ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaet71d09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY589581.1| Triticum aestivum beta-expansin TaEXPB4 mRNA, complete cds Length = 898 Score = 369 bits (186), Expect = 6e-99 Identities = 219/230 (95%) Strand = Plus / Minus Query: 240 ccgaatcaatcagcatcttcgttgatcgatcgggagctccgagcaatcaacggaactgga 299 |||||| ||||| | ||||||| |||||||||| ||||| |||||||||||||||||||| Sbjct: 898 ccgaattaatcaacgtcttcgtcgatcgatcggaagctcggagcaatcaacggaactgga 839 Query: 300 cgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttggccacca 359 ||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 838 cgttggaacggtagttcgtgtcgggcctccagttggccgggatgacttgtttggccacca 779 Query: 360 gcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggcgcctgg 419 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 778 gcgtcttgccggattcgctgcggatgcggagagagaaggggccctgcagccggcgcctgg 719 Query: 420 agtccatccgccagatggcgccccacgaatggcgcatcgccgtccagtac 469 |||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 718 agtccatccgccagatggcgccccacgagtggcgcatcgccgtccagtac 669
>gb|AY589580.1| Triticum aestivum beta-expansin TaEXPB3 mRNA, complete cds Length = 1013 Score = 131 bits (66), Expect = 2e-27 Identities = 147/174 (84%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||| |||| |||| ||||||||||||||||||| | || Sbjct: 853 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 794 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 |||||||||| |||||||||| |||||| |||||| | |||||||| ||||| || || Sbjct: 793 ggccaccagcttcttgccggagtcgctggtgatgcgcatggagaagggcccctggaggcg 734 Query: 412 gcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | | ||||||||||||||||||||| |||||| || | |||||||| |||||| Sbjct: 733 gtggttggagtccatccgccagatggagccccaggactcgcgcatcggcgtcca 680
>gb|AY543541.1| Triticum aestivum expansin EXPB7 mRNA, complete cds Length = 1056 Score = 131 bits (66), Expect = 2e-27 Identities = 147/174 (84%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||| |||| |||| ||||||||||||||||||| | || Sbjct: 885 gaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatgacattgtt 826 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 |||||||||| |||||||||| |||||| |||||| | |||||||| ||||| || || Sbjct: 825 ggccaccagcttcttgccggagtcgctggtgatgcgcatggagaagggcccctggaggcg 766 Query: 412 gcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | | ||||||||||||||||||||| |||||| || | |||||||| |||||| Sbjct: 765 gtggttggagtccatccgccagatggagccccaggactcgcgcatcggcgtcca 712
>ref|NM_197701.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB4 (OSJNBa0010C11.2), mRNA Length = 1340 Score = 107 bits (54), Expect = 3e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| ||||| |||| ||||||||||||||||||| | |||| Sbjct: 960 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 901 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 | || |||||||||||||| ||| |||||||||||| ||||||||| |||| |||| | Sbjct: 900 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 841 Query: 414 gcctggagtccatccgccagatggcgccccacga 447 | ||| ||||| || |||||||| ||||||||| Sbjct: 840 ggttggtgtccagcctccagatggagccccacga 807
>gb|AF261272.1| Oryza sativa beta-expansin (EXPB4) mRNA, complete cds Length = 1249 Score = 107 bits (54), Expect = 3e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| ||||| |||| ||||||||||||||||||| | |||| Sbjct: 916 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 857 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 | || |||||||||||||| ||| |||||||||||| ||||||||| |||| |||| | Sbjct: 856 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 797 Query: 414 gcctggagtccatccgccagatggcgccccacga 447 | ||| ||||| || |||||||| ||||||||| Sbjct: 796 ggttggtgtccagcctccagatggagccccacga 763
>gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 genomic sequence, complete sequence Length = 147117 Score = 107 bits (54), Expect = 3e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| ||||| |||| ||||||||||||||||||| | |||| Sbjct: 16762 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 16703 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 | || |||||||||||||| ||| |||||||||||| ||||||||| |||| |||| | Sbjct: 16702 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 16643 Query: 414 gcctggagtccatccgccagatggcgccccacga 447 | ||| ||||| || |||||||| ||||||||| Sbjct: 16642 ggttggtgtccagcctccagatggagccccacga 16609 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/139 (82%), Gaps = 2/139 (1%) Strand = Plus / Plus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| || |||| || ||| ||||||||| ||| || |||||| Sbjct: 4107 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 4166 Query: 388 gagcgagaaggg-gccctgcagccggcgcctggagtccatccgccagatggcgccccacg 446 |||||||||||| ||| || || ||| | ||||||| | || |||||||| |||||||| Sbjct: 4167 gagcgagaagggcgccgtg-aggcggtggttggagtcgagcctccagatggagccccacg 4225 Query: 447 aatggcgcatcgccgtcca 465 | | |||||||| |||||| Sbjct: 4226 actcgcgcatcggcgtcca 4244
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 107 bits (54), Expect = 3e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| ||||| |||| ||||||||||||||||||| | |||| Sbjct: 21341749 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 21341690 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 | || |||||||||||||| ||| |||||||||||| ||||||||| |||| |||| | Sbjct: 21341689 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 21341630 Query: 414 gcctggagtccatccgccagatggcgccccacga 447 | ||| ||||| || |||||||| ||||||||| Sbjct: 21341629 ggttggtgtccagcctccagatggagccccacga 21341596 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Plus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||||| | || ||| |||||| ||||||||||| | || Sbjct: 21311307 gaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttgtt 21311366 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 ||| || |||||||||||||| ||||||||||||||||| |||||||| |||| || || Sbjct: 21311367 ggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggaggcg 21311426 Query: 412 gcgcctggagtccatccgccagatggcgccccacga 447 | | ||||||| | |||||||||| ||||||||| Sbjct: 21311427 gtggttggagtcgaggcgccagatggagccccacga 21311462 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Plus Query: 285 atcaacggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatga 344 |||||||||||||||| ||||||| |||||| |||| || | |||||||||||||||||| Sbjct: 21317162 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 21317221 Query: 345 cttgtttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccct 404 | || | ||| | | |||| |||||| |||||| |||||||| ||||||||||||| Sbjct: 21317222 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 21317281 Query: 405 g 405 | Sbjct: 21317282 g 21317282 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/139 (82%), Gaps = 2/139 (1%) Strand = Plus / Plus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| || |||| || ||| ||||||||| ||| || |||||| Sbjct: 21329093 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 21329152 Query: 388 gagcgagaaggg-gccctgcagccggcgcctggagtccatccgccagatggcgccccacg 446 |||||||||||| ||| || || ||| | ||||||| | || |||||||| |||||||| Sbjct: 21329153 gagcgagaagggcgccgtg-aggcggtggttggagtcgagcctccagatggagccccacg 21329211 Query: 447 aatggcgcatcgccgtcca 465 | | |||||||| |||||| Sbjct: 21329212 actcgcgcatcggcgtcca 21329230 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgccccacga 447 |||||||| |||||||||||||||||| Sbjct: 20947234 gtccatcctccagatggcgccccacga 20947208
>dbj|AK105981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-F12, full insert sequence Length = 1290 Score = 107 bits (54), Expect = 3e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| ||||| |||| ||||||||||||||||||| | |||| Sbjct: 973 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 914 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 | || |||||||||||||| ||| |||||||||||| ||||||||| |||| |||| | Sbjct: 913 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 854 Query: 414 gcctggagtccatccgccagatggcgccccacga 447 | ||| ||||| || |||||||| ||||||||| Sbjct: 853 ggttggtgtccagcctccagatggagccccacga 820
