ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet71f01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_463753.1| Oryza sativa (japonica cultivar-group), predic... 174 2e-40
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 174 2e-40
3dbj|AP004368.3| Oryza sativa (japonica cultivar-group) genomic D... 174 2e-40
4dbj|AK119633.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 2e-40
5dbj|AK101291.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 2e-40
6gb|AY106918.1| Zea mays PCO090417 mRNA sequence 66 1e-07
7gb|AC134894.4| Mus musculus BAC clone RP24-260P1 from chromosome... 46 0.10
8gb|AC113527.8| Mus musculus chromosome 9, clone RP23-314E23, com... 46 0.10
9emb|BX927158.14| Zebrafish DNA sequence from clone DKEY-106K1 in... 46 0.10
10dbj|AK089846.1| Mus musculus activated spleen cDNA, RIKEN full-l... 46 0.10
11emb|BX950204.17| Zebrafish DNA sequence from clone DKEY-252P7 in... 46 0.10
12gb|AC163640.5| Mus musculus BAC clone RP24-182L3 from chromosome... 44 0.40
13gb|AC160961.3| Mus musculus BAC clone RP24-288N19 from chromosom... 44 0.40
14gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, com... 44 0.40
15gb|AC108097.3| Homo sapiens chromosome 16 clone RP11-109P11, com... 44 0.40
16emb|CR847786.13| Zebrafish DNA sequence from clone DKEYP-9B4 in ... 44 0.40
17emb|AL355677.15| Human DNA sequence from clone RP11-428M15 on ch... 44 0.40
18emb|CR381637.5| Zebrafish DNA sequence from clone DKEY-225P19 in... 44 0.40
19emb|BX950857.8| Zebrafish DNA sequence from clone CH211-203D19 i... 44 0.40
20emb|BX005074.10| Zebrafish DNA sequence from clone CH211-146J7 i... 44 0.40
21gb|AC092332.4| Homo sapiens chromosome 16 clone RP11-18F14, comp... 44 0.40
22emb|BX005472.11| Zebrafish DNA sequence from clone CH211-119C22 ... 44 0.40
23emb|AL807833.5| Mouse DNA sequence from clone RP23-371E13 on chr... 44 0.40
24gb|AC110907.7| Mus musculus chromosome 7, clone RP24-180J10, com... 42 1.6
25gb|AC102914.9| Mus musculus chromosome 15, clone RP24-274M4, com... 42 1.6
26gb|AC168056.3| Mus musculus BAC clone RP24-189B1 from chromosome... 42 1.6
27gb|AC167970.4| Mus musculus BAC clone RP24-471H15 from chromosom... 42 1.6
28gb|AC130671.7| Mus musculus chromosome 15, clone RP24-90K19, com... 42 1.6
29gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, comp... 42 1.6
30gb|AC163684.5| Mus musculus BAC clone RP23-8N10 from chromosome ... 42 1.6
31gb|DQ223119.1| Alasmidonta heterodon microsatellite AheB121 sequ... 42 1.6
32gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 42 1.6
33gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.6
34gb|AC145205.2| Homo sapiens chromosome 17, clone RP11-1224M18, c... 42 1.6
35gb|AC132278.3| Mus musculus BAC clone RP24-346C20 from chromosom... 42 1.6
36gb|AC183804.3| Pan troglodytes BAC clone CH251-67P16 from chromo... 42 1.6
37gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.6
38gb|AC162890.4| Mus musculus chromosome 3, clone RP23-362E13, com... 42 1.6
39gb|AC137154.2| Mus musculus BAC clone RP24-572L22 from chromosom... 42 1.6
40emb|BX936460.6| Zebrafish DNA sequence from clone CH211-69N2 in ... 42 1.6
41emb|BX511141.27| Zebrafish DNA sequence from clone DKEYP-10C6 in... 42 1.6
42emb|CR932998.12| Zebrafish DNA sequence from clone DKEY-111I23 i... 42 1.6
43emb|CR354562.12| Zebrafish DNA sequence from clone DKEY-25B23 in... 42 1.6
44emb|CR925863.7| Zebrafish DNA sequence from clone DKEY-184N1 in ... 42 1.6
45gb|AC121909.3| Mus musculus BAC clone RP24-179L9 from chromosome... 42 1.6
46gb|AC126025.4| Mus musculus BAC clone RP24-461L18 from chromosom... 42 1.6
47gb|AC112149.4| Mus musculus BAC clone RP23-186F18 from chromosom... 42 1.6
48gb|AC125349.3| Mus musculus BAC clone RP23-394P9 from chromosome... 42 1.6
49gb|AC093519.3| Homo sapiens chromosome 16 clone RP11-107C10, com... 42 1.6
50gb|AC124369.4| Mus musculus BAC clone RP24-549O12 from chromosom... 42 1.6
51gb|AC121974.3| Mus musculus BAC clone RP24-285E14 from chromosom... 42 1.6
52gb|AC122267.4| Mus musculus BAC clone RP23-214H6 from 8, complet... 42 1.6
53emb|BX664703.21| Zebrafish DNA sequence from clone DKEYP-74A8 in... 42 1.6
54gb|AC122916.4| Mus musculus BAC clone RP23-28F1 from 5, complete... 42 1.6
55gb|AC122190.4| Mus musculus BAC clone RP23-41J14 from 12, comple... 42 1.6
56gb|AC117227.3| Mus musculus BAC clone RP23-380C5 from 13, comple... 42 1.6
57gb|AC091506.2| Sus scrofa clone RP44-348C20, complete sequence 42 1.6
58gb|AC149067.3| Mus musculus BAC clone RP23-56C20 from chromosome... 42 1.6
59emb|BX928753.10| Zebrafish DNA sequence from clone DKEY-5J3 in l... 42 1.6
60emb|AL365401.20| Human DNA sequence from clone RP11-489M19 on ch... 42 1.6
61emb|AL355608.11| Human DNA sequence from clone RP11-567J2 on chr... 42 1.6
62emb|AL139823.11| Human DNA sequence from clone RP4-703E10 on chr... 42 1.6
63gb|AC073617.16| Homo sapiens Xp BAC RP11-413F15 (Roswell Park Ca... 42 1.6
64emb|AL109919.18|HSDJ258B3 Human DNA sequence from clone RP1-258B... 42 1.6
65emb|AL035070.3|HS1043L13 Human DNA sequence from clone RP5-1043L... 42 1.6
66emb|BX908784.6| Zebrafish DNA sequence from clone DKEY-69I13, co... 42 1.6
67emb|BX927311.7| Zebrafish DNA sequence from clone CH211-235E15 i... 42 1.6
68emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.6
69gb|AC161457.5| Mus musculus BAC clone RP23-156A3 from chromosome... 42 1.6
70emb|AL662950.2|OSJN00152 Oryza sativa genomic DNA, chromosome 4,... 42 1.6
71gb|AC136964.2| Sus scrofa domestica clone RP44-154L9, complete s... 42 1.6
72gb|AC144770.1| Homo sapiens chromosome 19 clone XXfos-87852H4, c... 42 1.6
73emb|BX927328.10| Zebrafish DNA sequence from clone CH211-10M4 in... 42 1.6
74emb|CR759811.8| Zebrafish DNA sequence from clone CH211-190M18 i... 42 1.6
75emb|CR382384.18| Zebrafish DNA sequence from clone CH211-15B7 in... 42 1.6
76emb|BX004886.8| Zebrafish DNA sequence from clone DKEY-33P4 in l... 42 1.6
77emb|BX572620.15| Zebrafish DNA sequence from clone CH211-202G13 ... 42 1.6
78emb|BX470140.10| Zebrafish DNA sequence from clone CH211-238E6 i... 42 1.6
79emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in... 42 1.6
80emb|CR361551.8| Zebrafish DNA sequence from clone CH211-224M9 in... 42 1.6
81emb|BX088705.18| Zebrafish DNA sequence from clone DKEY-21G19, c... 42 1.6
82emb|BX324148.9| Zebrafish DNA sequence from clone RP71-17G11 in ... 42 1.6
83emb|BX572647.10| Zebrafish DNA sequence from clone CH211-149N1 i... 42 1.6
84gb|AC092566.2| Homo sapiens chromosome 19 clone LLNLR-239F4, com... 42 1.6
85gb|AC010299.8| Homo sapiens chromosome 5 clone CTB-174J2, comple... 42 1.6
86emb|BX537141.17| Zebrafish DNA sequence from clone DKEY-9E8 in l... 42 1.6
87emb|CR450716.5| Zebrafish DNA sequence from clone DKEYP-84G1 in ... 42 1.6
88gb|AC105292.3| Drosophila melanogaster X BAC RP98-18F10 (Roswell... 42 1.6
89gb|AC116559.30| Papio anubis clone rp41-339c10, complete sequence 42 1.6
90gb|AC116558.21| Papio anubis clone rp41-273g19, complete sequence 42 1.6
91gb|AC117383.4| Homo sapiens 3 BAC RP11-789L4 (Roswell Park Cance... 42 1.6
92emb|BX510352.17| Zebrafish DNA sequence from clone DKEY-96J11 in... 42 1.6
93emb|BX571850.7| Zebrafish DNA sequence from clone DKEY-259L18 in... 42 1.6
94emb|BX769174.7| Zebrafish DNA sequence from clone DKEY-246O14, c... 42 1.6
95ref|NM_167192.1| Drosophila melanogaster CG32700-RB, transcript ... 42 1.6
96ref|NM_167191.1| Drosophila melanogaster CG32700-RA, transcript ... 42 1.6
97gb|AY060321.1| Drosophila melanogaster GH19985 full length cDNA 42 1.6
98emb|BX324129.11| Zebrafish DNA sequence from clone CH211-221D5 i... 42 1.6
99emb|BX322620.13| Zebrafish DNA sequence from clone DKEY-49L3 in ... 42 1.6
100emb|BX321896.13| Zebrafish DNA sequence from clone RP71-49B22 in... 42 1.6
101emb|BX255912.10| Zebrafish DNA sequence from clone CH211-267H23,... 42 1.6
102emb|BX548002.12| Zebrafish DNA sequence from clone CH211-170I2 i... 42 1.6
103gb|AC158955.2| Mus musculus chromosome 15, clone RP23-22C17, com... 42 1.6
104emb|BX248323.8| Zebrafish DNA sequence from clone CH211-199J6, c... 42 1.6
105gb|AC159148.10| Mus musculus 10 BAC RP23-42M24 (Roswell Park Can... 42 1.6
106emb|BX322791.7| Zebrafish DNA sequence from clone RP71-55E12, co... 42 1.6
107gb|AC073057.6| Homo sapiens BAC clone RP11-114G11 from 7, comple... 42 1.6
108emb|BX897687.7| Zebrafish DNA sequence from clone DKEY-151O8, co... 42 1.6
109dbj|AK043033.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 42 1.6
110gb|AC139319.6| Mus musculus BAC clone RP24-439B16 from chromosom... 42 1.6
111emb|BX465186.11| Zebrafish DNA sequence from clone DKEY-106M10 i... 42 1.6
112gb|AC156287.12| Mus musculus 6 BAC RP24-243F8 (Roswell Park Canc... 42 1.6
113emb|BX322566.6| Zebrafish DNA sequence from clone CH211-209B6 in... 42 1.6
114emb|BX255944.7| Zebrafish DNA sequence from clone CH211-241L20, ... 42 1.6
115dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
116gb|AC117500.13| Homo sapiens 12 BAC RP11-495K9 (Roswell Park Can... 42 1.6
117gb|AC008236.4|AC008236 Drosophila melanogaster, chromosome 3R, r... 42 1.6
118emb|BX324188.7| Zebrafish DNA sequence from clone DKEY-85A20 in ... 42 1.6
119gb|AC153616.8| Mus musculus 6 BAC RP23-328I7 (Roswell Park Cance... 42 1.6
120gb|AC158807.11| Mus musculus 10 BAC RP24-64G24 (Roswell Park Can... 42 1.6
121gb|AC008403.8| Homo sapiens chromosome 19 clone CTC-273B12, comp... 42 1.6
122gb|AC153613.9| Mus musculus 10 BAC RP23-23C9 (Roswell Park Cance... 42 1.6
123gb|AC136601.2| Homo sapiens chromosome 5 clone RP11-1259L22, com... 42 1.6
124gb|AC022215.4|AC022215 Homo sapiens BAC clone RP11-764I5 from 3,... 42 1.6
125gb|AC068580.23| Homo sapiens chromosome 11, clone RP11-295K3, co... 42 1.6
126gb|AC055858.18| Homo sapiens chromosome 17, clone RP11-682M7, co... 42 1.6
127emb|BX470088.11| Zebrafish DNA sequence from clone DKEY-171E12 i... 42 1.6
128emb|BX088561.9| Zebrafish DNA sequence from clone DKEY-257G8 in ... 42 1.6
129gb|AF191069.1|AF191069 Homo sapiens chromosome 21 clone P704-682... 42 1.6
130gb|AF190641.1|AF190641 Homo sapiens chromosome 21 PAC 704P23131 ... 42 1.6
131gb|AC132145.3| Mus musculus BAC clone RP23-44H21 from chromosome... 42 1.6
132gb|AC142168.3| Mus musculus BAC clone RP24-80B23 from chromosome... 42 1.6
133gb|AC154502.2| Mus musculus BAC clone RP24-87I20 from chromosome... 42 1.6
134emb|BX088724.6| Zebrafish DNA sequence from clone DKEY-15G22, co... 42 1.6
135gb|AC158669.3| Mus musculus 6 BAC RP23-66K6 (Roswell Park Cancer... 42 1.6
136emb|BX004770.12| Zebrafish DNA sequence from clone DKEY-14K21 in... 42 1.6
137emb|AL928887.13| Zebrafish DNA sequence from clone CH211-136O14 ... 42 1.6
138emb|AL935207.6| Zebrafish DNA sequence from clone CH211-251J8, c... 42 1.6
139emb|CR628405.8| Zebrafish DNA sequence from clone CH211-170A5 in... 42 1.6
140emb|CR926459.7| Zebrafish DNA sequence from clone CH211-260O22 i... 42 1.6
141emb|CR388128.18| Zebrafish DNA sequence from clone CH211-127B17 ... 42 1.6
142emb|CR381630.12| Zebrafish DNA sequence from clone CH211-234G24 ... 42 1.6
143emb|BX537249.8| Zebrafish DNA sequence from clone DKEY-77B17 in ... 42 1.6
144emb|BX088581.11| Zebrafish DNA sequence from clone CH211-209H6 i... 42 1.6
145emb|AL954149.19| Zebrafish DNA sequence from clone CH211-146G19 ... 42 1.6
146emb|BX465846.14| Zebrafish DNA sequence from clone CH211-215B21 ... 42 1.6
147emb|AL929391.10| Zebrafish DNA sequence from clone CH211-155I14 ... 42 1.6
148emb|BX510325.3| Zebrafish DNA sequence from clone CH211-149A22 i... 42 1.6
149emb|CR855387.11| Zebrafish DNA sequence from clone DKEY-282H22 i... 42 1.6
150emb|BX901971.15| Zebrafish DNA sequence from clone DKEY-256M21 i... 42 1.6
151gb|AC004114.1|AC004114 Drosophila melanogaster, chromosome X, re... 42 1.6
152gb|AF087796.1|AF087796 Oryctolagus cuniculus clone Nb 09-H immun... 42 1.6
153gb|AE003743.3| Drosophila melanogaster chromosome 3R, section 81... 42 1.6
154gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 ... 42 1.6
155dbj|AP001707.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 42 1.6
156emb|AL928980.7| Zebrafish DNA sequence from clone DKEY-77M16 in ... 42 1.6
157dbj|AP002754.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 1.6
158dbj|AP006199.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 42 1.6
159dbj|AP006196.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 42 1.6
160dbj|AP002380.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 1.6
161gb|AC096628.14| Mus musculus strain C57BL/6J chromosome 13 clone... 42 1.6
162gb|AF042806.1|HSSWAP06 Homo sapiens suppressor of white-apricot ... 42 1.6
163emb|AL928675.7| Zebrafish DNA sequence from clone DKEY-13B16 in ... 42 1.6
164gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.6
165gb|AC005760.1|AC005760 Homo sapiens chromosome 19, cosmid R31118... 42 1.6
166gb|AC163357.5| Mus musculus BAC clone RP23-3K10 from chromosome ... 42 1.6
167gb|AC153639.4| Mus musculus 6 BAC RP23-124H2 (Roswell Park Cance... 42 1.6
168emb|CR536605.14| Zebrafish DNA sequence from clone DKEY-96K16 in... 42 1.6
