttttttgttgttttcttctt 156801



to top

>gb|AY392893.1| Homo sapiens clone RA702-A2-21.fa immunoglobulin heavy chain mRNA,
           partial cds
          Length = 384

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 388 tagtagtagtagtagtcttc 407
           ||||||||||||||||||||
Sbjct: 302 tagtagtagtagtagtcttc 283



to top

>ref|NM_001039590.1| Homo sapiens ubiquitin specific peptidase 9, X-linked (USP9X),
             transcript variant 3, mRNA
          Length = 12401

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   ttttttgttgttttcttctt 229
             ||||||||||||||||||||
Sbjct: 10381 ttttttgttgttttcttctt 10400



to top

>ref|NM_001039591.1| Homo sapiens ubiquitin specific peptidase 9, X-linked (USP9X),
             transcript variant 4, mRNA
          Length = 12353

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   ttttttgttgttttcttctt 229
             ||||||||||||||||||||
Sbjct: 10333 ttttttgttgttttcttctt 10352



to top

>gb|AY435216.1| Sus scrofa T-box 21 (TBX21) mRNA, partial cds
          Length = 200

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 145 gttggggaggagaggagagt 164
           ||||||||||||||||||||
Sbjct: 58  gttggggaggagaggagagt 39



to top

>ref|NM_170735.4| Homo sapiens brain-derived neurotrophic factor (BDNF), transcript
            variant 1, mRNA
          Length = 4247

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2340 gttattttttgttgttttct 2321



to top

>ref|NM_170732.3| Homo sapiens brain-derived neurotrophic factor (BDNF), transcript
            variant 2, mRNA
          Length = 4084

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2177 gttattttttgttgttttct 2158



to top

>ref|NM_170731.3| Homo sapiens brain-derived neurotrophic factor (BDNF), transcript
            variant 3, mRNA
          Length = 4044

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2137 gttattttttgttgttttct 2118



to top

>ref|NM_170734.2| Homo sapiens brain-derived neurotrophic factor (BDNF), transcript
            variant 6, mRNA
          Length = 3958

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2051 gttattttttgttgttttct 2032



to top

>ref|NM_170733.2| Homo sapiens brain-derived neurotrophic factor (BDNF), transcript
            variant 5, mRNA
          Length = 4016

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2109 gttattttttgttgttttct 2090



to top

>ref|NM_001709.3| Homo sapiens brain-derived neurotrophic factor (BDNF), transcript
            variant 4, mRNA
          Length = 3972

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2065 gttattttttgttgttttct 2046



to top

>gb|AC147047.2| Mus musculus BAC clone RP23-97D19 from chromosome 6, complete sequence
          Length = 239653

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 384    tcactagtagtagtagtagt 403
              ||||||||||||||||||||
Sbjct: 137307 tcactagtagtagtagtagt 137288



to top

>gb|AC166570.2| Mus musculus chromosome 18, clone RP24-74O22, complete sequence
          Length = 163755

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 149   gggaggagaggagagtttac 168
             ||||||||||||||||||||
Sbjct: 62225 gggaggagaggagagtttac 62244



to top

>gb|DQ132236.1| Arabidopsis thaliana ecotype Bs-1 At5g63850 gene, partial cds
          Length = 807

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 783 caagtacaacgactctttcctaagatca 756



to top

>gb|DQ132235.1| Arabidopsis thaliana ecotype Te-0 At5g63850 gene, partial cds
          Length = 807