>dbj|AK103929.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D11, full insert sequence Length = 1266 Score = 107 bits (54), Expect = 3e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| ||||| |||| ||||||||||||||||||| | |||| Sbjct: 966 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 907 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 | || |||||||||||||| ||| |||||||||||| ||||||||| |||| |||| | Sbjct: 906 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 847 Query: 414 gcctggagtccatccgccagatggcgccccacga 447 | ||| ||||| || |||||||| ||||||||| Sbjct: 846 ggttggtgtccagcctccagatggagccccacga 813
>dbj|AK101806.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033066K12, full insert sequence Length = 1883 Score = 107 bits (54), Expect = 3e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| ||||| |||| ||||||||||||||||||| | |||| Sbjct: 1550 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 1491 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 | || |||||||||||||| ||| |||||||||||| ||||||||| |||| |||| | Sbjct: 1490 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 1431 Query: 414 gcctggagtccatccgccagatggcgccccacga 447 | ||| ||||| || |||||||| ||||||||| Sbjct: 1430 ggttggtgtccagcctccagatggagccccacga 1397
>dbj|AK101357.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033035B15, full insert sequence Length = 1475 Score = 107 bits (54), Expect = 3e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| ||||| |||| ||||||||||||||||||| | |||| Sbjct: 1154 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 1095 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 | || |||||||||||||| ||| |||||||||||| ||||||||| |||| |||| | Sbjct: 1094 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 1035 Query: 414 gcctggagtccatccgccagatggcgccccacga 447 | ||| ||||| || |||||||| ||||||||| Sbjct: 1034 ggttggtgtccagcctccagatggagccccacga 1001
>dbj|AK060096.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G02, full insert sequence Length = 1293 Score = 107 bits (54), Expect = 3e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| ||||| |||| ||||||||||||||||||| | |||| Sbjct: 972 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 913 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 | || |||||||||||||| ||| |||||||||||| ||||||||| |||| |||| | Sbjct: 912 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 853 Query: 414 gcctggagtccatccgccagatggcgccccacga 447 | ||| ||||| || |||||||| ||||||||| Sbjct: 852 ggttggtgtccagcctccagatggagccccacga 819
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 107 bits (54), Expect = 3e-20 Identities = 129/154 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| ||||| |||| ||||||||||||||||||| | |||| Sbjct: 21353012 actggacgaaggagcggtagaatgtgttgggcctccagttggccgggatgacgttgttgg 21352953 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 | || |||||||||||||| ||| |||||||||||| ||||||||| |||| |||| | Sbjct: 21352952 cgacgagcgtcttgccggactcgttgcggatgcggatggagaagggggcctggagcctgt 21352893 Query: 414 gcctggagtccatccgccagatggcgccccacga 447 | ||| ||||| || |||||||| ||||||||| Sbjct: 21352892 ggttggtgtccagcctccagatggagccccacga 21352859 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Plus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||||| | || ||| |||||| ||||||||||| | || Sbjct: 21322571 gaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttgtt 21322630 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 ||| || |||||||||||||| ||||||||||||||||| |||||||| |||| || || Sbjct: 21322631 ggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggaggcg 21322690 Query: 412 gcgcctggagtccatccgccagatggcgccccacga 447 | | ||||||| | |||||||||| ||||||||| Sbjct: 21322691 gtggttggagtcgaggcgccagatggagccccacga 21322726 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Plus Query: 285 atcaacggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatga 344 |||||||||||||||| ||||||| |||||| |||| || | |||||||||||||||||| Sbjct: 21328426 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 21328485 Query: 345 cttgtttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccct 404 | || | ||| | | |||| |||||| |||||| |||||||| ||||||||||||| Sbjct: 21328486 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 