169gb|AC004770.1|AC004770 Homo sapiens chromosome 11, BAC CIT-HSP-3... 42 1.6
170emb|AL929086.7| Zebrafish DNA sequence from clone CH211-130K1 in... 42 1.6
171emb|AL954192.3| Zebrafish DNA sequence from clone CH211-215D15, ... 42 1.6
172emb|AL669970.10| Human DNA sequence from clone RP11-473E2 on chr... 42 1.6
173gb|AC161459.5| Mus musculus BAC clone RP23-117I19 from chromosom... 42 1.6
174emb|AL808103.8| Mouse DNA sequence from clone RP23-301G2 on chro... 42 1.6
175emb|AL807384.5| Mouse DNA sequence from clone RP23-18F9 on chrom... 42 1.6
176emb|AL158219.11| Human DNA sequence from clone RP5-876B19 on chr... 42 1.6
177gb|AC090692.9| Homo sapiens chromosome 11, clone RP11-698N11, co... 42 1.6
178gb|AC093290.4| Homo sapiens chromosome 5 clone RP11-47L17, compl... 42 1.6
179dbj|AP000390.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 42 1.6
180dbj|AP002529.1| Homo sapiens genomic DNA, chromosome 6q21, anti-... 42 1.6
181dbj|AB041731.1| Homo sapiens genomic DNA, chromosome 6q21, BAC c... 42 1.6
182dbj|AB042031.1| Homo sapiens genomic DNA, chromosome 6q21, BAC c... 42 1.6
183gb|AC108402.12| Mus musculus chromosome 3, clone RP24-141M5, com... 40 6.3
184gb|AC138358.12| Mus musculus chromosome 1, clone RP24-147G10, co... 40 6.3
185gb|AC117825.9| Mus musculus chromosome 18, clone RP24-80J4, comp... 40 6.3
186gb|AC155072.1| Homo sapiens chromosome 12 clone fa0727, complete... 40 6.3
187gb|AC102176.8| Mus musculus chromosome 15, clone RP23-480E14, co... 40 6.3
188gb|AC107762.8| Mus musculus chromosome 1, clone RP23-183L12, com... 40 6.3
189gb|AC137884.9| Mus musculus chromosome 1, clone RP23-152I6, comp... 40 6.3
190gb|AC113013.15| Mus musculus chromosome 7, clone RP23-174K7, com... 40 6.3
191gb|AC153799.1| Mus musculus BAC RP23-145M15 (Roswell Park Cance... 40 6.3
192gb|AC102039.8| Mus musculus chromosome 5, clone RP23-262L7, comp... 40 6.3
193gb|AC154808.2| Mus musculus BAC clone RP24-512K19 from chromosom... 40 6.3
194gb|AC150385.2| Branchiostoma floridae clone CH302-101G3, complet... 40 6.3
195gb|AC168091.3| Mus musculus BAC clone RP23-163F18 from chromosom... 40 6.3
196gb|AC154221.3| Mus musculus BAC clone RP24-373L7 from chromosome... 40 6.3
197gb|AC103624.9| Mus musculus chromosome 5, clone RP24-258B22, com... 40 6.3
198gb|AC101661.7| Mus musculus chromosome 1, clone RP23-26A10, comp... 40 6.3
199gb|AC166170.4| Mus musculus BAC clone RP23-174N23 from chromosom... 40 6.3
200gb|AC139867.4| Mus musculus BAC clone RP23-430P22 from chromosom... 40 6.3
201gb|AC164310.2| Mus musculus BAC clone RP23-139E15 from chromosom... 40 6.3
202gb|AC154650.2| Mus musculus BAC clone RP23-162K2 from chromosome... 40 6.3
203gb|AC132350.4| Mus musculus BAC clone RP24-95A6 from chromosome ... 40 6.3
204gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome... 40 6.3
205gb|AC160966.2| Mus musculus BAC clone RP24-362F17 from chromosom... 40 6.3
206gb|AC166238.7| Mus musculus chromosome 1, clone RP23-469H11, com... 40 6.3
207gb|AC167466.6| Mus musculus chromosome 7, clone RP24-220N8, comp... 40 6.3
208gb|AC166776.6| Mus musculus chromosome 5, clone RP23-24K16, comp... 40 6.3
209gb|AC166047.6| Mus musculus chromosome 18, clone wi1-1600J1, com... 40 6.3
210gb|AC133489.32| Mus musculus strain C57BL/6J clone rp23-74a5, co... 40 6.3
211gb|AC102355.13| Mus musculus chromosome 5, clone RP23-120C8, com... 40 6.3
212gb|AC160860.2| Homo sapiens chromosome 11 clone WI2-3817J24, com... 40 6.3
213gb|AY790940.1| Homo sapiens insulin-like growth factor 1 (somato... 40 6.3
214gb|AY770133.1| Botryotinia fuckeliana strain 610 microsatellite ... 40 6.3
215gb|AY770111.1| Botryotinia fuckeliana strain 698 microsatellite ... 40 6.3
216gb|AY770110.1| Botryotinia fuckeliana strain 1259 microsatellite... 40 6.3
217gb|AY770109.1| Botryotinia fuckeliana strain 715 microsatellite ... 40 6.3
218gb|AY770108.1| Botryotinia fuckeliana strain T4 microsatellite 6... 40 6.3
219gb|AY770107.1| Botryotinia fuckeliana strain 32 microsatellite 6... 40 6.3
220gb|AY770106.1| Botryotinia fuckeliana strain 686 microsatellite ... 40 6.3
221gb|AY770105.1| Botryotinia fuckeliana strain 1771 microsatellite... 40 6.3
222gb|AY770104.1| Botryotinia fuckeliana strain 422 microsatellite ... 40 6.3
223gb|AY770103.1| Botryotinia fuckeliana strain 1750 microsatellite... 40 6.3
224gb|AY770102.1| Botryotinia fuckeliana strain 1309 microsatellite... 40 6.3
225gb|AY770101.1| Botryotinia fuckeliana strain 1260 microsatellite... 40 6.3
226gb|AC134409.12| Mus musculus chromosome 5, clone RP24-355F10, co... 40 6.3
227gb|AC120398.10| Mus musculus chromosome 3, clone RP24-333H9, com... 40 6.3
228gb|AC119856.13| Mus musculus chromosome 5, clone RP23-256B18, co... 40 6.3
229gb|AC158974.8| Mus musculus chromosome 15, clone RP24-252G18, co... 40 6.3
230gb|AC115789.9| Mus musculus chromosome 18, clone RP23-398N2, com... 40 6.3
231gb|AC161581.3| Mus musculus chromosome 15, clone RP24-75A19, com... 40 6.3
232gb|AC161792.9| Mus musculus chromosome 7, clone RP23-288B12, com... 40 6.3
233gb|AF026276.1| Homo sapiens fast skeletal troponin T (TNNT3) gen... 40 6.3
234gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 6.3
235gb|AF052189.1| Homo sapiens short myelin basic protein (MBP) gen... 40 6.3
236gb|AY094990.1| Athene cunicularia isolate Buow04 microsatellite ... 40 6.3
237gb|AF393671.1| Siphateles bicolor obesa isolate G99 microsatelli... 40 6.3
238gb|AF272364.1|AF272364S1 Mus musculus lysophosphatidic acid rece... 40 6.3
239gb|AY602200.1| Mustela vison clone Mvi1012 microsatellite sequences 40 6.3
240gb|AY263771.1| Seepiophila jonesi clone E2-10B microsatellite se... 40 6.3
241gb|AC114640.11| Mus musculus chromosome 17, clone RP24-125I7, co... 40 6.3
242gb|AC004778.1| Homo sapiens chromosome 16, cosmid clone RT156 (L... 40 6.3
243gb|AC004644.1| Homo sapiens chromosome 16, cosmid clone 367E12 (... 40 6.3
244gb|AC118010.11| Mus musculus chromosome 5, clone RP23-451E8, com... 40 6.3
245gb|AC157211.7| Mus musculus chromosome 1, clone RP23-204C6, comp... 40 6.3
246gb|AC102873.10| Mus musculus chromosome 17, clone RP24-536C15, c... 40 6.3
247gb|AC160993.5| Mus musculus BAC clone RP23-159D11 from chromosom... 40 6.3
248gb|AC119897.8| Mus musculus chromosome 1, clone RP24-227F14, com... 40 6.3
249gb|AC163329.6| Mus musculus chromosome 5, clone RP24-294K15, com... 40 6.3
250gb|AC166079.2| Mus musculus BAC clone RP23-51L15 from chromosome... 40 6.3
251gb|AC160995.4| Mus musculus BAC clone RP23-96D5 from chromosome ... 40 6.3
252gb|AC152063.5| Mus musculus BAC clone RP23-204I16 from chromosom... 40 6.3
253gb|AC154523.2| Mus musculus BAC clone RP24-65H12 from chromosome... 40 6.3
254gb|AC154494.2| Mus musculus BAC clone RP24-111G24 from chromosom... 40 6.3
255gb|AC134443.3| Mus musculus BAC clone RP24-107B13 from chromosom... 40 6.3
256gb|AC167169.2| Mus musculus BAC clone RP24-257G14 from chromosom... 40 6.3
257gb|AC159247.2| Mus musculus BAC clone RP24-249C9 from chromosome... 40 6.3
258gb|AC151715.3| Mus musculus BAC clone RP23-396L12 from chromosom... 40 6.3
259gb|AC161587.2| Mus musculus BAC clone RP24-492G17 from chromosom... 40 6.3
260gb|AC158943.9| Mus musculus chromosome 1, clone RP24-272N10, com... 40 6.3
261gb|AC105076.25| Mus musculus chromosome 3, clone RP23-258P2, com... 40 6.3
262gb|AC119884.13| Mus musculus chromosome 15, clone RP24-213O5, co... 40 6.3
263gb|AC118255.32| Mus musculus chromosome 8, clone RP24-89A4, comp... 40 6.3
264gb|AC123597.9| Mus musculus chromosome 8, clone RP23-134A7, comp... 40 6.3
265gb|AC007589.8| Drosophila melanogaster clone BACR20D10, complete... 40 6.3
266gb|AC110734.9| Mus musculus chromosome 1, clone RP24-113C15, com... 40 6.3
267gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, compl... 40 6.3
268gb|AC115508.5| Rattus norvegicus 2 BAC CH230-355B17 (Children's ... 40 6.3
269gb|AC097117.12| Rattus norvegicus 1 BAC CH230-36C10 (Children's ... 40 6.3
270gb|AC109291.12| Mus musculus chromosome 18, clone RP24-231C23, c... 40 6.3
271gb|AC009537.6| Drosophila melanogaster clone BACR11M01, complete... 40 6.3
272gb|AC120388.11| Mus musculus chromosome 9, clone RP24-300P2, com... 40 6.3
273gb|AC166334.8| Mus musculus chromosome 7, clone RP23-470P9, comp... 40 6.3
274ref|XM_420314.1| PREDICTED: Gallus gallus similar to p21-activat... 40 6.3
275ref|XM_417167.1| PREDICTED: Gallus gallus similar to CWF19-like ... 40 6.3
276gb|AC116500.13| Mus musculus chromosome 5, clone RP24-297N9, com... 40 6.3
277gb|AC114657.8| Mus musculus chromosome 5, clone RP24-161C20, com... 40 6.3
278gb|AC133495.4| Mus musculus BAC clone RP24-331G15 from chromosom... 40 6.3
279gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosom... 40 6.3
280gb|AC130828.4| Mus musculus BAC clone RP23-406H14 from chromosom... 40 6.3
281gb|AC123837.5| Mus musculus BAC clone RP23-385F8 from chromosome... 40 6.3
282gb|AC110898.7| Mus musculus chromosome 18, clone RP24-114C6, com... 40 6.3
283gb|AC137680.10| Mus musculus chromosome 13, clone RP23-454P19, c... 40 6.3
284gb|AC184848.2| Pan troglodytes BAC clone CH251-277H16 from chrom... 40 6.3
285gb|AC148934.2| Pan troglodytes BAC clone CH251-557M20 from Y, co... 40 6.3
286gb|AC148310.2| Pan troglodytes BAC clone RP43-31J11 from 7, comp... 40 6.3
287gb|AC119952.12| Mus musculus chromosome 14, clone RP24-448F1, co... 40 6.3
288gb|AC129580.14| Mus musculus chromosome 14, clone RP24-149P3, co... 40 6.3
289gb|AC166779.3| Mus musculus chromosome 18, clone RP23-399N10, co... 40 6.3
290gb|AY623110.1| Homo sapiens solute carrier family 6 (neurotransm... 40 6.3
291gb|AC134530.3| Mus musculus BAC clone RP24-507K16 from chromosom... 40 6.3
292gb|AC147663.3| Pan troglodytes BAC clone CH251-304A22 from Y, co... 40 6.3
293gb|AC145863.3| Pan troglodytes BAC clone RP43-6J8 from 7, comple... 40 6.3
294gb|AC146408.3| Pan troglodytes BAC clone RP43-41L7 from 7, compl... 40 6.3
295gb|AC146428.3| Pan troglodytes BAC clone RP43-22M18 from 7, comp... 40 6.3
296gb|AC124749.5| Mus musculus BAC clone RP23-262G23 from chromosom... 40 6.3
297gb|AC122302.4| Mus musculus BAC clone RP23-276E10 from chromosom... 40 6.3
298gb|AC137980.4| Mus musculus BAC clone RP24-69K24 from chromosome... 40 6.3
299gb|AC140333.2| Mus musculus BAC clone RP24-326A21 from chromosom... 40 6.3
300gb|AC131669.3| Mus musculus BAC clone RP23-307E9 from chromosome... 40 6.3
301gb|AC125186.6| Mus musculus BAC clone RP23-302C16 from chromosom... 40 6.3
302gb|AC183681.2| Pan troglodytes BAC clone CH251-278I15 from chrom... 40 6.3
303gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete se... 40 6.3
304gb|AC118546.80| Mus musculus strain C57BL/6J clone rp23-346h22 m... 40 6.3
305gb|AC157552.10| Mus musculus chromosome 7, clone RP23-89C10, com... 40 6.3
306gb|AC161514.4| Mus musculus chromosome 7, clone RP23-378L12, com... 40 6.3
307gb|AC157805.3| Mus musculus chromosome 1, clone RP24-324B17, com... 40 6.3
308gb|AC113028.15| Mus musculus chromosome 5, clone RP23-205D3, com... 40 6.3
309gb|AC154675.2| Mus musculus BAC clone RP23-143J5 from chromosome... 40 6.3
310gb|AF235096.5| Homo sapiens chromosome 8 clone RP11-562D1 map q2... 40 6.3
311gb|AY496606.1| Simian T-lymphotropic virus 1 isolate 01CM-1312 e... 40 6.3
312gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, compl... 40 6.3
313gb|AC153360.6| Mus musculus BAC clone RP23-321I6 from chromosome... 40 6.3
314gb|AC111029.8| Mus musculus chromosome 3, clone RP23-235E15, com... 40 6.3
315gb|AC155711.14| Mus musculus 10 BAC RP24-189K8 (Roswell Park Can... 40 6.3
316gb|AC022062.10| Mus musculus chromosome 5, clone RP23-57P23, com... 40 6.3
317gb|AC124814.10| Mus musculus chromosome 1, clone RP24-119P5, com... 40 6.3
318gb|AC138682.14| Mus musculus chromosome 5, clone RP23-34L23, com... 40 6.3
319gb|AC091396.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 6.3
320gb|AC136699.23| Mus musculus chromosome 9, clone RP23-18E24, com... 40 6.3
321gb|AC116107.10| Mus musculus chromosome 1, clone RP23-28F18, com... 40 6.3
322gb|AC125274.12| Mus musculus chromosome 15, clone RP24-157F9, co... 40 6.3
323gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 6.3
324gb|AC161169.10| Mus musculus chromosome 5, clone RP24-102B13, co... 40 6.3
325gb|AC161170.7| Mus musculus chromosome 1, clone RP23-307G23, com... 40 6.3
326gb|AC165155.2| Mus musculus BAC clone RP23-293N22 from chromosom... 40 6.3
327gb|AC109271.10| Mus musculus chromosome 1, clone RP23-353I19, co... 40 6.3
328gb|AC137681.20| Mus musculus chromosome 14, clone RP23-460H20, c... 40 6.3
329gb|AC149215.3| Mus musculus BAC clone RP24-201G21 from chromosom... 40 6.3
330gb|AC164103.5| Mus musculus BAC clone RP23-427D2 from chromosome... 40 6.3
331gb|AC156164.2| Mus musculus BAC clone RP24-75M13 from chromosome... 40 6.3
332gb|AC165293.2| Mus musculus BAC clone RP23-268A5 from chromosome... 40 6.3
333gb|AC163636.5| Mus musculus BAC clone RP24-499E13 from chromosom... 40 6.3
334gb|AC156947.7| Mus musculus 10 BAC RP24-374M24 (Roswell Park Can... 40 6.3