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 783 caagtacaacgactctttcctaagatca 756



to top

>gb|DQ132231.1| Arabidopsis thaliana ecotype Tu-1 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132230.1| Arabidopsis thaliana ecotype Cvi-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132229.1| Arabidopsis thaliana ecotype Nok-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132228.1| Arabidopsis thaliana ecotype Lisse-1 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132227.1| Arabidopsis thaliana ecotype Ler-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132226.1| Arabidopsis thaliana ecotype Ita-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132225.1| Arabidopsis thaliana ecotype Ma-2 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132224.1| Arabidopsis thaliana ecotype Bla-10 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132223.1| Arabidopsis thaliana ecotype Me-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132222.1| Arabidopsis thaliana ecotype Da (1)-12 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132221.1| Arabidopsis thaliana ecotype Kas-1 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>gb|DQ132220.1| Arabidopsis thaliana ecotype Ag-0 At5g63850 gene, partial cds
          Length = 808

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 37  caagtacaacgactcattgctaagatca 64
           ||||||||||||||| || |||||||||
Sbjct: 784 caagtacaacgactctttcctaagatca 757



to top

>emb|CT009551.8| Pig DNA sequence from clone CH242-214G8 on chromosome 17, complete
             sequence
          Length = 239237

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 204   tagttattttttgttgtttt 223
             ||||||||||||||||||||
Sbjct: 47025 tagttattttttgttgtttt 47006



to top

>emb|CT010521.4| M.truncatula DNA sequence from clone MTH2-34D24 on chromosome 3,
             complete sequence
          Length = 104085

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 212   ttttgttgttttcttcttgg 231
             ||||||||||||||||||||
Sbjct: 40136 ttttgttgttttcttcttgg 40155



to top

>gb|AC123810.4| Mus musculus BAC clone RP24-178B17 from chromosome 8, complete sequence
          Length = 161521

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 388    tagtagtagtagtagtcttc 407
              ||||||||||||||||||||
Sbjct: 103921 tagtagtagtagtagtcttc 103902



to top

>gb|AC130821.3| Mus musculus BAC clone RP23-205K12 from chromosome 13, complete sequence
          Length = 227411

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 149    gggaggagaggagagtttac 168
              ||||||||||||||||||||
Sbjct: 114433 gggaggagaggagagtttac 114452



to top

>emb|Z81503.1|CEF14F7 Caenorhabditis elegans Cosmid F14F7, complete sequence
          Length = 25468

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 388  tagtagtagtagtagtcttc 407
            ||||||||||||||||||||
Sbjct: 6460 tagtagtagtagtagtcttc 6441



to top

>gb|AY368473.1| Sus scrofa isolate LWH006 natural resistance associated macrophage
           protein 1 (NRAMP1) gene, intron 6 and partial cds
          Length = 455

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 210 ttttttgttgttttcttctt 229
           ||||||||||||||||||||
Sbjct: 352 ttttttgttgttttcttctt 371



to top

>gb|AF462604.1| Mus musculus HMG-L6 (Hmgl6), T2R6 (T2r6), and candidate taste receptor
             T2R4 (T2r4) genes, complete cds
          Length = 84503

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   ttattttttgttgttttctt 226
             ||||||||||||||||||||
Sbjct: 67388 ttattttttgttgttttctt 67369



to top

>gb|AC144644.3| Medicago truncatula clone mth2-14l3, complete sequence
          Length = 117645

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 204   tagttattttttgttgtttt 223
             ||||||||||||||||||||
Sbjct: 67630 tagttattttttgttgtttt 67649



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 204   tagttattttttgttgtttt 223
             ||||||||||||||||||||
Sbjct: 67246 tagttattttttgttgtttt 67265



to top

>gb|AC165244.2| Mus musculus BAC clone RP24-498C9 from chromosome 14, complete sequence
          Length = 191747

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 388    tagtagtagtagtagtcttc 407
              ||||||||||||||||||||
Sbjct: 123384 tagtagtagtagtagtcttc 123403



to top

>emb|AL691455.20| Human DNA sequence from clone CTD-2411I11 on chromosome 10 Contains two
             CpG islands, complete sequence
          Length = 41452