21328545 Query: 405 g 405 | Sbjct: 21328546 g 21328546 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/139 (82%), Gaps = 2/139 (1%) Strand = Plus / Plus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| || |||| || ||| ||||||||| ||| || |||||| Sbjct: 21340357 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 21340416 Query: 388 gagcgagaaggg-gccctgcagccggcgcctggagtccatccgccagatggcgccccacg 446 |||||||||||| ||| || || ||| | ||||||| | || |||||||| |||||||| Sbjct: 21340417 gagcgagaagggcgccgtg-aggcggtggttggagtcgagcctccagatggagccccacg 21340475 Query: 447 aatggcgcatcgccgtcca 465 | | |||||||| |||||| Sbjct: 21340476 actcgcgcatcggcgtcca 21340494 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgccccacga 447 |||||||| |||||||||||||||||| Sbjct: 20958498 gtccatcctccagatggcgccccacga 20958472
>ref|NM_197698.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB6 (OSJNBb0014I11.3), mRNA Length = 1240 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||||| | || ||| |||||| ||||||||||| | || Sbjct: 918 gaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttgtt 859 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 ||| || |||||||||||||| ||||||||||||||||| |||||||| |||| || || Sbjct: 858 ggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggaggcg 799 Query: 412 gcgcctggagtccatccgccagatggcgccccacga 447 | | ||||||| | |||||||||| ||||||||| Sbjct: 798 gtggttggagtcgaggcgccagatggagccccacga 763
>gb|AF261274.1| Oryza sativa beta-expansin (EXPB6) mRNA, complete cds Length = 1250 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||||| | || ||| |||||| ||||||||||| | || Sbjct: 911 gaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttgtt 852 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 ||| || |||||||||||||| ||||||||||||||||| |||||||| |||| || || Sbjct: 851 ggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggaggcg 792 Query: 412 gcgcctggagtccatccgccagatggcgccccacga 447 | | ||||||| | |||||||||| ||||||||| Sbjct: 791 gtggttggagtcgaggcgccagatggagccccacga 756
>gb|AC037426.12| Oryza sativa chromosome 10 BAC OSJNBb0014I11 genomic sequence, complete sequence Length = 135510 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||||| | || ||| |||||| ||||||||||| | || Sbjct: 23052 gaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttgtt 22993 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 ||| || |||||||||||||| ||||||||||||||||| |||||||| |||| || || Sbjct: 22992 ggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggaggcg 22933 Query: 412 gcgcctggagtccatccgccagatggcgccccacga 447 | | ||||||| | |||||||||| ||||||||| Sbjct: 22932 gtggttggagtcgaggcgccagatggagccccacga 22897 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 285 atcaacggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatga 344 |||||||||||||||| ||||||| |||||| |||| || | |||||||||||||||||| Sbjct: 17197 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 17138 Query: 345 cttgtttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccct 404 | || | ||| | | |||| |||||| |||||| |||||||| ||||||||||||| Sbjct: 17137 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 17078 Query: 405 g 405 | Sbjct: 17077 g 17077 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/139 (82%), Gaps = 2/139 (1%) Strand = Plus / Minus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| || |||| || ||| ||||||||| ||| || |||||| Sbjct: 5266 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 5207 Query: 388 gagcgagaaggg-gccctgcagccggcgcctggagtccatccgccagatggcgccccacg 446 |||||||||||| ||| || || ||| | ||||||| | || |||||||| |||||||| Sbjct: 5206 gagcgagaagggcgccgtg-aggcggtggttggagtcgagcctccagatggagccccacg 5148 Query: 447 aatggcgcatcgccgtcca 465 | | |||||||| |||||| Sbjct: 5147 actcgcgcatcggcgtcca 5129
>dbj|AK105799.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A09, full insert sequence Length = 1257 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||||| | || ||| |||||| ||||||||||| | || Sbjct: 931 gaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttgtt 872 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 ||| || |||||||||||||| ||||||||||||||||| |||||||| |||| || || Sbjct: 871 ggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggaggcg 812 Query: 412 gcgcctggagtccatccgccagatggcgccccacga 447 | | ||||||| | |||||||||| ||||||||| Sbjct: 811 gtggttggagtcgaggcgccagatggagccccacga 776