335gb|AC119906.6| Mus musculus chromosome 5, clone RP24-239D13, com... 40 6.3
336gb|AY549314.1| Homo sapiens tyrosine kinase 2 (TYK2) gene, compl... 40 6.3
337gb|AC122541.3| Mus musculus BAC clone RP24-567D4 from chromosome... 40 6.3
338gb|AC183833.2| Pan troglodytes BAC clone CH251-141C5 from chromo... 40 6.3
339gb|AC183614.3| Pan troglodytes BAC clone CH251-186N21 from chrom... 40 6.3
340gb|AC183385.3| Pan troglodytes BAC clone CH251-277F20 from chrom... 40 6.3
341gb|AC148932.3| Pan troglodytes BAC clone CH251-571G8 from chromo... 40 6.3
342gb|AC140981.3| Mus musculus chromosome 9 clone RP23-282G22, comp... 40 6.3
343gb|AC126944.3| Mus musculus BAC clone RP23-19A4 from chromosome ... 40 6.3
344gb|AC128670.3| Mus musculus BAC clone RP23-137H4 from chromosome... 40 6.3
345gb|AC133937.3| Mus musculus BAC clone RP24-486L5 from chromosome... 40 6.3
346gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome... 40 6.3
347gb|AC119219.6| Mus musculus chromosome 12, clone RP24-201C18, co... 40 6.3
348gb|AC148094.1| Mus musculus chromosome UNK clone RP24-497G1, com... 40 6.3
349gb|AC093168.3| Homo sapiens BAC clone RP11-148M21 from 7, comple... 40 6.3
350gb|AC006372.2| Homo sapiens BAC clone RP11-331D5 from 7, complet... 40 6.3
351gb|AC005056.2| Homo sapiens BAC clone CTB-51J22 from 7, complete... 40 6.3
352gb|AC007567.2| Homo sapiens BAC clone CTB-36G2 from 7, complete ... 40 6.3
353gb|AY514436.1| Cervus elaphus canadensis clone C32 tetranucleoti... 40 6.3
354gb|AC093734.3| Homo sapiens BAC clone RP11-16P10 from 7, complet... 40 6.3
355gb|AF254983.3| Homo sapiens chromosome 21 clone RP11-589M2 map p... 40 6.3
356gb|AC115743.10| Mus musculus chromosome 5, clone RP23-477P24, co... 40 6.3
357gb|AC004877.1| Homo sapiens PAC clone RP4-751H13 from 7, complet... 40 6.3
358gb|AC004851.2| Homo sapiens PAC clone RP4-665P5 from 7, complete... 40 6.3
359emb|BX294177.35| Zebrafish DNA sequence from clone CH211-281O13 ... 40 6.3
360gb|AC102689.10| Mus musculus chromosome 12, clone RP24-142L2, co... 40 6.3
361gb|AC147341.2| Pan troglodytes BAC clone CH251-31E16 from Y, com... 40 6.3
362gb|AC146234.3| Pan troglodytes BAC clone CH251-199F20 from Y, co... 40 6.3
363gb|AC147151.2| Pan troglodytes BAC clone CH251-205A10 from Y, co... 40 6.3
364gb|AC117118.4| Rattus norvegicus 1 BAC CH230-161O8 (Children's H... 40 6.3
365gb|AC140113.3| Homo sapiens PAC clone RP1-85D24 from Y, complete... 40 6.3
366gb|AC147773.1| Homo sapiens chromosome 16 clone PCR-16A05, compl... 40 6.3
367gb|AC116552.2| Homo sapiens chromosome 16 clone RP11-21B21, comp... 40 6.3
368gb|AC146211.3| Pan troglodytes BAC clone RP43-33E10 from 7, comp... 40 6.3
369gb|AC110622.6| Mus musculus BAC clone RP23-204H3 from chromosome... 40 6.3
370gb|AC126689.4| Mus musculus BAC clone RP23-166P10 from chromosom... 40 6.3
371gb|AC145199.3| Mus musculus BAC clone RP23-173N12 from chromosom... 40 6.3
372gb|AC141563.3| Mus musculus BAC clone RP23-410M22 from chromosom... 40 6.3
373gb|AC125536.3| Mus musculus BAC clone RP24-142N21 from chromosom... 40 6.3
374gb|AC127699.4| Mus musculus BAC clone RP24-114P21 from chromosom... 40 6.3
375gb|AC122376.4| Mus musculus BAC clone RP23-472G10 from chromosom... 40 6.3
376gb|AC124449.3| Mus musculus BAC clone RP24-212N10 from chromosom... 40 6.3
377gb|AC134438.3| Mus musculus BAC clone RP24-470G3 from chromosome... 40 6.3
378gb|AF288076.1| Mus musculus gastric mucin (Muc5ac) gene, promote... 40 6.3
379gb|AY050668.1| Homo sapiens PKC-potentiated PP1 inhibitory prote... 40 6.3
380gb|DQ483421.1| Gymnogyps californianus clone 124H microsatellite... 40 6.3
381emb|CR376773.7| Zebrafish DNA sequence from clone CH211-23E22 in... 40 6.3
382emb|CR925737.7| Zebrafish DNA sequence from clone DKEY-263O8 in ... 40 6.3
383emb|CR848707.6| Zebrafish DNA sequence from clone CH211-276P5 in... 40 6.3
384emb|CR388005.16| Zebrafish DNA sequence from clone DKEY-162B23 i... 40 6.3
385emb|CR450685.13| Zebrafish DNA sequence from clone DKEY-83K24 in... 40 6.3
386emb|CR388016.11| Zebrafish DNA sequence from clone DKEY-106M5 in... 40 6.3
387emb|CT025601.7| Mouse DNA sequence from clone RP23-424B7 on chro... 40 6.3
388emb|CR388131.10| Zebrafish DNA sequence from clone DKEY-114G9 in... 40 6.3
389emb|CR352327.13| Zebrafish DNA sequence from clone CH211-194C22 ... 40 6.3
390emb|CR936412.13| Zebrafish DNA sequence from clone DKEY-181M21 i... 40 6.3
391emb|BX890591.12| Zebrafish DNA sequence from clone DKEY-184J23 i... 40 6.3
392emb|AJ566134.1|SAR566134 Squalius aradensis microsatellite DNA, ... 40 6.3
393emb|AJ538310.1|PFL538310 Platichthys flesus microsatellite DNA, ... 40 6.3
394emb|BX927165.18| Zebrafish DNA sequence from clone DKEYP-120H9 i... 40 6.3
395emb|CR762485.16| Zebrafish DNA sequence from clone DKEY-269K12 i... 40 6.3
396emb|CR405683.10| Zebrafish DNA sequence from clone CH211-157B13 ... 40 6.3
397emb|BX571706.24| Zebrafish DNA sequence from clone DKEYP-123H11 ... 40 6.3
398emb|CR626875.10| Zebrafish DNA sequence from clone DKEY-31J4 in ... 40 6.3
399emb|BX936436.13| Zebrafish DNA sequence from clone DKEY-16H19 in... 40 6.3
400emb|BX908756.12| Zebrafish DNA sequence from clone CH211-190D13 ... 40 6.3
401emb|AL929541.41| Zebrafish DNA sequence from clone CH211-133D2 i... 40 6.3
402emb|CR769785.19| Zebrafish DNA sequence from clone DKEY-1N3 in l... 40 6.3
403emb|CR792425.6| Zebrafish DNA sequence from clone DKEY-81N9 in l... 40 6.3
404emb|CR478208.13| Zebrafish DNA sequence from clone CH211-149M3 i... 40 6.3
405gb|AC007616.5| Homo sapiens chromosome 16 clone RP11-547D14, com... 40 6.3
406gb|AC007613.8| Homo sapiens chromosome 16 clone RP11-490O6, comp... 40 6.3
407emb|CR936442.13| Zebrafish DNA sequence from clone DKEY-266F7 in... 40 6.3
408emb|BX927107.9| Zebrafish DNA sequence from clone CH211-281H20 i... 40 6.3
409gb|AC124992.14| Mus musculus chromosome 10, clone RP23-149L10, c... 40 6.3
410gb|AC120548.15| Mus musculus chromosome 17, clone RP23-211H11, c... 40 6.3
411emb|CR933522.11| Zebrafish DNA sequence from clone CH211-22N13 i... 40 6.3
412emb|CR392002.14| Zebrafish DNA sequence from clone DKEY-61D19 in... 40 6.3
413emb|CR545479.12| Zebrafish DNA sequence from clone CH211-219M24 ... 40 6.3
414emb|BX927327.14| Zebrafish DNA sequence from clone CH211-11C15 i... 40 6.3
415emb|CR936839.12| Mouse DNA sequence from clone CH29-120A16 on ch... 40 6.3
416emb|CR589948.8| Zebrafish DNA sequence from clone CH211-160P12 i... 40 6.3
417emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in... 40 6.3
418emb|CR391978.12| Zebrafish DNA sequence from clone DKEY-252L8 in... 40 6.3
419emb|CT010426.3| Mouse DNA sequence from clone RP23-17A17 on chro... 40 6.3
420emb|BX927339.16| Zebrafish DNA sequence from clone CH211-251A10 ... 40 6.3
421emb|BX001001.16| Zebrafish DNA sequence from clone CH211-262P15 ... 40 6.3
422emb|BX897684.8| Zebrafish DNA sequence from clone CH211-107A4 in... 40 6.3
423ref|XM_571065.1| Cryptococcus neoformans var. neoformans JEC21 h... 40 6.3
424emb|BX000523.24| Zebrafish DNA sequence from clone CH211-161N23 ... 40 6.3
425gb|AC130539.3| Mus musculus BAC clone RP23-455J15 from chromosom... 40 6.3
426gb|AC131705.4| Mus musculus BAC clone RP24-130N16 from chromosom... 40 6.3
427gb|AC135115.5| Mus musculus BAC clone RP24-251K13 from chromosom... 40 6.3
428gb|AC140222.3| Mus musculus BAC clone RP24-330A7 from chromosome... 40 6.3
429gb|AC122058.4| Mus musculus BAC clone RP24-468G7 from chromosome... 40 6.3
430gb|AC144711.2| Danio rerio clone CH211-218M15, complete sequence 40 6.3
431gb|AC127351.3| Mus musculus BAC clone RP23-66K20 from chromosome... 40 6.3
432gb|AC132467.3| Mus musculus BAC clone RP23-71E21 from chromosome... 40 6.3
433gb|AC125486.4| Mus musculus BAC clone RP23-21G7 from chromosome ... 40 6.3
434gb|AC114819.4| Mus musculus BAC clone RP23-52J20 from chromosome... 40 6.3
435gb|AC141429.4| Mus musculus BAC clone RP23-56L6 from chromosome ... 40 6.3
436gb|AC130221.4| Mus musculus BAC clone RP23-168E11 from chromosom... 40 6.3
437gb|AC122251.4| Mus musculus BAC clone RP23-167J15 from chromosom... 40 6.3
438emb|CR354390.16| Zebrafish DNA sequence from clone CH211-90K4 in... 40 6.3
439emb|CR847563.12| Zebrafish DNA sequence from clone CH211-202H14 ... 40 6.3
440gb|AC134603.4| Mus musculus BAC clone RP23-246L24 from chromosom... 40 6.3
441gb|AC130217.4| Mus musculus BAC clone RP23-237P18 from chromosom... 40 6.3
442emb|CR407592.10| Zebrafish DNA sequence from clone DKEY-166N5, c... 40 6.3
443gb|AC122342.4| Mus musculus BAC clone RP23-357O17 from chromosom... 40 6.3
444gb|AC122336.4| Mus musculus BAC clone RP23-351K21 from chromosom... 40 6.3
445gb|AC122365.4| Mus musculus BAC clone RP23-447A7 from chromosome... 40 6.3
446gb|AC132455.3| Mus musculus BAC clone RP23-129K10 from chromosom... 40 6.3
447gb|AC111008.6| Mus musculus BAC clone RP23-415J21 from chromosom... 40 6.3
448gb|AC093516.5| Homo sapiens chromosome 16 clone CTD-2537L13, com... 40 6.3
449gb|AC004382.1|HUAC004382 Homo sapiens Chromosome 16 BAC clone CI... 40 6.3
450gb|AC004787.1|HUAC004787 Homo sapiens Chromosome 16 BAC clone CI... 40 6.3
451emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 ... 40 6.3
452emb|BX539321.14| Zebrafish DNA sequence from clone CH211-223F3 i... 40 6.3
453emb|BX649517.15| Zebrafish DNA sequence from clone DKEY-174D5 in... 40 6.3
454emb|CR387978.12| Zebrafish DNA sequence from clone DKEY-33M5 in ... 40 6.3
455gb|AC135780.2| Homo sapiens chromosome 16 clone CTD-2320F3, comp... 40 6.3
456gb|AC026748.7| Homo sapiens chromosome 5 clone RP11-325I22, comp... 40 6.3
457gb|AC126672.3| Mus musculus BAC clone RP24-473A18 from chromosom... 40 6.3
458gb|AC127275.4| Mus musculus BAC clone RP24-207I8 from chromosome... 40 6.3
459gb|AC113554.9| Homo sapiens chromosome 17, clone CTD-2501B8, com... 40 6.3
460gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosom... 40 6.3
461gb|AC127568.4| Mus musculus BAC clone RP24-215P13 from chromosom... 40 6.3
462gb|AC114684.10| Homo sapiens chromosome 18, clone RP11-1058N17, ... 40 6.3
463gb|AC124422.5| Mus musculus BAC clone RP24-326L13 from chromosom... 40 6.3
464gb|AC125138.4| Mus musculus BAC clone RP24-324N8 from chromosome... 40 6.3
465gb|AC125147.4| Mus musculus BAC clone RP24-350A15 from chromosom... 40 6.3
466gb|AC124684.3| Mus musculus BAC clone RP24-375D13 from chromosom... 40 6.3
467gb|AC124403.3| Mus musculus BAC clone RP24-369I6 from chromosome... 40 6.3
468gb|AC124686.3| Mus musculus BAC clone RP24-422F20 from chromosom... 40 6.3
469gb|AC117259.3| Mus musculus BAC clone RP24-492O19 from chromosom... 40 6.3
470gb|AC123925.4| Mus musculus BAC clone RP24-292N2 from chromosome... 40 6.3
471emb|CR854834.11| Zebrafish DNA sequence from clone DKEYP-92B10 i... 40 6.3
472gb|AC073864.29| Homo sapiens 12 BAC RP11-227B21 (Roswell Park Ca... 40 6.3
473gb|AC121804.3| Mus musculus BAC clone RP23-442I5 from chromosome... 40 6.3
474gb|AC126555.3| Mus musculus BAC clone RP23-474A17 from chromosom... 40 6.3
475gb|AC079325.10| Homo sapiens chromosome 17, clone RP11-194J3, co... 40 6.3
476gb|AC123826.4| Mus musculus BAC clone RP24-97K3 from chromosome ... 40 6.3
477gb|AC124183.4| Mus musculus BAC clone RP23-213I18 from 13, compl... 40 6.3
478emb|BX899180.11| Zebrafish DNA sequence from clone DKEY-287G19 i... 40 6.3
479gb|AC122332.4| Mus musculus BAC clone RP23-346G14 from chromosom... 40 6.3
480emb|CR774185.17| Zebrafish DNA sequence from clone CH211-237H18 ... 40 6.3
481emb|CR361562.12| Zebrafish DNA sequence from clone CH211-281H24 ... 40 6.3
482gb|AC124462.2| Mus musculus BAC clone RP24-146O4 from chromosome... 40 6.3
483emb|CR354583.8| Zebrafish DNA sequence from clone CH211-230G15 i... 40 6.3
484gb|AC090582.9| Homo sapiens chromosome 11, clone RP11-125F14, co... 40 6.3
485emb|CR545462.25| Zebrafish DNA sequence from clone DKEYP-88F5 in... 40 6.3
486gb|AC091092.3| Papio anubis clone RP41-191D8, complete sequence 40 6.3
487gb|AC087430.3| Homo sapiens chromosome 3 clone RP11-242C8 map 3p... 40 6.3
488gb|AC121930.3| Mus musculus BAC clone RP24-205C1 from chromosome... 40 6.3
489gb|AE014305.1| Homo sapiens chromosome 13q34 schizophrenia regio... 40 6.3
490gb|AC125050.6| Mus musculus BAC clone RP23-372I18 from chromosom... 40 6.3
491gb|AC091001.3| Papio anubis clone RP41-36M16, complete sequence 40 6.3
492gb|AC131748.3| Mus musculus BAC clone RP23-42A17 from 12, comple... 40 6.3
493emb|CR450724.10| Zebrafish DNA sequence from clone DKEY-168I4 in... 40 6.3
494emb|CR847570.9| Zebrafish DNA sequence from clone DKEY-29M9 in l... 40 6.3
495gb|AC127335.4| Mus musculus BAC clone RP23-150G24 from 8, comple... 40 6.3
496gb|AC125229.3| Mus musculus BAC clone RP23-45P1 from 5, complete... 40 6.3
497gb|AC122195.4| Mus musculus BAC clone RP23-49D1 from 8, complete... 40 6.3
498gb|AC122864.3| Mus musculus BAC clone RP23-142M19 from 6, comple... 40 6.3
499gb|AC127333.3| Mus musculus BAC clone RP23-137F10 from 7, comple... 40 6.3
500gb|AC124765.2| Mus musculus BAC clone RP23-197D9 from 2, complet... 40 6.3