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 199   tcctctagttattttttgttgttt 222
             ||||||||||||||||| ||||||
Sbjct: 19369 tcctctagttatttttttttgttt 19346



to top

>emb|AL591214.8| Human DNA sequence from clone RP11-18I23 on chromosome 9 Contains part
             of one variant of the ROR2 gene for receptor tyrosine
             kinase-like orphan receptor 2, complete sequence
          Length = 66959

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 63    cacggaacaatcctccatca 82
             ||||||||||||||||||||
Sbjct: 17703 cacggaacaatcctccatca 17684



to top

>emb|AL353650.5| Human DNA sequence from clone RP11-344N19 on chromosome 10 Contains
            the 5' end of a novel gene (DKFZp761L0424) (KIAA1217) and
            a CpG island, complete sequence
          Length = 84778

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    gtatgatcttccaatccaac 21
            ||||||||||||||||||||
Sbjct: 8120 gtatgatcttccaatccaac 8139



to top

>emb|AL158047.9| Human DNA sequence from clone RP11-388B24 on chromosome 9 Contains a
            novel pseudogene, a novel gene, a DEAD/H
            (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)
            (HRH-J8) (DDX10) pseudogene and a ribosomal protein S2
            (LLREP3) (RPS2) pseudogene, complete sequence
          Length = 201629

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 211  tttttgttgttttcttcttg 230
            ||||||||||||||||||||
Sbjct: 6997 tttttgttgttttcttcttg 7016



to top

>gb|AC087446.13| Homo sapiens chromosome 11, clone RP11-651M4, complete sequence
          Length = 167865

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 206    gttattttttgttgttttct 225
              ||||||||||||||||||||
Sbjct: 148979 gttattttttgttgttttct 148960



to top

>emb|AL117348.26|HSDJ559A3 Human DNA sequence from clone RP4-559A3 on chromosome 1q41-42.2
             Contains the 5' end of a novel gene (KIAA0792), the LEFTB
             gene for left-right determination, factor B, the PYCR2
             gene for pyrroline-5-carboxylate reductase family, member
             2, the EBAF gene for endometrial bleeding associated
             factor (left-right determination, factor A; transforming
             growth factor beta superfamily), a novel gene, an NADH
             dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
             (NDUFA3) pseudogene and two CpG islands, complete sequence
          Length = 127736

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   ttattttttgttgttttctt 226
             ||||||||||||||||||||
Sbjct: 80450 ttattttttgttgttttctt 80431



to top

>emb|AL109797.18|HS1172N10 Human DNA sequence from clone RP5-1172N10 on chromosome Xp11.3-11.4
             Contains the 3' end of the USP9X gene for X chromosome
             ubiquitin specific protease 9 (fat facets-like
             Drosophila), a novel gene and a CpG island, complete
             sequence
          Length = 129293

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   ttttttgttgttttcttctt 229
             ||||||||||||||||||||
Sbjct: 60229 ttttttgttgttttcttctt 60248



to top

>gb|AC158633.7| Mus musculus 10 BAC RP23-407I4 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 206282

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 140    aaagagttggggaggagagg 159
              ||||||||||||||||||||
Sbjct: 182578 aaagagttggggaggagagg 182559



to top

>emb|AL731792.12| Mouse DNA sequence from clone RP23-189P1 on chromosome 11 Contains the
             5' end of a novel gene, the 3' end of the Spnb2 gene for
             spectrin beta 2 and a CpG island, complete sequence
          Length = 143722

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   attttttgttgttttcttct 228
             ||||||||||||||||||||
Sbjct: 12564 attttttgttgttttcttct 12545



to top

>gb|AC079851.14| Homo sapiens 12 BAC RP11-349L8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 82421

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   ttattttttgttgttttctt 226
             ||||||||||||||||||||
Sbjct: 43890 ttattttttgttgttttctt 43871



to top

>emb|BX324130.5| Zebrafish DNA sequence from clone DKEY-30J16 in linkage group 11,
             complete sequence
          Length = 209188