>dbj|AK104197.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-A02, full insert sequence Length = 1257 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||||| | || ||| |||||| ||||||||||| | || Sbjct: 931 gaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttgtt 872 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 ||| || |||||||||||||| ||||||||||||||||| |||||||| |||| || || Sbjct: 871 ggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggaggcg 812 Query: 412 gcgcctggagtccatccgccagatggcgccccacga 447 | | ||||||| | |||||||||| ||||||||| Sbjct: 811 gtggttggagtcgaggcgccagatggagccccacga 776
>dbj|AK101728.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033061F13, full insert sequence Length = 1263 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||||| | || ||| |||||| ||||||||||| | || Sbjct: 937 gaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttgtt 878 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 ||| || |||||||||||||| ||||||||||||||||| |||||||| |||| || || Sbjct: 877 ggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggaggcg 818 Query: 412 gcgcctggagtccatccgccagatggcgccccacga 447 | | ||||||| | |||||||||| ||||||||| Sbjct: 817 gtggttggagtcgaggcgccagatggagccccacga 782
>dbj|AK061498.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-D06, full insert sequence Length = 1259 Score = 103 bits (52), Expect = 5e-19 Identities = 130/156 (83%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| ||||||||||||| | || ||| |||||| ||||||||||| | || Sbjct: 931 gaactggacgatggagcggtagttggagttgggggaccagttcgccgggatgacgttgtt 872 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 ||| || |||||||||||||| ||||||||||||||||| |||||||| |||| || || Sbjct: 871 ggcgacgagcgtcttgccggagtcgctgcggatgcggagggagaagggcgcctggaggcg 812 Query: 412 gcgcctggagtccatccgccagatggcgccccacga 447 | | ||||||| | |||||||||| ||||||||| Sbjct: 811 gtggttggagtcgaggcgccagatggagccccacga 776
>gb|AY543536.1| Triticum aestivum expansin EXPB1 mRNA, complete cds Length = 810 Score = 87.7 bits (44), Expect = 3e-14 Identities = 140/172 (81%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| ||||||||||| ||| |||| |||||||||||||||||| | | || Sbjct: 797 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 738 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 ||||||||||||||||||| ||| || |||||| | |||||||| |||| || ||| Sbjct: 737 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 678 Query: 414 gcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | | |||||||| ||||||||||| |||||||| | |||||||| |||||| Sbjct: 677 ggccggagtccagccgccagatggatccccacgactcgcgcatcggcgtcca 626
>dbj|AK064012.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-H01, full insert sequence Length = 1794 Score = 85.7 bits (43), Expect = 1e-13 Identities = 106/127 (83%) Strand = Plus / Minus Query: 321 cgggcttccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgc 380 ||||| |||||| |||||||||||| | ||||| || |||||||||||||| ||| ||| Sbjct: 945 cgggcctccagtaggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgc 886 Query: 381 ggatgcggagcgagaaggggccctgcagccggcgcctggagtccatccgccagatggcgc 440 ||||||||| ||||||||| |||| |||| | | ||| ||||| || |||||||| || Sbjct: 885 ggatgcggatggagaagggggcctggagcctgtggttggtgtccagcctccagatggagc 826 Query: 441 cccacga 447 ||||||| Sbjct: 825 cccacga 819
>gb|AY543537.1| Triticum aestivum expansin EXPB2 mRNA, complete cds Length = 948 Score = 83.8 bits (42), Expect = 5e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| |||| |||| ||||||||||||||||||| | |||| Sbjct: 873 actggacgaaggagcggtagaaggtgttgggcctccagttggccgggatgaccttgttgg 814 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggg 399 | || |||||||||||||| ||| |||||||||||| |||||||| Sbjct: 813 cgacgagcgtcttgccggactcgttgcggatgcggatggagaaggg 768