>ref|XM_463753.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1563

 Score =  174 bits (88), Expect = 2e-40
 Identities = 171/198 (86%), Gaps = 3/198 (1%)
 Strand = Plus / Minus

                                                                        
Query: 271  tcctggtggtaagggagggcctcatcttgacgatctgctcgtcgtcggcgaggcccatcc 330
            |||||||||| || || ||||||||||||||||||||||||||||   ||| ||||||||
Sbjct: 1537 tcctggtggtgagcgatggcctcatcttgacgatctgctcgtcgt---cgacgcccatcc 1481

                                                                        
Query: 331  tcttggccgacatgccggcctcgaagaagcgccgcacggccgacctcatgtaggaggtgc 390
            ||||||| |||||||||| |||||||||||||   || ||   || |||||| | | |||
Sbjct: 1480 tcttggctgacatgccggtctcgaagaagcgctttacagcgccccgcatgtacgcgatgc 1421

                                                                        
Query: 391  cttccctcacgttcatcctctccctgatcctctcctgcaggctgctcagctggtgatccc 450
            ||||||| ||||||||||| ||||||||| | ||||||||||||||||||||||| ||||
Sbjct: 1420 cttccctgacgttcatcctgtccctgatcgtgtcctgcaggctgctcagctggtggtccc 1361

                              
Query: 451  cgttcagcaccgccgcca 468
            |||| ||||||| |||||
Sbjct: 1360 cgttgagcaccgacgcca 1343



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  174 bits (88), Expect = 2e-40
 Identities = 171/198 (86%), Gaps = 3/198 (1%)
 Strand = Plus / Plus

                                                                            
Query: 271      tcctggtggtaagggagggcctcatcttgacgatctgctcgtcgtcggcgaggcccatcc 330
                |||||||||| || || |||||||||||||||||||||||||||||| ||   |||||||
Sbjct: 42055874 tcctggtggtgagcgatggcctcatcttgacgatctgctcgtcgtcgacg---cccatcc 42055930

                                                                            
Query: 331      tcttggccgacatgccggcctcgaagaagcgccgcacggccgacctcatgtaggaggtgc 390
                ||||||| |||||||||| |||||||||||||   || ||   || |||||| | | |||
Sbjct: 42055931 tcttggctgacatgccggtctcgaagaagcgctttacagcgccccgcatgtacgcgatgc 42055990

                                                                            
Query: 391      cttccctcacgttcatcctctccctgatcctctcctgcaggctgctcagctggtgatccc 450
                ||||||| ||||||||||| ||||||||| | ||||||||||||||||||||||| ||||
Sbjct: 42055991 cttccctgacgttcatcctgtccctgatcgtgtcctgcaggctgctcagctggtggtccc 42056050

                                  
Query: 451      cgttcagcaccgccgcca 468
                |||| ||||||| |||||
Sbjct: 42056051 cgttgagcaccgacgcca 42056068



to top

>dbj|AP004368.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1139B11
          Length = 136548

 Score =  174 bits (88), Expect = 2e-40
 Identities = 171/198 (86%), Gaps = 3/198 (1%)
 Strand = Plus / Plus

                                                                         
Query: 271   tcctggtggtaagggagggcctcatcttgacgatctgctcgtcgtcggcgaggcccatcc 330
             |||||||||| || || |||||||||||||||||||||||||||||| ||   |||||||
Sbjct: 42679 tcctggtggtgagcgatggcctcatcttgacgatctgctcgtcgtcgacg---cccatcc 42735

                                                                         
Query: 331   tcttggccgacatgccggcctcgaagaagcgccgcacggccgacctcatgtaggaggtgc 390
             ||||||| |||||||||| |||||||||||||   || ||   || |||||| | | |||
Sbjct: 42736 tcttggctgacatgccggtctcgaagaagcgctttacagcgccccgcatgtacgcgatgc 42795

                                                                         
Query: 391   cttccctcacgttcatcctctccctgatcctctcctgcaggctgctcagctggtgatccc 450
             ||||||| ||||||||||| ||||||||| | ||||||||||||||||||||||| ||||
Sbjct: 42796 cttccctgacgttcatcctgtccctgatcgtgtcctgcaggctgctcagctggtggtccc 42855

                               
Query: 451   cgttcagcaccgccgcca 468
             |||| ||||||| |||||
Sbjct: 42856 cgttgagcaccgacgcca 42873



to top

>dbj|AK119633.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-E12, full
            insert sequence
          Length = 1830

 Score =  174 bits (88), Expect = 2e-40
 Identities = 171/198 (86%), Gaps = 3/198 (1%)
 Strand = Plus / Minus

                                                                        
Query: 271  tcctggtggtaagggagggcctcatcttgacgatctgctcgtcgtcggcgaggcccatcc 330
            |||||||||| || || ||||||||||||||||||||||||||||   ||| ||||||||
Sbjct: 1617 tcctggtggtgagcgatggcctcatcttgacgatctgctcgtcgt---cgacgcccatcc 1561

                                                                        
Query: 331  tcttggccgacatgccggcctcgaagaagcgccgcacggccgacctcatgtaggaggtgc 390
            ||||||| |||||||||| |||||||||||||   || ||   || |||||| | | |||
Sbjct: 1560 tcttggctgacatgccggtctcgaagaagcgctttacagcgccccgcatgtacgcgatgc 1501

                                                                        
Query: 391  cttccctcacgttcatcctctccctgatcctctcctgcaggctgctcagctggtgatccc 450
            ||||||| ||||||||||| ||||||||| | ||||||||||||||||||||||| ||||
Sbjct: 1500 cttccctgacgttcatcctgtccctgatcgtgtcctgcaggctgctcagctggtggtccc 1441

                              
Query: 451  cgttcagcaccgccgcca 468
            |||| ||||||| |||||
Sbjct: 1440 cgttgagcaccgacgcca 1423



to top

>dbj|AK101291.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033033G16, full
            insert sequence
          Length = 1871

 Score =  174 bits (88), Expect = 2e-40
 Identities = 171/198 (86%), Gaps = 3/198 (1%)
 Strand = Plus / Minus

                                                                        
Query: 271  tcctggtggtaagggagggcctcatcttgacgatctgctcgtcgtcggcgaggcccatcc 330
            |||||||||| || || ||||||||||||||||||||||||||||   ||| ||||||||
Sbjct: 1617 tcctggtggtgagcgatggcctcatcttgacgatctgctcgtcgt---cgacgcccatcc 1561

                                                                        
Query: 331  tcttggccgacatgccggcctcgaagaagcgccgcacggccgacctcatgtaggaggtgc 390
            ||||||| |||||||||| |||||||||||||   || ||   || |||||| | | |||
Sbjct: 1560 tcttggctgacatgccggtctcgaagaagcgctttacagcgccccgcatgtacgcgatgc 1501

                                                                        
Query: 391  cttccctcacgttcatcctctccctgatcctctcctgcaggctgctcagctggtgatccc 450
            ||||||| ||||||||||| ||||||||| | ||||||||||||||||||||||| ||||
Sbjct: 1500 cttccctgacgttcatcctgtccctgatcgtgtcctgcaggctgctcagctggtggtccc 1441