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   ttattttttgttgttttctt 226
             ||||||||||||||||||||
Sbjct: 71142 ttattttttgttgttttctt 71123



to top

>emb|CR859589.1| Pongo pygmaeus mRNA; cDNA DKFZp459O184 (from clone DKFZp459O184)
          Length = 3241

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  ttattttttgttgttttctt 226
            ||||||||||||||||||||
Sbjct: 1823 ttattttttgttgttttctt 1804



to top

>gb|DQ421402.1| Ictalurus punctatus clone BM1-31 microsatellite sequences
          Length = 386

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 388 tagtagtagtagtagtcttc 407
           ||||||||||||||||||||
Sbjct: 185 tagtagtagtagtagtcttc 204



to top

>emb|BX470113.8| Zebrafish DNA sequence from clone DKEY-246M15 in linkage group 17,
             complete sequence
          Length = 118640

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   gttattttttgttgttttct 225
             ||||||||||||||||||||
Sbjct: 63786 gttattttttgttgttttct 63767



to top

>dbj|AP007174.1| Aspergillus oryzae RIB40 genomic DNA, SC103
          Length = 1282697

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 386    actagtagtagtagtagtct 405
              ||||||||||||||||||||
Sbjct: 214863 actagtagtagtagtagtct 214844



to top

>gb|AC159910.6| Mus musculus 10 BAC RP23-353C6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 219861

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 140    aaagagttggggaggagagg 159
              ||||||||||||||||||||
Sbjct: 197420 aaagagttggggaggagagg 197439



to top

>gb|AC023738.3| Drosophila melanogaster X BAC RP98-6F4 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 103196

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   ttttttgttgttttcttctt 229
             ||||||||||||||||||||
Sbjct: 20444 ttttttgttgttttcttctt 20463



to top

>gb|AC099569.2| Homo sapiens chromosome 1 clone RP5-1007M22, complete sequence
          Length = 126833

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   gttattttttgttgttttct 225
             ||||||||||||||||||||
Sbjct: 18149 gttattttttgttgttttct 18168



to top

>gb|AY054400.2| Homo sapiens brain-derived neurotrophic factor BDNF6B (BDNF) mRNA,
            complete cds, alternatively spliced
          Length = 3957

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2050 gttattttttgttgttttct 2031



to top

>gb|AY054399.2| Homo sapiens brain-derived neurotrophic factor BDNF6A (BDNF) mRNA,
            complete cds, alternatively spliced
          Length = 3856

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 1949 gttattttttgttgttttct 1930



to top

>gb|AY054398.2| Homo sapiens brain-derived neurotrophic factor BDNF5 (BDNF) mRNA,
            complete cds, alternatively spliced
          Length = 3971

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2064 gttattttttgttgttttct 2045



to top

>gb|AY054397.2| Homo sapiens brain-derived neurotrophic factor BDNF4 (BDNF) mRNA,
            complete cds, alternatively spliced
          Length = 3924

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2017 gttattttttgttgttttct 1998



to top

>gb|AY054396.2| Homo sapiens brain-derived neurotrophic factor BDNF3 (BDNF) mRNA,
            complete cds, alternatively spliced
          Length = 3841

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 1934 gttattttttgttgttttct 1915



to top

>gb|AY054395.2| Homo sapiens brain-derived neurotrophic factor BDNF2C (BDNF) mRNA,
            complete cds, alternatively spliced
          Length = 4083

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2176 gttattttttgttgttttct 2157



to top

>gb|AY054394.2| Homo sapiens brain-derived neurotrophic factor BDNF2B (BDNF) mRNA,
            complete cds, alternatively spliced
          Length = 4000

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2093 gttattttttgttgttttct 2074



to top

>gb|AY054393.2| Homo sapiens brain-derived neurotrophic factor BDNF2A (BDNF) mRNA,
            complete cds, alternatively spliced
          Length = 3786