>ref|NM_197699.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB2 (OSJNBb0014I11.2), mRNA Length = 1262 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 285 atcaacggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatga 344 |||||||||||||||| ||||||| |||||| |||| || | |||||||||||||||||| Sbjct: 856 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 797 Query: 345 cttgtttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccct 404 | || | ||| | | |||| |||||| |||||| |||||||| ||||||||||||| Sbjct: 796 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 737 Query: 405 g 405 | Sbjct: 736 g 736
>dbj|AK104128.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-F04, full insert sequence Length = 1043 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 285 atcaacggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatga 344 |||||||||||||||| ||||||| |||||| |||| || | |||||||||||||||||| Sbjct: 855 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 796 Query: 345 cttgtttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccct 404 | || | ||| | | |||| |||||| |||||| |||||||| ||||||||||||| Sbjct: 795 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 736 Query: 405 g 405 | Sbjct: 735 g 735
>dbj|AK061068.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-206-C01, full insert sequence Length = 1259 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 285 atcaacggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatga 344 |||||||||||||||| ||||||| |||||| |||| || | |||||||||||||||||| Sbjct: 853 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 794 Query: 345 cttgtttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccct 404 | || | ||| | | |||| |||||| |||||| |||||||| ||||||||||||| Sbjct: 793 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 734 Query: 405 g 405 | Sbjct: 733 g 733
>dbj|AK058895.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F11, full insert sequence Length = 1026 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 285 atcaacggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatga 344 |||||||||||||||| ||||||| |||||| |||| || | |||||||||||||||||| Sbjct: 846 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 787 Query: 345 cttgtttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccct 404 | || | ||| | | |||| |||||| |||||| |||||||| ||||||||||||| Sbjct: 786 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggagaaggggccct 727 Query: 405 g 405 | Sbjct: 726 g 726
>gb|AY589579.1| Triticum aestivum beta-expansin TaEXPB2 mRNA, complete cds Length = 897 Score = 79.8 bits (40), Expect = 7e-12 Identities = 139/172 (80%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| ||||||||||| ||| |||| |||||||||||||||||| | | || Sbjct: 824 actggacgatggagcggtagaaggtgctgggcgcccagttggccgggatgaccttgtcgg 765 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggc 413 ||||||||||||||||||| ||| || |||||| | |||||||| |||| || ||| Sbjct: 764 ccaccagcgtcttgccggactcgttggtgatgcgcatggagaagggcgcctggaggcggt 705 Query: 414 gcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | | |||||| | ||||||||||| |||||| || | |||||||| |||||| Sbjct: 704 ggccggagtcgagccgccagatggagccccatgactcgcgcatcggcgtcca 653
>gb|DQ428284.1| Sorghum propinquum locus PRC0324 genomic sequence Length = 477 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428283.1| Sorghum bicolor voucher PI585454 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428282.1| Sorghum bicolor voucher PI267539 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428281.1| Sorghum bicolor voucher PI267408 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428280.1| Sorghum bicolor voucher PI221607 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428279.1| Sorghum bicolor voucher PI152702 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428278.1| Sorghum bicolor voucher NSL92371 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428277.1| Sorghum bicolor voucher NSL87902 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428276.1| Sorghum bicolor voucher NSL87666 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428275.1| Sorghum bicolor voucher NSL77217 