                              
Query: 451  cgttcagcaccgccgcca 468
            |||| ||||||| |||||
Sbjct: 1440 cgttgagcaccgacgcca 1423



to top

>gb|AY106918.1| Zea mays PCO090417 mRNA sequence
          Length = 551

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 269 gatcctggtggtaagggagggcctcatcttgacgatctgctcgtcgtcg 317
           |||||||||||| |||||||| ||||||||||||||||| ||| |||||
Sbjct: 450 gatcctggtggtgagggagggtctcatcttgacgatctggtcgccgtcg 402



to top

>gb|AC134894.4| Mus musculus BAC clone RP24-260P1 from chromosome 9, complete sequence
          Length = 136085

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 58     atccattcatccatccatcctac 80
              |||||||||||||||||||||||
Sbjct: 130530 atccattcatccatccatcctac 130508



to top

>gb|AC113527.8| Mus musculus chromosome 9, clone RP23-314E23, complete sequence
          Length = 202544

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 58     atccattcatccatccatcctac 80
              |||||||||||||||||||||||
Sbjct: 107497 atccattcatccatccatcctac 107519



to top

>emb|BX927158.14| Zebrafish DNA sequence from clone DKEY-106K1 in linkage group 5, complete
              sequence
          Length = 144909

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 58     atccattcatccatccatcctac 80
              |||||||||||||||||||||||
Sbjct: 142677 atccattcatccatccatcctac 142699



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 143760 atccattcatccatccatcc 143779



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 142592 atccattcatccatccatcc 142611



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 57    aatccattcatccatccatcctac 80
             ||||||| ||||||||||||||||
Sbjct: 39417 aatccatccatccatccatcctac 39440



to top

>dbj|AK089846.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830032J04 product:unclassifiable, full
            insert sequence
          Length = 2453

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 58   atccattcatccatccatcctac 80
            |||||||||||||||||||||||
Sbjct: 2167 atccattcatccatccatcctac 2189



to top

>emb|BX950204.17| Zebrafish DNA sequence from clone DKEY-252P7 in linkage group 18,
             complete sequence
          Length = 133263

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 57    aatccattcatccatccatccta 79
             |||||||||||||||||||||||
Sbjct: 64795 aatccattcatccatccatccta 64817



to top

>gb|AC163640.5| Mus musculus BAC clone RP24-182L3 from chromosome 16, complete sequence
          Length = 168350

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 58     atccattcatccatccatccta 79
              ||||||||||||||||||||||
Sbjct: 151122 atccattcatccatccatccta 151143



to top

>gb|AC160961.3| Mus musculus BAC clone RP24-288N19 from chromosome 16, complete
            sequence
          Length = 157144

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 58   atccattcatccatccatccta 79
            ||||||||||||||||||||||
Sbjct: 4600 atccattcatccatccatccta 4621



to top

>gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, complete sequence
          Length = 248320

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 207   cctatgtatatatgcatgtgtg 228
             ||||||||||||||||||||||
Sbjct: 69702 cctatgtatatatgcatgtgtg 69681



to top

>gb|AC108097.3| Homo sapiens chromosome 16 clone RP11-109P11, complete sequence
          Length = 181387

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 58    atccattcatccatccatccta 79
             ||||||||||||||||||||||
Sbjct: 21315 atccattcatccatccatccta 21336



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 178446 atccattcatccatccatcc 178465



to top

>emb|CR847786.13| Zebrafish DNA sequence from clone DKEYP-9B4 in linkage group 13,
             complete sequence
          Length = 156551

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 57    aatccattcatccatccatcct 78
             ||||||||||||||||||||||
Sbjct: 70335 aatccattcatccatccatcct 70314



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    aatccattcatccatccatc 76
             ||||||||||||||||||||
Sbjct: 73317 aatccattcatccatccatc 73336



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 73031 atccattcatccatccatcc 73050



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 72883 atccattcatccatccatcc 72902



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    aatccattcatccatccatc 76
             ||||||||||||||||||||
Sbjct: 72754 aatccattcatccatccatc 72773



to top

>emb|AL355677.15| Human DNA sequence from clone RP11-428M15 on chromosome 13 Contains a
            CpG island, complete sequence
          Length = 175302

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 56   gaatccattcatccatccatcc 77
            ||||||||||||||||||||||
Sbjct: 6777 gaatccattcatccatccatcc 6798



to top

>emb|CR381637.5| Zebrafish DNA sequence from clone DKEY-225P19 in linkage group 21,
              complete sequence
          Length = 171229

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 58     atccattcatccatccatccta 79
              ||||||||||||||||||||||
Sbjct: 134002 atccattcatccatccatccta 134023



to top

>emb|BX950857.8| Zebrafish DNA sequence from clone CH211-203D19 in linkage group 5,
              complete sequence
          Length = 156682

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 56     gaatccattcatccatccatcc 77
              ||||||||||||||||||||||
Sbjct: 144180 gaatccattcatccatccatcc 144159



to top

>emb|BX005074.10| Zebrafish DNA sequence from clone CH211-146J7 in linkage group 8,
             complete sequence
          Length = 153989

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 58    atccattcatccatccatccta 79
             ||||||||||||||||||||||
Sbjct: 58838 atccattcatccatccatccta 58817



to top

>gb|AC092332.4| Homo sapiens chromosome 16 clone RP11-18F14, complete sequence
          Length = 155886

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 58    atccattcatccatccatccta 79
             ||||||||||||||||||||||
Sbjct: 30029 atccattcatccatccatccta 30008



to top

>emb|BX005472.11| Zebrafish DNA sequence from clone CH211-119C22 in linkage group 11,
              complete sequence
          Length = 158170

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 58     atccattcatccatccatccta 79
              ||||||||||||||||||||||
Sbjct: 118459 atccattcatccatccatccta 118480



to top

>emb|AL807833.5| Mouse DNA sequence from clone RP23-371E13 on chromosome 4, complete
             sequence
          Length = 188795

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 58    atccattcatccatccatccta 79
             ||||||||||||||||||||||
Sbjct: 81163 atccattcatccatccatccta 81142



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 176482 atccattcatccatccatcc 176501



to top

>gb|AC110907.7| Mus musculus chromosome 7, clone RP24-180J10, complete sequence
          Length = 179750

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 59578 atccattcatccatccatcct 59598



to top

>gb|AC102914.9| Mus musculus chromosome 15, clone RP24-274M4, complete sequence
          Length = 185807

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 84266 atccattcatccatccatcct 84286



to top

>gb|AC168056.3| Mus musculus BAC clone RP24-189B1 from chromosome 13, complete sequence
          Length = 179458

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 209    tatgtatatatgcatgtgtgc 229
              |||||||||||||||||||||
Sbjct: 136916 tatgtatatatgcatgtgtgc 136936



to top

>gb|AC167970.4| Mus musculus BAC clone RP24-471H15 from chromosome 7, complete sequence
          Length = 238950

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 209    tatgtatatatgcatgtgtgc 229
              |||||||||||||||||||||
Sbjct: 218212 tatgtatatatgcatgtgtgc 218232



to top

>gb|AC130671.7| Mus musculus chromosome 15, clone RP24-90K19, complete sequence
          Length = 205646

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 181523 atccattcatccatccatcct 181543



to top

>gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, complete sequence
          Length = 183264

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 58   atccattcatccatccatcct 78
            |||||||||||||||||||||
Sbjct: 5060 atccattcatccatccatcct 5080



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   atccattcatccatccatcc 77
            ||||||||||||||||||||
Sbjct: 4947 atccattcatccatccatcc 4966



to top

>gb|AC163684.5| Mus musculus BAC clone RP23-8N10 from chromosome 13, complete sequence
          Length = 234717

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 75444 tatgtatatatgcatgtgtgc 75464



to top

>gb|DQ223119.1| Alasmidonta heterodon microsatellite AheB121 sequence
          Length = 375

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 57  aatccattcatccatccatcc 77
           |||||||||||||||||||||
Sbjct: 200 aatccattcatccatccatcc 180



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 300     acgatctgctcgtcgtcggcg 320
               |||||||||||||||||||||
Sbjct: 3138635 acgatctgctcgtcgtcggcg 3138655



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 300    acgatctgctcgtcgtcggcg 320
              |||||||||||||||||||||
Sbjct: 261327 acgatctgctcgtcgtcggcg 261307



to top

>gb|AC145205.2| Homo sapiens chromosome 17, clone RP11-1224M18, complete sequence
          Length = 81310

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 58   atccattcatccatccatcct 78
            |||||||||||||||||||||
Sbjct: 2362 atccattcatccatccatcct 2342



to top

>gb|AC132278.3| Mus musculus BAC clone RP24-346C20 from chromosome 8, complete
            sequence
          Length = 154524

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 57   aatccattcatccatccatcc 77
            |||||||||||||||||||||
Sbjct: 1563 aatccattcatccatccatcc 1583



to top

>gb|AC183804.3| Pan troglodytes BAC clone CH251-67P16 from chromosome 2, complete
             sequence
          Length = 169437

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 73975 atccattcatccatccatcct 73995



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 74326 atccattcatccatccatcc 74345



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 300    acgatctgctcgtcgtcggcg 320
              |||||||||||||||||||||
Sbjct: 943596 acgatctgctcgtcgtcggcg 943576



to top

>gb|AC162890.4| Mus musculus chromosome 3, clone RP23-362E13, complete sequence
          Length = 113095

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 33738 tatgtatatatgcatgtgtgc 33718



to top

>gb|AC137154.2| Mus musculus BAC clone RP24-572L22 from chromosome 5, complete sequence
          Length = 173460

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 96219 atccattcatccatccatcct 96239



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 96106 atccattcatccatccatcc 96125



to top

>emb|BX936460.6| Zebrafish DNA sequence from clone CH211-69N2 in linkage group 9,
             complete sequence
          Length = 79327

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 56410 aatccattcatccatccatcc 56390



to top

>emb|BX511141.27| Zebrafish DNA sequence from clone DKEYP-10C6 in linkage group 23,
              complete sequence
          Length = 165253

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 150804 aatccattcatccatccatcc 150824



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 152695 atccattcatccatccatcc 152714



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 152589 atccattcatccatccatcc 152608



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 151082 atccattcatccatccatcc 151101



to top

>emb|CR932998.12| Zebrafish DNA sequence from clone DKEY-111I23 in linkage group 9,
             complete sequence
          Length = 218171

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 11981 atccattcatccatccatcct 11961



to top

>emb|CR354562.12| Zebrafish DNA sequence from clone DKEY-25B23 in linkage group 23,
             complete sequence
          Length = 201764

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 94271 aatccattcatccatccatcc 94251



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 93997 atccattcatccatccatcc 93978



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 93458 atccattcatccatccatcc 93439



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 92439 atccattcatccatccatcc 92420



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 92333 atccattcatccatccatcc 92314



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 70136 atccattcatccatccatcc 70155



to top

>emb|CR925863.7| Zebrafish DNA sequence from clone DKEY-184N1 in linkage group 8,
            complete sequence
          Length = 134388

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 58   atccattcatccatccatcct 78
            |||||||||||||||||||||
Sbjct: 4061 atccattcatccatccatcct 4041



to top

>gb|AC121909.3| Mus musculus BAC clone RP24-179L9 from chromosome 5, complete sequence
          Length = 155771

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 40470 tatgtatatatgcatgtgtgc 40490



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 60727 atccattcatccatccatcc 60708



to top

>gb|AC126025.4| Mus musculus BAC clone RP24-461L18 from chromosome 14, complete
             sequence
          Length = 164636

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 30247 aatccattcatccatccatcc 30227



to top

>gb|AC112149.4| Mus musculus BAC clone RP23-186F18 from chromosome 10, complete
             sequence
          Length = 195384

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 64516 tatgtatatatgcatgtgtgc 64496



to top

>gb|AC125349.3| Mus musculus BAC clone RP23-394P9 from chromosome 3, complete sequence
          Length = 194060

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 46023 tatgtatatatgcatgtgtgc 46043



to top

>gb|AC093519.3| Homo sapiens chromosome 16 clone RP11-107C10, complete sequence
          Length = 165074

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 84086 atccattcatccatccatcct 84106



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 84062 atccattcatccatccatcc 84081



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 84010 atccattcatccatccatcc 84029



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 83990 atccattcatccatccatcc 84009



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 83938 atccattcatccatccatcc 83957



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 83910 atccattcatccatccatcc 83929



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 83818 atccattcatccatccatcc 83837



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 83694 atccattcatccatccatcc 83713



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 83674 atccattcatccatccatcc 83693



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 83586 atccattcatccatccatcc 83605



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 83538 atccattcatccatccatcc 83557



to top

>gb|AC124369.4| Mus musculus BAC clone RP24-549O12 from chromosome 7, complete sequence
          Length = 147686

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 209    tatgtatatatgcatgtgtgc 229
              |||||||||||||||||||||
Sbjct: 132548 tatgtatatatgcatgtgtgc 132528



to top

>gb|AC121974.3| Mus musculus BAC clone RP24-285E14 from chromosome 16, complete
             sequence
          Length = 159535

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 42826 tatgtatatatgcatgtgtgc 42806



to top

>gb|AC122267.4| Mus musculus BAC clone RP23-214H6 from 8, complete sequence
          Length = 214619

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 179312 aatccattcatccatccatcc 179332



to top

>emb|BX664703.21| Zebrafish DNA sequence from clone DKEYP-74A8 in linkage group 6,
             complete sequence
          Length = 193958

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 62639 aatccattcatccatccatcc 62659



to top

>gb|AC122916.4| Mus musculus BAC clone RP23-28F1 from 5, complete sequence
          Length = 231319

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 66960 tatgtatatatgcatgtgtgc 66940



to top

>gb|AC122190.4| Mus musculus BAC clone RP23-41J14 from 12, complete sequence
          Length = 179390

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 52173 atccattcatccatccatcct 52153



to top

>gb|AC117227.3| Mus musculus BAC clone RP23-380C5 from 13, complete sequence
          Length = 190816

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 209    tatgtatatatgcatgtgtgc 229
              |||||||||||||||||||||
Sbjct: 168263 tatgtatatatgcatgtgtgc 168283



to top

>gb|AC091506.2| Sus scrofa clone RP44-348C20, complete sequence
          Length = 194809

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 189945 atccattcatccatccatcct 189965



to top

>gb|AC149067.3| Mus musculus BAC clone RP23-56C20 from chromosome 7, complete sequence
          Length = 267610

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 209    tatgtatatatgcatgtgtgc 229
              |||||||||||||||||||||
Sbjct: 210661 tatgtatatatgcatgtgtgc 210641



to top

>emb|BX928753.10| Zebrafish DNA sequence from clone DKEY-5J3 in linkage group 17, complete
              sequence
          Length = 159225