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 1879 gttattttttgttgttttct 1860



to top

>gb|AY054392.2| Homo sapiens brain-derived neurotrophic factor BDNF1 (BDNF) mRNA,
            complete cds, alternatively spliced
          Length = 4043

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  gttattttttgttgttttct 225
            ||||||||||||||||||||
Sbjct: 2136 gttattttttgttgttttct 2117



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 414      gggagcggcgccggggaagg 433
                ||||||||||||||||||||
Sbjct: 21412388 gggagcggcgccggggaagg 21412369



to top

>gb|AC114785.5| Homo sapiens BAC clone RP11-607G14 from 2, complete sequence
          Length = 118022

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 206   gttattttttgttgttttcttctt 229
             |||||||||| |||||||||||||
Sbjct: 80393 gttattttttattgttttcttctt 80370



to top

>gb|AC010852.7|AC010852 Arabidopsis thaliana chromosome 1 BAC T12P18 genomic sequence, complete
             sequence
          Length = 79469

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 37    caagtacaacgactcattgctaagatca 64
             ||||||||||||||| || |||||||||
Sbjct: 42607 caagtacaacgactctttcctaagatca 42634



to top

>gb|AC140204.3| Mus musculus BAC clone RP24-342N5 from chromosome 6, complete sequence
          Length = 200130

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   ttattttttgttgttttctt 226
             ||||||||||||||||||||
Sbjct: 99931 ttattttttgttgttttctt 99950



to top

>gb|AC160568.2| Pan troglodytes BAC clone CH251-293A11 from chromosome unknown,
             complete sequence
          Length = 159393

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   ttattttttgttgttttctt 226
             ||||||||||||||||||||
Sbjct: 74036 ttattttttgttgttttctt 74017



to top

>gb|AC012665.8| Homo sapiens BAC clone RP11-19E11 from 2, complete sequence
          Length = 126039

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 206   gttattttttgttgttttcttctt 229
             |||||||||| |||||||||||||
Sbjct: 69444 gttattttttattgttttcttctt 69421



to top

>gb|AC104563.14| Homo sapiens chromosome 11, clone RP11-587D21, complete sequence
          Length = 141200

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   gttattttttgttgttttct 225
             ||||||||||||||||||||
Sbjct: 77416 gttattttttgttgttttct 77435



to top

>dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome
          Length = 1358633

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 207    ttattttttgttgttttctt 226
              ||||||||||||||||||||
Sbjct: 691782 ttattttttgttgttttctt 691801



to top

>dbj|AP005156.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1729_E01
          Length = 155527

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 414   gggagcggcgccggggaagg 433
             ||||||||||||||||||||
Sbjct: 56444 gggagcggcgccggggaagg 56425



to top

>dbj|AP003515.1| Clostridium perfringens str. 13 plasmid pCP13 DNA, complete sequence
          Length = 54310

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 19    aactgacaataatatgtacaagta 42
             ||||||||||||||| ||||||||
Sbjct: 44575 aactgacaataatatttacaagta 44552



to top

>dbj|AB001684.1| Chlorella vulgaris C-27 chloroplast DNA, complete sequence
          Length = 150613

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   ttattttttgttgttttctt 226
             ||||||||||||||||||||
Sbjct: 87588 ttattttttgttgttttctt 87569



to top

>gb|AC154790.2| Mus musculus BAC clone RP24-481A4 from 17, complete sequence
          Length = 194675

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 207    ttattttttgttgttttctt 226
              ||||||||||||||||||||
Sbjct: 191706 ttattttttgttgttttctt 191725



to top

>emb|BX548024.4| Zebrafish DNA sequence from clone DKEY-218H11 in linkage group 2,
              complete sequence
          Length = 218565

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 388    tagtagtagtagtagtcttc 407
              ||||||||||||||||||||
Sbjct: 209454 tagtagtagtagtagtcttc 209473



to top

>emb|BX088564.10| Zebrafish DNA sequence from clone CH211-239H19 in linkage group 4,
             complete sequence
          Length = 132891