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428274.1| Sorghum bicolor voucher NSL77034 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428273.1| Sorghum bicolor voucher NSL56174 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428272.1| Sorghum bicolor voucher NSL56003 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428271.1| Sorghum bicolor voucher NSL55243 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428270.1| Sorghum bicolor voucher NSL51365 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428269.1| Sorghum bicolor voucher NSL51030 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428268.1| Sorghum bicolor voucher NSL50875 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|DQ428267.1| Sorghum bicolor voucher BTx623 locus PRC0324 genomic sequence Length = 467 Score = 77.8 bits (39), Expect = 3e-11 Identities = 141/175 (80%) Strand = Plus / Minus Query: 291 ggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtt 350 ||||||||||||||||| |||||| || ||||||||||||||||||||||| | Sbjct: 311 ggaactggacgttggaggggtagtcggtcatcggcttccagttggccgggatgacgttgc 252 Query: 351 tggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagcc 410 |||||||||||||||||||||| || | || | ||| ||||||||||| |||||| Sbjct: 251 tggccaccagcgtcttgccggagccgttccgaacgcgcagcgagaagggcggctgcaggg 192 Query: 411 ggcgcctggagtccatccgccagatggcgccccacgaatggcgcatcgccgtcca 465 | ||| ||| ||| | ||||||| |||||||||||| |||||||| |||||| Sbjct: 191 gccgcttggtgtcgaggcgccagacggcgccccacgacacgcgcatcggcgtcca 137
>gb|U95968.1|OSU95968 Oryza sativa beta-expansin (EXPB2) mRNA, complete cds Length = 999 Score = 77.8 bits (39), Expect = 3e-11 Identities = 100/121 (82%) Strand = Plus / Minus Query: 285 atcaacggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatga 344 |||||||||||||||| ||||||| |||||| |||| || | |||||||||||||||||| Sbjct: 856 atcaacggaactggactttggagccgtagttggtgttggccctccagttggccgggatga 797 Query: 345 cttgtttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccct 404 | || | ||| | | |||| |||||| |||||| |||||||| || |||||||||| Sbjct: 796 cctggtgggcgatgacggtctggccggactcgctgaccatgcggagggakaaggggccct 737 Query: 405 g 405 | Sbjct: 736 g 736
>gb|AY589582.1| Triticum aestivum beta-expansin TaEXPB5 mRNA, complete cds Length = 939 Score = 77.8 bits (39), Expect = 3e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 350 ttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagc 409 ||||||||||||||||| |||| |||||| |||||||| | ||| || ||||||||| Sbjct: 796 ttggccaccagcgtctttccggtatcgctggtgatgcggatggcgaatggcccctgcagc 737 Query: 410 cggcgcctggagtccatccgccagatggcgccccacgaatggcgcat 456 |||| ||| ||||||||||||||||| ||||||||| ||||||| Sbjct: 736 gggcggttggtgtccatccgccagatggagccccacgagcggcgcat 690
>gb|AY543544.1| Triticum aestivum expansin EXPB10 mRNA, complete cds Length = 1132 Score = 77.8 bits (39), Expect = 3e-11 Identities = 90/107 (84%) Strand = Plus / Minus Query: 350 ttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagc 409 ||||||||||||||||| |||| |||||| |||||||| | ||| || ||||||||| Sbjct: 771 ttggccaccagcgtctttccggtatcgctggtgatgcggatggcgaatggcccctgcagc 712 Query: 410 cggcgcctggagtccatccgccagatggcgccccacgaatggcgcat 456 |||| ||| ||||||||||||||||| ||||||||| ||||||| Sbjct: 711 gggcggttggtgtccatccgccagatggagccccacgagcggcgcat 665
>gb|AY543542.1| Triticum aestivum expansin EXPB8 mRNA, complete cds Length = 1078 Score = 77.8 bits (39), Expect = 3e-11 Identities = 87/103 (84%) Strand = Plus / Minus Query: 335 gccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcggagcgag 394 ||||||||||| | |||||||| |||||||| ||||| |||||| ||| || | ||| Sbjct: 794 gccgggatgacattgttggccacaagcgtcttcccggagtcgctggtgatacgcatggag 735 Query: 395 aaggggccctgcagccggcgcctggagtccatccgccagatgg 437 ||||| ||||||||| |||| |||| ||||||||||||||||| Sbjct: 734 aagggcccctgcagcgggcggctggtgtccatccgccagatgg 692