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 156412 aatccattcatccatccatcc 156432



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 155956 aatccattcatccatccatcc 155976



to top

>emb|AL365401.20| Human DNA sequence from clone RP11-489M19 on chromosome 20 Contains
             part of the CDH4 gene for retinal cadherin 4 type 1
             (R-cadherin), ESTs, STSs and GSSs, complete sequence
          Length = 108291

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 12097 atccattcatccatccatcct 12117



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 12159 atccattcatccatccatcc 12178



to top

>emb|AL355608.11| Human DNA sequence from clone RP11-567J2 on chromosome 9 Contains part
             of the ASTN2 gene for astrotactin 2 (KIAA0634) and a novel
             gene similar to ribosomal protein L10 (RPL10), complete
             sequence
          Length = 132590

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 70040 aatccattcatccatccatcc 70020



to top

>emb|AL139823.11| Human DNA sequence from clone RP4-703E10 on chromosome 1p36.32-36.33,
             complete sequence
          Length = 118994

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 58857 aatccattcatccatccatcc 58877



to top

>gb|AC073617.16| Homo sapiens Xp BAC RP11-413F15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 151302

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 49018 aatccattcatccatccatcc 48998



to top

>emb|AL109919.18|HSDJ258B3 Human DNA sequence from clone RP1-258B3 on chromosome 6q16.1-16.3
             Contains part of the GRIK2 gene for glutamate receptor
             ionotropic kainate 2, complete sequence
          Length = 147603

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 37732 atccattcatccatccatcct 37712



to top

>emb|AL035070.3|HS1043L13 Human DNA sequence from clone RP5-1043L13 on chromosome 20q13.2-13.33
              Contains part of a novel gene (LOC284757), complete
              sequence
          Length = 156666

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 147391 atccattcatccatccatcct 147411



to top

>emb|BX908784.6| Zebrafish DNA sequence from clone DKEY-69I13, complete sequence
          Length = 116059

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 10784 aatccattcatccatccatcc 10804



to top

>emb|BX927311.7| Zebrafish DNA sequence from clone CH211-235E15 in linkage group 24,
              complete sequence
          Length = 162570

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 154373 aatccattcatccatccatcc 154353



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 153615 atccattcatccatccatcc 153596



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 300    acgatctgctcgtcgtcggcg 320
              |||||||||||||||||||||
Sbjct: 785999 acgatctgctcgtcgtcggcg 785979



to top

>gb|AC161457.5| Mus musculus BAC clone RP23-156A3 from chromosome 16, complete sequence
          Length = 208176

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 58     atccattcatccatccatcctacag 82
              |||||| ||||||||||||||||||
Sbjct: 106252 atccatccatccatccatcctacag 106276



to top

>emb|AL662950.2|OSJN00152 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0008M17,
             complete sequence
          Length = 133279

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 15533 aatccattcatccatccatcc 15513



to top

>gb|AC136964.2| Sus scrofa domestica clone RP44-154L9, complete sequence
          Length = 164640

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 12250 atccattcatccatccatcct 12270



to top

>gb|AC144770.1| Homo sapiens chromosome 19 clone XXfos-87852H4, complete sequence
          Length = 45852

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 58   atccattcatccatccatcct 78
            |||||||||||||||||||||
Sbjct: 6200 atccattcatccatccatcct 6180



to top

>emb|BX927328.10| Zebrafish DNA sequence from clone CH211-10M4 in linkage group 17,
             complete sequence
          Length = 197949

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 85488 aatccattcatccatccatcc 85508



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 85028 aatccattcatccatccatcc 85048



to top

>emb|CR759811.8| Zebrafish DNA sequence from clone CH211-190M18 in linkage group 13,
              complete sequence
          Length = 132853

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 119438 atccattcatccatccatcct 119418



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 119458 atccattcatccatccatcc 119439



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 65551 atccattcatccatccatcc 65570



to top

>emb|CR382384.18| Zebrafish DNA sequence from clone CH211-15B7 in linkage group 8,
             complete sequence
          Length = 124327

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 57700 atccattcatccatccatcct 57680



to top

>emb|BX004886.8| Zebrafish DNA sequence from clone DKEY-33P4 in linkage group 10,
            complete sequence
          Length = 125715

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 57   aatccattcatccatccatcc 77
            |||||||||||||||||||||
Sbjct: 6887 aatccattcatccatccatcc 6907



to top

>emb|BX572620.15| Zebrafish DNA sequence from clone CH211-202G13 in linkage group 3,
              complete sequence
          Length = 199512

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 181595 aatccattcatccatccatcc 181615



to top

>emb|BX470140.10| Zebrafish DNA sequence from clone CH211-238E6 in linkage group 4
             Contains the gene for a novel protein similar to
             vertebrate microphthalmia-associated transcription factor
             (MITF), six novel genes and two CpG islands, complete
             sequence
          Length = 148136

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 58    atccattcatccatccatcctacag 82
             |||||| ||||||||||||||||||
Sbjct: 58137 atccatccatccatccatcctacag 58113



to top

>emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in linkage group 13,
              complete sequence
          Length = 207677

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 167946 atccattcatccatccatcct 167926



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 118027 atccattcatccatccatcc 118046



to top

>emb|CR361551.8| Zebrafish DNA sequence from clone CH211-224M9 in linkage group 1,
             complete sequence
          Length = 177606

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 24253 aatccattcatccatccatcc 24233



to top

>emb|BX088705.18| Zebrafish DNA sequence from clone DKEY-21G19, complete sequence
          Length = 204103

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 60297 aatccattcatccatccatcc 60317



to top

>emb|BX324148.9| Zebrafish DNA sequence from clone RP71-17G11 in linkage group 23,
             complete sequence
          Length = 127356

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 95461 aatccattcatccatccatcc 95441



to top

>emb|BX572647.10| Zebrafish DNA sequence from clone CH211-149N1 in linkage group 10,
              complete sequence
          Length = 190639

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 168050 aatccattcatccatccatcc 168070



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 178235 atccattcatccatccatcc 178254



to top

>gb|AC092566.2| Homo sapiens chromosome 19 clone LLNLR-239F4, complete sequence
          Length = 38046

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 28213 atccattcatccatccatcct 28233



to top

>gb|AC010299.8| Homo sapiens chromosome 5 clone CTB-174J2, complete sequence
          Length = 107689

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 24185 aatccattcatccatccatcc 24165



to top

>emb|BX537141.17| Zebrafish DNA sequence from clone DKEY-9E8 in linkage group 2,
            complete sequence
          Length = 264534

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 58   atccattcatccatccatcct 78
            |||||||||||||||||||||
Sbjct: 9482 atccattcatccatccatcct 9502



to top

>emb|CR450716.5| Zebrafish DNA sequence from clone DKEYP-84G1 in linkage group 18,
             complete sequence
          Length = 193900

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 76801 atccattcatccatccatcct 76821



to top

>gb|AC105292.3| Drosophila melanogaster X BAC RP98-18F10 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 161360

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 101497 atccattcatccatccatcct 101477



to top

>gb|AC116559.30| Papio anubis clone rp41-339c10, complete sequence
          Length = 162030

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 152019 atccattcatccatccatcct 151999



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 59     tccattcatccatccatcct 78
              ||||||||||||||||||||
Sbjct: 152379 tccattcatccatccatcct 152360



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 151722 atccattcatccatccatcc 151703



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 151182 atccattcatccatccatcc 151163



to top

>gb|AC116558.21| Papio anubis clone rp41-273g19, complete sequence
          Length = 188182

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 58   atccattcatccatccatcct 78
            |||||||||||||||||||||
Sbjct: 6960 atccattcatccatccatcct 6980



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   atccattcatccatccatcc 77
            ||||||||||||||||||||
Sbjct: 7821 atccattcatccatccatcc 7840



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   atccattcatccatccatcc 77
            ||||||||||||||||||||
Sbjct: 7257 atccattcatccatccatcc 7276



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 59   tccattcatccatccatcct 78
            ||||||||||||||||||||
Sbjct: 6600 tccattcatccatccatcct 6619



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 59   tccattcatccatccatcct 78
            ||||||||||||||||||||
Sbjct: 6286 tccattcatccatccatcct 6305



to top

>gb|AC117383.4| Homo sapiens 3 BAC RP11-789L4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 194991

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 35057 aatccattcatccatccatcc 35037



to top

>emb|BX510352.17| Zebrafish DNA sequence from clone DKEY-96J11 in linkage group 18,
            complete sequence
          Length = 152387

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 57   aatccattcatccatccatcc 77
            |||||||||||||||||||||
Sbjct: 7544 aatccattcatccatccatcc 7564



to top

>emb|BX571850.7| Zebrafish DNA sequence from clone DKEY-259L18 in linkage group 23,
             complete sequence
          Length = 236136

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 17905 aatccattcatccatccatcc 17925



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 17748 aatccattcatccatccatcc 17768



to top

>emb|BX769174.7| Zebrafish DNA sequence from clone DKEY-246O14, complete sequence
          Length = 187545

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 134295 atccattcatccatccatcct 134275



to top

>ref|NM_167192.1| Drosophila melanogaster CG32700-RB, transcript variant B (CG32700),
            mRNA
          Length = 1857

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 58   atccattcatccatccatcct 78
            |||||||||||||||||||||
Sbjct: 1573 atccattcatccatccatcct 1553



to top

>ref|NM_167191.1| Drosophila melanogaster CG32700-RA, transcript variant A (CG32700),
            mRNA
          Length = 1853

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 58   atccattcatccatccatcct 78
            |||||||||||||||||||||
Sbjct: 1569 atccattcatccatccatcct 1549



to top

>gb|AY060321.1| Drosophila melanogaster GH19985 full length cDNA
          Length = 1471

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 58   atccattcatccatccatcct 78
            |||||||||||||||||||||
Sbjct: 1167 atccattcatccatccatcct 1147



to top

>emb|BX324129.11| Zebrafish DNA sequence from clone CH211-221D5 in linkage group 2,
             complete sequence
          Length = 111186

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 88741 aatccattcatccatccatcc 88721



to top

>emb|BX322620.13| Zebrafish DNA sequence from clone DKEY-49L3 in linkage group 13,
             complete sequence
          Length = 192504

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 95110 aatccattcatccatccatcc 95090



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 95011 atccattcatccatccatcc 94992



to top

>emb|BX321896.13| Zebrafish DNA sequence from clone RP71-49B22 in linkage group 23,
              complete sequence
          Length = 165985

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 129219 atccattcatccatccatcct 129239



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 131258 atccattcatccatccatcc 131277



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 129007 atccattcatccatccatcc 129026



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 128551 atccattcatccatccatcc 128570



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 73833 atccattcatccatccatcc 73852



to top

>emb|BX255912.10| Zebrafish DNA sequence from clone CH211-267H23, complete sequence
          Length = 178425

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 69635 aatccattcatccatccatcc 69615



to top

>emb|BX548002.12| Zebrafish DNA sequence from clone CH211-170I2 in linkage group 25,
              complete sequence
          Length = 149569

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 107773 aatccattcatccatccatcc 107793



to top

>gb|AC158955.2| Mus musculus chromosome 15, clone RP23-22C17, complete sequence
          Length = 256999

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 120621 atccattcatccatccatcct 120641



to top

>emb|BX248323.8| Zebrafish DNA sequence from clone CH211-199J6, complete sequence
          Length = 177714

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 100349 atccattcatccatccatcct 100329



to top

>gb|AC159148.10| Mus musculus 10 BAC RP23-42M24 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 166208

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 58    atccattcatccatccatcctacag 82
             |||||| ||||||||||||||||||
Sbjct: 92608 atccatccatccatccatcctacag 92584



to top

>emb|BX322791.7| Zebrafish DNA sequence from clone RP71-55E12, complete sequence
          Length = 127643

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 76046 aatccattcatccatccatcc 76026



to top

>gb|AC073057.6| Homo sapiens BAC clone RP11-114G11 from 7, complete sequence
          Length = 178105

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 35846 atccattcatccatccatcct 35866



to top

>emb|BX897687.7| Zebrafish DNA sequence from clone DKEY-151O8, complete sequence
          Length = 208227

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 26994 aatccattcatccatccatcc 27014



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 146332 atccattcatccatccatcc 146313



to top

>dbj|AK043033.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:A730049K22 product:GPI
            TRANSAMIDASE homolog [Homo sapiens], full insert sequence
          Length = 3643

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 209  tatgtatatatgcatgtgtgc 229
            |||||||||||||||||||||
Sbjct: 2075 tatgtatatatgcatgtgtgc 2095



to top

>gb|AC139319.6| Mus musculus BAC clone RP24-439B16 from chromosome 12, complete sequence
          Length = 189003

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 201    tttcgacctatgtatatatgcatgt 225
              |||||||||||||||||||| ||||
Sbjct: 126529 tttcgacctatgtatatatgtatgt 126505



to top

>emb|BX465186.11| Zebrafish DNA sequence from clone DKEY-106M10 in linkage group 10,
              complete sequence
          Length = 247227

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 204730 aatccattcatccatccatcc 204750



to top

>gb|AC156287.12| Mus musculus 6 BAC RP24-243F8 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 159846

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 39780 atccattcatccatccatcct 39760



to top

>emb|BX322566.6| Zebrafish DNA sequence from clone CH211-209B6 in linkage group 23,
             complete sequence
          Length = 203127

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 87961 atccattcatccatccatcct 87981



to top

>emb|BX255944.7| Zebrafish DNA sequence from clone CH211-241L20, complete sequence
          Length = 169165

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 162614 aatccattcatccatccatcc 162594



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 162257 atccattcatccatccatcc 162238



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 162138 atccattcatccatccatcc 162119



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 116145 atccattcatccatccatcc 116126



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 57       aatccattcatccatccatcc 77
                |||||||||||||||||||||
Sbjct: 31193932 aatccattcatccatccatcc 31193912



to top

>gb|AC117500.13| Homo sapiens 12 BAC RP11-495K9 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 180995

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 152816 atccattcatccatccatcct 152836



to top

>gb|AC008236.4|AC008236 Drosophila melanogaster, chromosome 3R, region 95A-95A, BAC clone
             BACR24C15, complete sequence
          Length = 162923

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    aatgtttcattttccacggcc 45
             |||||||||||||||||||||
Sbjct: 77220 aatgtttcattttccacggcc 77240



to top

>emb|BX324188.7| Zebrafish DNA sequence from clone DKEY-85A20 in linkage group 13,
              complete sequence
          Length = 237686