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 388   tagtagtagtagtagtcttc 407
             ||||||||||||||||||||
Sbjct: 45015 tagtagtagtagtagtcttc 44996



to top

>gb|AY108292.1| Zea mays PCO081562 mRNA sequence
          Length = 976

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 386 actagtagtagtagtagtct 405
           ||||||||||||||||||||
Sbjct: 701 actagtagtagtagtagtct 682



to top

>gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 of 74 of the complete
              sequence
          Length = 288721

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 210    ttttttgttgttttcttctt 229
              ||||||||||||||||||||
Sbjct: 104288 ttttttgttgttttcttctt 104269



to top

>emb|AL845473.7| Mouse DNA sequence from clone RP23-212E8 on chromosome 2, complete
              sequence
          Length = 189998

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 207    ttattttttgttgttttctt 226
              ||||||||||||||||||||
Sbjct: 134393 ttattttttgttgttttctt 134412



to top

>emb|BX004791.6| Mouse DNA sequence from clone RP24-233L10 on chromosome 4, complete
             sequence
          Length = 123244

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 205   agttattttttgttgttttcttct 228
             |||| |||||||||||||||||||
Sbjct: 74196 agtttttttttgttgttttcttct 74219



to top

>gb|AC149051.4| Mus musculus BAC clone RP24-325F10 from 8, complete sequence
          Length = 184939

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 388   tagtagtagtagtagtcttc 407
             ||||||||||||||||||||
Sbjct: 67295 tagtagtagtagtagtcttc 67276



to top

>gb|AC151476.1| Mus musculus BAC clone RP23-287H13 from 8, complete sequence
          Length = 155220

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 388    tagtagtagtagtagtcttc 407
              ||||||||||||||||||||
Sbjct: 140255 tagtagtagtagtagtcttc 140236



to top

>emb|CT033752.6| Mouse DNA sequence from clone RP23-140I20 on chromosome 17, complete
              sequence
          Length = 216455

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 207    ttattttttgttgttttctt 226
              ||||||||||||||||||||
Sbjct: 162325 ttattttttgttgttttctt 162344



to top

>emb|AL136038.5|CNS01DVT Human chromosome 14 DNA sequence BAC C-2302E22 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 151930

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 203    ctagttattttttgttgttttcttcttg 230
              |||||| |||||||||||||| ||||||
Sbjct: 135250 ctagtttttttttgttgtttttttcttg 135223



to top

>emb|AL606918.9| Mouse DNA sequence from clone RP23-327O13 on chromosome 4, complete
              sequence
          Length = 192787

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 204    tagttattttttgttgtttt 223
              ||||||||||||||||||||
Sbjct: 124634 tagttattttttgttgtttt 124615



to top

>gb|M13420.1|HUM18BPD Human bcl-2 gene (chromosome 18) translocation to Ig H-chain locus
           J6 gene (chromosome 14) breakpoint, from follicular
           lymphoma 1144
          Length = 165

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 388 tagtagtagtagtagtcttc 407
           ||||||||||||||||||||
Sbjct: 119 tagtagtagtagtagtcttc 100



to top

>dbj|D63338.1| Aspergillus oryzae DNA for tannase, complete cds
          Length = 3561

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 386  actagtagtagtagtagtct 405
            ||||||||||||||||||||
Sbjct: 1018 actagtagtagtagtagtct 999


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,506,137
Number of Sequences: 3902068
Number of extensions: 4506137
Number of successful extensions: 189875
Number of sequences better than 10.0: 120
Number of HSP's better than 10.0 without gapping: 120
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 189369
Number of HSP's gapped (non-prelim): 505
length of query: 434
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 412
effective length of database: 17,147,199,772
effective search space: 7064646306064
effective search space used: 7064646306064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top