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 160524 atccattcatccatccatcct 160504



to top

>gb|AC153616.8| Mus musculus 6 BAC RP23-328I7 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 195332

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 26698 atccattcatccatccatcct 26718



to top

>gb|AC158807.11| Mus musculus 10 BAC RP24-64G24 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 228073

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 23143 tatgtatatatgcatgtgtgc 23163



to top

>gb|AC008403.8| Homo sapiens chromosome 19 clone CTC-273B12, complete sequence
          Length = 190076

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 131960 atccattcatccatccatcct 131940



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 131792 atccattcatccatccatcc 131773



to top

>gb|AC153613.9| Mus musculus 10 BAC RP23-23C9 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 214432

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 208    ctatgtatatatgcatgtgtg 228
              |||||||||||||||||||||
Sbjct: 113078 ctatgtatatatgcatgtgtg 113098



to top

>gb|AC136601.2| Homo sapiens chromosome 5 clone RP11-1259L22, complete sequence
          Length = 186323

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 98405 aatccattcatccatccatcc 98385



to top

>gb|AC022215.4|AC022215 Homo sapiens BAC clone RP11-764I5 from 3, complete sequence
          Length = 180068

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 93662 aatccattcatccatccatcc 93682



to top

>gb|AC068580.23| Homo sapiens chromosome 11, clone RP11-295K3, complete sequence
          Length = 120298

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 63952 atccattcatccatccatcct 63972



to top

>gb|AC055858.18| Homo sapiens chromosome 17, clone RP11-682M7, complete sequence
          Length = 167395

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 57013 atccattcatccatccatcct 57033



to top

>emb|BX470088.11| Zebrafish DNA sequence from clone DKEY-171E12 in linkage group 7,
             complete sequence
          Length = 102546

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 93408 atccattcatccatccatcct 93428



to top

>emb|BX088561.9| Zebrafish DNA sequence from clone DKEY-257G8 in linkage group 2, complete
              sequence
          Length = 190419

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 153565 aatccattcatccatccatcc 153545



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 184056 atccattcatccatccatcc 184075



to top

>gb|AF191069.1|AF191069 Homo sapiens chromosome 21 clone P704-682K20 map 21q22.1, complete
            sequence
          Length = 108965

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 256  caggggaggaggtgatcctgg 276
            |||||||||||||||||||||
Sbjct: 5472 caggggaggaggtgatcctgg 5492



to top

>gb|AF190641.1|AF190641 Homo sapiens chromosome 21 PAC 704P23131 map 21q22.1, complete sequence
          Length = 89102

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 256   caggggaggaggtgatcctgg 276
             |||||||||||||||||||||
Sbjct: 63991 caggggaggaggtgatcctgg 64011



to top

>gb|AC132145.3| Mus musculus BAC clone RP23-44H21 from chromosome 7, complete sequence
          Length = 162513

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 12521 tatgtatatatgcatgtgtgc 12501



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 131695 atccattcatccatccatcc 131676



to top

>gb|AC142168.3| Mus musculus BAC clone RP24-80B23 from chromosome 9, complete sequence
          Length = 173152

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 142712 aatccattcatccatccatcc 142692



to top

>gb|AC154502.2| Mus musculus BAC clone RP24-87I20 from chromosome 13, complete sequence
          Length = 183319

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 112373 aatccattcatccatccatcc 112393



to top

>emb|BX088724.6| Zebrafish DNA sequence from clone DKEY-15G22, complete sequence
          Length = 198368

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 59608 atccattcatccatccatcct 59588



to top

>gb|AC158669.3| Mus musculus 6 BAC RP23-66K6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 242779

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 132770 atccattcatccatccatcct 132790



to top

>emb|BX004770.12| Zebrafish DNA sequence from clone DKEY-14K21 in linkage group 10,
              complete sequence
          Length = 231131

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 132784 atccattcatccatccatcct 132764



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 133921 atccattcatccatccatcc 133902



to top

>emb|AL928887.13| Zebrafish DNA sequence from clone CH211-136O14 in linkage group 23,
              complete sequence
          Length = 174456

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 147739 aatccattcatccatccatcc 147759



to top

>emb|AL935207.6| Zebrafish DNA sequence from clone CH211-251J8, complete sequence
          Length = 146351

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 54268 atccattcatccatccatcct 54248



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 54155 atccattcatccatccatcc 54136



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 53445 atccattcatccatccatcc 53426



to top

>emb|CR628405.8| Zebrafish DNA sequence from clone CH211-170A5 in linkage group 10,
            complete sequence
          Length = 75121

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 57   aatccattcatccatccatcc 77
            |||||||||||||||||||||
Sbjct: 5961 aatccattcatccatccatcc 5941



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 58   atccattcatccatccatcc 77
            ||||||||||||||||||||
Sbjct: 5458 atccattcatccatccatcc 5439



to top

>emb|CR926459.7| Zebrafish DNA sequence from clone CH211-260O22 in linkage group 20,
             complete sequence
          Length = 132837

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 99078 atccattcatccatccatcct 99058



to top

>emb|CR388128.18| Zebrafish DNA sequence from clone CH211-127B17 in linkage group 18,
              complete sequence
          Length = 180022

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 177317 atccattcatccatccatcct 177297



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 177426 atccattcatccatccatcc 177407



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 153855 atccattcatccatccatcc 153836



to top

>emb|CR381630.12| Zebrafish DNA sequence from clone CH211-234G24 in linkage group 18,
             complete sequence
          Length = 152854

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 77089 aatccattcatccatccatcc 77109



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 108362 atccattcatccatccatcc 108343



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 105969 atccattcatccatccatcc 105950



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 105709 atccattcatccatccatcc 105690



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 105194 atccattcatccatccatcc 105175



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 77029 atccattcatccatccatcc 77048



to top

>emb|BX537249.8| Zebrafish DNA sequence from clone DKEY-77B17 in linkage group 20,
             complete sequence
          Length = 92426

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 53818 aatccattcatccatccatcc 53798



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 49772 atccattcatccatccatcc 49791



to top

>emb|BX088581.11| Zebrafish DNA sequence from clone CH211-209H6 in linkage group 4,
             complete sequence
          Length = 196294

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 66799 atccattcatccatccatcct 66819



to top

>emb|AL954149.19| Zebrafish DNA sequence from clone CH211-146G19 in linkage group 2,
             complete sequence
          Length = 163971

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 56761 aatccattcatccatccatcc 56781



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 54671 aatccattcatccatccatcc 54691



to top

>emb|BX465846.14| Zebrafish DNA sequence from clone CH211-215B21 in linkage group 18,
             complete sequence
          Length = 109342

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 22949 atccattcatccatccatcct 22969



to top

>emb|AL929391.10| Zebrafish DNA sequence from clone CH211-155I14 in linkage group 20,
             complete sequence
          Length = 186458

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 42964 aatccattcatccatccatcc 42944



to top

>emb|BX510325.3| Zebrafish DNA sequence from clone CH211-149A22 in linkage group 19,
             complete sequence
          Length = 147275

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 94979 aatccattcatccatccatcc 94999



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 94911 aatccattcatccatccatcc 94931



to top

>emb|CR855387.11| Zebrafish DNA sequence from clone DKEY-282H22 in linkage group 3,
             complete sequence
          Length = 106466

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 67444 atccattcatccatccatcct 67464



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 67357 atccattcatccatccatcct 67377



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 67500 atccattcatccatccatcc 67519



to top

>emb|BX901971.15| Zebrafish DNA sequence from clone DKEY-256M21 in linkage group 21,
             complete sequence
          Length = 156578

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 42635 atccattcatccatccatcct 42655



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    ttcatccatccatcctacag 82
             ||||||||||||||||||||
Sbjct: 80032 ttcatccatccatcctacag 80051



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 67311 atccattcatccatccatcc 67330



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 67271 atccattcatccatccatcc 67290



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 42830 atccattcatccatccatcc 42849



to top

>gb|AC004114.1|AC004114 Drosophila melanogaster, chromosome X, region 8E3-8E4, P1 clone
             DS05468, complete sequence
          Length = 75307

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 45524 atccattcatccatccatcct 45504



to top

>gb|AF087796.1|AF087796 Oryctolagus cuniculus clone Nb 09-H immunoglobulin heavy chain
           V-D-J region (IgH) gene, partial cds
          Length = 346

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 261 gaggaggtgatcctggtggta 281
           |||||||||||||||||||||
Sbjct: 287 gaggaggtgatcctggtggta 307



to top

>gb|AE003743.3| Drosophila melanogaster chromosome 3R, section 81 of 118 of the complete
              sequence
          Length = 210258

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 25     aatgtttcattttccacggcc 45
              |||||||||||||||||||||
Sbjct: 197975 aatgtttcattttccacggcc 197995



to top

>gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 of 74 of the complete
              sequence
          Length = 288721

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 167058 atccattcatccatccatcct 167078



to top

>dbj|AP001707.1| Homo sapiens genomic DNA, chromosome 21q, section 51/105
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 256   caggggaggaggtgatcctgg 276
             |||||||||||||||||||||
Sbjct: 32052 caggggaggaggtgatcctgg 32072



to top

>emb|AL928980.7| Zebrafish DNA sequence from clone DKEY-77M16 in linkage group 11,
             complete sequence
          Length = 167387

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 84041 aatccattcatccatccatcc 84021



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 117416 atccattcatccatccatcc 117435



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 83696 atccattcatccatccatcc 83677



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 83576 atccattcatccatccatcc 83557



to top

>dbj|AP002754.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-855O10, complete
              sequence
          Length = 185766

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 127642 aatccattcatccatccatcc 127622



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 98144 atccattcatccatccatcc 98125



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 98000 atccattcatccatccatcc 97981



to top

>dbj|AP006199.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-482B5, complete
              sequence
          Length = 188161

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 148580 atccattcatccatccatcct 148600



to top

>dbj|AP006196.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-347H8, complete
             sequence
          Length = 181660

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 22927 atccattcatccatccatcct 22947



to top

>dbj|AP002380.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-467L20, complete
             sequence
          Length = 188788

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 24729 aatccattcatccatccatcc 24709



to top

>gb|AC096628.14| Mus musculus strain C57BL/6J chromosome 13 clone rp23-81n4, complete
             sequence
          Length = 194818

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 71554 tatgtatatatgcatgtgtgc 71534



to top

>gb|AF042806.1|HSSWAP06 Homo sapiens suppressor of white-apricot homolog 2 (SWAP2) gene,
          exon 8
          Length = 884

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 57 aatccattcatccatccatcc 77
          |||||||||||||||||||||
Sbjct: 6  aatccattcatccatccatcc 26



to top

>emb|AL928675.7| Zebrafish DNA sequence from clone DKEY-13B16 in linkage group 5, complete
              sequence
          Length = 191304

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 56     gaatccattcatccatccatc 76
              |||||||||||||||||||||
Sbjct: 106728 gaatccattcatccatccatc 106708



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 56     gaatccattcatccatccatc 76
              |||||||||||||||||||||
Sbjct: 106626 gaatccattcatccatccatc 106606



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 300    acgatctgctcgtcgtcggcg 320
              |||||||||||||||||||||
Sbjct: 685502 acgatctgctcgtcgtcggcg 685482



to top

>gb|AC005760.1|AC005760 Homo sapiens chromosome 19, cosmid R31118, complete sequence
          Length = 39731

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 11046 atccattcatccatccatcct 11066



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 11114 atccattcatccatccatcc 11133



to top

>gb|AC163357.5| Mus musculus BAC clone RP23-3K10 from chromosome 12, complete sequence
          Length = 236266

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 69606 atccattcatccatccatcct 69626



to top

>gb|AC153639.4| Mus musculus 6 BAC RP23-124H2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190211

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 155081 atccattcatccatccatcct 155061



to top

>emb|CR536605.14| Zebrafish DNA sequence from clone DKEY-96K16 in linkage group 9,
             complete sequence
          Length = 72938

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 59    tccattcatccatccatccta 79
             |||||||||||||||||||||
Sbjct: 70346 tccattcatccatccatccta 70366



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 72730 atccattcatccatccatcc 72749



to top

>gb|AC004770.1|AC004770 Homo sapiens chromosome 11, BAC CIT-HSP-311e8 (BC269730) containing the
              hFEN1 gene, complete sequence
          Length = 185035

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 176590 aatccattcatccatccatcc 176610



to top

>emb|AL929086.7| Zebrafish DNA sequence from clone CH211-130K1 in linkage group 3,
            complete sequence
          Length = 174740

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 57   aatccattcatccatccatcc 77
            |||||||||||||||||||||
Sbjct: 4689 aatccattcatccatccatcc 4669



to top

>emb|AL954192.3| Zebrafish DNA sequence from clone CH211-215D15, complete sequence
          Length = 198052

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 139905 atccattcatccatccatcct 139925



to top

>emb|AL669970.10| Human DNA sequence from clone RP11-473E2 on chromosome 9, complete
             sequence
          Length = 169247

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 59098 aatccattcatccatccatcc 59118



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 59535 atccattcatccatccatcc 59554



to top

>gb|AC161459.5| Mus musculus BAC clone RP23-117I19 from chromosome 14, complete
             sequence
          Length = 212988

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 33176 aatccattcatccatccatcc 33196



to top

>emb|AL808103.8| Mouse DNA sequence from clone RP23-301G2 on chromosome 4, complete
             sequence
          Length = 232070

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 209   tatgtatatatgcatgtgtgc 229
             |||||||||||||||||||||
Sbjct: 99574 tatgtatatatgcatgtgtgc 99594



to top

>emb|AL807384.5| Mouse DNA sequence from clone RP23-18F9 on chromosome 2, complete
              sequence
          Length = 218815

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     aatccattcatccatccatcc 77
              |||||||||||||||||||||
Sbjct: 125622 aatccattcatccatccatcc 125602



to top

>emb|AL158219.11| Human DNA sequence from clone RP5-876B19 on chromosome 11, complete
             sequence
          Length = 48412

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 38894 atccattcatccatccatcct 38914



to top

>gb|AC090692.9| Homo sapiens chromosome 11, clone RP11-698N11, complete sequence
          Length = 179494

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 67286 atccattcatccatccatcct 67266



to top

>gb|AC093290.4| Homo sapiens chromosome 5 clone RP11-47L17, complete sequence
          Length = 179443

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    aatccattcatccatccatcc 77
             |||||||||||||||||||||
Sbjct: 38408 aatccattcatccatccatcc 38428



to top

>dbj|AP000390.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region,
             clone:B347N6, complete sequence
          Length = 50188

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 256   caggggaggaggtgatcctgg 276
             |||||||||||||||||||||
Sbjct: 33631 caggggaggaggtgatcctgg 33651



to top

>dbj|AP002529.1| Homo sapiens genomic DNA, chromosome 6q21, anti-oncogene region,
             section 2/4
          Length = 300000

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 58322 atccattcatccatccatcct 58342



to top

>dbj|AB041731.1| Homo sapiens genomic DNA, chromosome 6q21, BAC clone:706L14, complete
              sequence
          Length = 156242

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     atccattcatccatccatcct 78
              |||||||||||||||||||||
Sbjct: 151549 atccattcatccatccatcct 151569



to top

>dbj|AB042031.1| Homo sapiens genomic DNA, chromosome 6q21, BAC clone:515A4, complete
             sequence
          Length = 194732

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    atccattcatccatccatcct 78
             |||||||||||||||||||||
Sbjct: 48247 atccattcatccatccatcct 48267



to top

>gb|AC108402.12| Mus musculus chromosome 3, clone RP24-141M5, complete sequence
          Length = 125057

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 103877 atccattcatccatccatcc 103896



to top

>gb|AC138358.12| Mus musculus chromosome 1, clone RP24-147G10, complete sequence
          Length = 180227

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 78117 atccattcatccatccatcc 78098



to top

>gb|AC117825.9| Mus musculus chromosome 18, clone RP24-80J4, complete sequence
          Length = 198559

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 42679 atccattcatccatccatcc 42698



to top

>gb|AC155072.1| Homo sapiens chromosome 12 clone fa0727, complete sequence
          Length = 32000

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 58   atccattcatccatccatcc 77
            ||||||||||||||||||||
Sbjct: 5666 atccattcatccatccatcc 5647



to top

>gb|AC102176.8| Mus musculus chromosome 15, clone RP23-480E14, complete sequence
          Length = 181577

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 125105 atccattcatccatccatcc 125124



to top

>gb|AC107762.8| Mus musculus chromosome 1, clone RP23-183L12, complete sequence
          Length = 187760

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 39721 atccattcatccatccatcc 39740



to top

>gb|AC137884.9| Mus musculus chromosome 1, clone RP23-152I6, complete sequence
          Length = 194164

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   tatgtatatatgcatgtgtg 228
             ||||||||||||||||||||
Sbjct: 32108 tatgtatatatgcatgtgtg 32089



to top

>gb|AC113013.15| Mus musculus chromosome 7, clone RP23-174K7, complete sequence
          Length = 235823

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 221696 atccattcatccatccatcc 221677



to top

>gb|AC153799.1| Mus musculus  BAC RP23-145M15 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 207598

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 23105 atccattcatccatccatcc 23124



to top

>gb|AC102039.8| Mus musculus chromosome 5, clone RP23-262L7, complete sequence
          Length = 168142

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 121564 atccattcatccatccatcc 121583



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 121448 atccattcatccatccatcc 121467



to top

>gb|AC154808.2| Mus musculus BAC clone RP24-512K19 from chromosome 13, complete sequence
          Length = 187080

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 128239 atccattcatccatccatcc 128220



to top

>gb|AC150385.2| Branchiostoma floridae clone CH302-101G3, complete sequence
          Length = 121661

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 27252 atccattcatccatccatcc 27233



to top

>gb|AC168091.3| Mus musculus BAC clone RP23-163F18 from chromosome 14, complete sequence
          Length = 227936

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 132784 atccattcatccatccatcc 132765



to top

>gb|AC154221.3| Mus musculus BAC clone RP24-373L7 from chromosome 13, complete sequence
          Length = 157332

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 134707 atccattcatccatccatcc 134726



to top

>gb|AC103624.9| Mus musculus chromosome 5, clone RP24-258B22, complete sequence
          Length = 172330

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 59621 atccattcatccatccatcc 59640



to top

>gb|AC101661.7| Mus musculus chromosome 1, clone RP23-26A10, complete sequence
          Length = 228933

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  atccattcatccatccatcc 77
           ||||||||||||||||||||
Sbjct: 573 atccattcatccatccatcc 592



to top

>gb|AC166170.4| Mus musculus BAC clone RP23-174N23 from chromosome 6, complete sequence
          Length = 216743

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    tatgtatatatgcatgtgtg 228
              ||||||||||||||||||||
Sbjct: 123402 tatgtatatatgcatgtgtg 123383



to top

>gb|AC139867.4| Mus musculus BAC clone RP23-430P22 from chromosome 1, complete sequence
          Length = 224730

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 27027 atccattcatccatccatcc 27046



to top

>gb|AC164310.2| Mus musculus BAC clone RP23-139E15 from chromosome 8, complete sequence
          Length = 204269

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 87971 atccattcatccatccatcc 87990



to top

>gb|AC154650.2| Mus musculus BAC clone RP23-162K2 from chromosome 17, complete sequence
          Length = 210417

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   tatgtatatatgcatgtgtg 228
             ||||||||||||||||||||
Sbjct: 20123 tatgtatatatgcatgtgtg 20142



to top

>gb|AC132350.4| Mus musculus BAC clone RP24-95A6 from chromosome 6, complete sequence
          Length = 177167

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    tatgtatatatgcatgtgtg 228
              ||||||||||||||||||||
Sbjct: 128823 tatgtatatatgcatgtgtg 128804



to top

>gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome 17, complete sequence
          Length = 202649

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 185626 atccattcatccatccatcc 185645



to top

>gb|AC160966.2| Mus musculus BAC clone RP24-362F17 from chromosome 9, complete
            sequence
          Length = 129782

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   atccattcatccatccatcc 77
            ||||||||||||||||||||
Sbjct: 5803 atccattcatccatccatcc 5822



to top

>gb|AC166238.7| Mus musculus chromosome 1, clone RP23-469H11, complete sequence
          Length = 181980

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   tatgtatatatgcatgtgtg 228
             ||||||||||||||||||||
Sbjct: 35934 tatgtatatatgcatgtgtg 35953



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   tatgtatatatgcatgtgtg 228
             ||||||||||||||||||||
Sbjct: 35872 tatgtatatatgcatgtgtg 35891



to top

>gb|AC167466.6| Mus musculus chromosome 7, clone RP24-220N8, complete sequence
          Length = 163721

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   tatgtatatatgcatgtgtg 228
             ||||||||||||||||||||
Sbjct: 22778 tatgtatatatgcatgtgtg 22797



to top

>gb|AC166776.6| Mus musculus chromosome 5, clone RP23-24K16, complete sequence
          Length = 216652

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 180579 atccattcatccatccatcc 180560



to top

>gb|AC166047.6| Mus musculus chromosome 18, clone wi1-1600J1, complete sequence
          Length = 42185

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 22491 atccattcatccatccatcc 22472



to top

>gb|AC133489.32| Mus musculus strain C57BL/6J clone rp23-74a5, complete sequence
          Length = 225524

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 121039 atccattcatccatccatcc 121020



to top

>gb|AC102355.13| Mus musculus chromosome 5, clone RP23-120C8, complete sequence
          Length = 194854

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 113059 atccattcatccatccatcc 113078



to top

>gb|AC160860.2| Homo sapiens chromosome 11 clone WI2-3817J24, complete sequence
          Length = 40103

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 22652 atccattcatccatccatcc 22633



to top

>gb|AY790940.1| Homo sapiens insulin-like growth factor 1 (somatomedin C) (IGF1) gene,
             complete cds
          Length = 88577

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 67263 atccattcatccatccatcc 67244



to top

>gb|AY770133.1| Botryotinia fuckeliana strain 610 microsatellite 63R sequence
          Length = 406

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 45 aatccatccatccatccatcctac 68



to top

>gb|AY770111.1| Botryotinia fuckeliana strain 698 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AY770110.1| Botryotinia fuckeliana strain 1259 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AY770109.1| Botryotinia fuckeliana strain 715 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AY770108.1| Botryotinia fuckeliana strain T4 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AY770107.1| Botryotinia fuckeliana strain 32 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AY770106.1| Botryotinia fuckeliana strain 686 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AY770105.1| Botryotinia fuckeliana strain 1771 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AY770104.1| Botryotinia fuckeliana strain 422 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AY770103.1| Botryotinia fuckeliana strain 1750 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AY770102.1| Botryotinia fuckeliana strain 1309 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AY770101.1| Botryotinia fuckeliana strain 1260 microsatellite 63R sequence
          Length = 410

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 57 aatccattcatccatccatcctac 80
          ||||||| ||||||||||||||||
Sbjct: 49 aatccatccatccatccatcctac 72



to top

>gb|AC134409.12| Mus musculus chromosome 5, clone RP24-355F10, complete sequence
          Length = 141528

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 138674 atccattcatccatccatcc 138693



to top

>gb|AC120398.10| Mus musculus chromosome 3, clone RP24-333H9, complete sequence
          Length = 153725

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 90175 atccattcatccatccatcc 90156



to top

>gb|AC119856.13| Mus musculus chromosome 5, clone RP23-256B18, complete sequence
          Length = 218174

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 133385 atccattcatccatccatcc 133404



to top

>gb|AC158974.8| Mus musculus chromosome 15, clone RP24-252G18, complete sequence
          Length = 170539

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 125883 atccattcatccatccatcc 125902



to top

>gb|AC115789.9| Mus musculus chromosome 18, clone RP23-398N2, complete sequence
          Length = 206108

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    tatgtatatatgcatgtgtg 228
              ||||||||||||||||||||
Sbjct: 157393 tatgtatatatgcatgtgtg 157374



to top

>gb|AC161581.3| Mus musculus chromosome 15, clone RP24-75A19, complete sequence
          Length = 210059

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 120951 atccattcatccatccatcc 120932



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 120935 atccattcatccatccatcc 120916



to top

>gb|AC161792.9| Mus musculus chromosome 7, clone RP23-288B12, complete sequence
          Length = 166375

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    acctatgtatatatgcatgt 225
              ||||||||||||||||||||
Sbjct: 120310 acctatgtatatatgcatgt 120329



to top

>gb|AF026276.1| Homo sapiens fast skeletal troponin T (TNNT3) gene, complete cds
          Length = 20369

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 15052 atccattcatccatccatcc 15071



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
               sequence
          Length = 1507550

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 58      atccattcatccatccatcc 77
               ||||||||||||||||||||
Sbjct: 1501789 atccattcatccatccatcc 1501808



to top

>gb|AF052189.1| Homo sapiens short myelin basic protein (MBP) gene, 5' sequence and
           exon 1, partial sequence
          Length = 354

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 58  atccattcatccatccatcc 77
           ||||||||||||||||||||
Sbjct: 304 atccattcatccatccatcc 285



to top

>gb|AY094990.1| Athene cunicularia isolate Buow04 microsatellite sequence
          Length = 394

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  atccattcatccatccatcc 77
           ||||||||||||||||||||
Sbjct: 236 atccattcatccatccatcc 255



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  atccattcatccatccatcc 77
           ||||||||||||||||||||
Sbjct: 200 atccattcatccatccatcc 219



to top

>gb|AF393671.1| Siphateles bicolor obesa isolate G99 microsatellite sequence
          Length = 510

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  atccattcatccatccatcc 77
           ||||||||||||||||||||
Sbjct: 372 atccattcatccatccatcc 391



to top

>gb|AF272364.1|AF272364S1 Mus musculus lysophosphatidic acid receptor (Edg7) gene, exon 2
          Length = 5557

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 58   atccattcatccatccatcc 77
            ||||||||||||||||||||
Sbjct: 2418 atccattcatccatccatcc 2399



to top

>gb|AY602200.1| Mustela vison clone Mvi1012 microsatellite sequences
          Length = 407

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 58  atccattcatccatccatcc 77
           ||||||||||||||||||||
Sbjct: 197 atccattcatccatccatcc 178



to top

>gb|AY263771.1| Seepiophila jonesi clone E2-10B microsatellite sequence
          Length = 816

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 58  atccattcatccatccatcc 77
           ||||||||||||||||||||
Sbjct: 686 atccattcatccatccatcc 705



to top

>gb|AC114640.11| Mus musculus chromosome 17, clone RP24-125I7, complete sequence
          Length = 190102

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   tatgtatatatgcatgtgtg 228
             ||||||||||||||||||||
Sbjct: 55427 tatgtatatatgcatgtgtg 55408



to top

>gb|AC004778.1| Homo sapiens chromosome 16, cosmid clone RT156 (LANL), complete
             sequence
          Length = 30175

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 16072 atccattcatccatccatcc 16053



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 15441 atccattcatccatccatcc 15422



to top

>gb|AC004644.1| Homo sapiens chromosome 16, cosmid clone 367E12 (LANL), complete
             sequence
          Length = 39338

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 27950 atccattcatccatccatcc 27931



to top

>gb|AC118010.11| Mus musculus chromosome 5, clone RP23-451E8, complete sequence
          Length = 184672

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 125460 atccattcatccatccatcc 125441



to top

>gb|AC157211.7| Mus musculus chromosome 1, clone RP23-204C6, complete sequence
          Length = 206840

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 86430 atccattcatccatccatcc 86411



to top

>gb|AC102873.10| Mus musculus chromosome 17, clone RP24-536C15, complete sequence
          Length = 155210

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 77735 atccattcatccatccatcc 77716



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    atccattcatccatccatcc 77
             ||||||||||||||||||||
Sbjct: 77623 atccattcatccatccatcc 77604



to top

>gb|AC160993.5| Mus musculus BAC clone RP23-159D11 from chromosome 16, complete sequence
          Length = 187536

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 164302 atccattcatccatccatcc 164321



to top

>gb|AC119897.8| Mus musculus chromosome 1, clone RP24-227F14, complete sequence
          Length = 195375

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 149145 atccattcatccatccatcc 149126



to top

>gb|AC163329.6| Mus musculus chromosome 5, clone RP24-294K15, complete sequence
          Length = 186890

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 139672 atccattcatccatccatcc 139653



to top

>gb|AC166079.2| Mus musculus BAC clone RP23-51L15 from chromosome 7, complete sequence
          Length = 193749

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     atccattcatccatccatcc 77
              ||||||||||||||||||||
Sbjct: 176598 atccattcatccatccatcc 176617


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,559,502
Number of Sequences: 3902068
Number of extensions: 4559502
Number of successful extensions: 304556
Number of sequences better than 10.0: 2075
Number of HSP's better than 10.0 without gapping: 2076
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 237412
Number of HSP's gapped (non-prelim): 67139
length of query: 468
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 446
effective length of database: 17,147,199,772
effective search space: 7647651098312
effective search space used: 7647651098312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top