>gb|BT017478.1| Zea mays clone EL01N0408G02.c mRNA sequence Length = 832 Score = 75.8 bits (38), Expect = 1e-10 Identities = 113/138 (81%) Strand = Plus / Minus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| | ||||| || |||||||||||||| ||| |||||||||| Sbjct: 263 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 204 Query: 388 gagcgagaaggggccctgcagccggcgcctggagtccatccgccagatggcgccccacga 447 || |||||||| ||||| ||| | ||| |||||| ||||||| || |||||| || Sbjct: 203 gatggagaagggcggctgcatgcggtggttggtgtccatgcgccagacggagccccagga 144 Query: 448 atggcgcatcgccgtcca 465 | |||||||| |||||| Sbjct: 143 ctcgcgcatcggcgtcca 126
>gb|AF332181.1|AF332181 Zea mays beta-expansin 8 (expB8) mRNA, complete cds Length = 1479 Score = 75.8 bits (38), Expect = 1e-10 Identities = 113/138 (81%) Strand = Plus / Minus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| | ||||| || |||||||||||||| ||| |||||||||| Sbjct: 899 ccagttggccgggatgacgttgttggcgacgagcgtcttgccggactcgttgcggatgcg 840 Query: 388 gagcgagaaggggccctgcagccggcgcctggagtccatccgccagatggcgccccacga 447 || |||||||| ||||| ||| | ||| |||||| ||||||| || |||||| || Sbjct: 839 gatggagaagggcggctgcatgcggtggttggtgtccatgcgccagacggagccccagga 780 Query: 448 atggcgcatcgccgtcca 465 | |||||||| |||||| Sbjct: 779 ctcgcgcatcggcgtcca 762
>gb|AF332175.1|AF332175 Zea mays beta-expansin 2 (expB2) mRNA, partial cds Length = 907 Score = 75.8 bits (38), Expect = 1e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| |||||||||| |||| |||| ||||||||||||||||||| | ||| Sbjct: 520 actggacgaaggagcggtagaaggtgttgggcctccagttggccgggatgacgttcctgg 461 Query: 354 ccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggg 399 | || |||||||||||||| ||| |||||||||||| |||||||| Sbjct: 460 cgacgagcgtcttgccggactcgttgcggatgcggatggagaaggg 415
>gb|AY692478.1| Triticum aestivum beta-expansin EXPB6 mRNA, partial cds Length = 671 Score = 73.8 bits (37), Expect = 5e-10 Identities = 102/125 (81%) Strand = Plus / Minus Query: 323 ggcttccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcgg 382 |||| ||||| ||| |||||||| |||| ||| | |||||||||||||| ||| || Sbjct: 331 ggctcccagtcggcggggatgacctgttcggcggcgagcgtcttgccggactcgttggtk 272 Query: 383 atgcggagcgagaaggggccctgcagccggcgcctggagtccatccgccagatggcgccc 442 |||| ||||||||||||||||||| |||||| | ||||||||||||||||| ||| Sbjct: 271 atgcscagcgagaaggggccctgcatggggcgccgcgtgtccatccgccagatggamccc 212 Query: 443 cacga 447 ||||| Sbjct: 211 cacga 207
>gb|AY111405.1| Zea mays CL5426_1 mRNA sequence Length = 528 Score = 73.8 bits (37), Expect = 5e-10 Identities = 43/45 (95%) Strand = Plus / Plus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccgga 372 |||||||||||||||||| || ||||||||||||||||||||||| Sbjct: 299 ccagttggccgggatgacctggttggccaccagcgtcttgccgga 343
>emb|AJ295941.1|FPR295941 Festuca pratensis mRNA for beta expansin B2 (expB2 gene) Length = 1194 Score = 71.9 bits (36), Expect = 2e-09 Identities = 132/164 (80%) Strand = Plus / Minus Query: 284 aatcaacggaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatg 343 ||||||| |||||||||| ||||||||||| |||| |||| ||||||||||||||||| Sbjct: 894 aatcaactgaactggacgaaggagcggtagtcggtgttgggcctccagttggccgggatg 835 Query: 344 acttgtttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccc 403 | | ||||| || ||| ||||||||| |||||| |||||| | ||||| || || Sbjct: 834 atgttgttggcgacgagctgcttgccggagtcgctggtgatgcgcatggagaatggcgcc 775 Query: 404 tgcagccggcgcctggagtccatccgccagatggcgccccacga 447 || || ||| | |||||||||||| |||||||| |||||||| Sbjct: 774 tggagacggtggttggagtccatcctccagatggatccccacga 731
>gb|BT019137.1| Zea mays clone Contig781.F mRNA sequence Length = 1044 Score = 67.9 bits (34), Expect = 3e-08 Identities = 112/138 (81%) Strand = Plus / Minus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| | ||||| || ||||||||| |||| ||| |||||||||| Sbjct: 524 ccagttggccgggatgacgttgttggcgacgagcgtcttggcggactcgttgcggatgcg 465 Query: 388 gagcgagaaggggccctgcagccggcgcctggagtccatccgccagatggcgccccacga 447 || |||||||| ||||| ||| | ||| |||||| ||||||| || |||||| || Sbjct: 464 gatggagaagggcggctgcatgcggtggttggtgtccatgcgccagacggagccccagga 405 Query: 448 atggcgcatcgccgtcca 465 | |||||||| |||||| Sbjct: 404 ctcgcgcatcggcgtcca 387
>gb|AF332176.1|AF332176 Zea mays beta-expansin 3 (expB3) mRNA, partial cds Length = 788 Score = 65.9 bits (33), Expect = 1e-07 Identities = 123/153 (80%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| |||||| |||| ||||||||| ||||| ||||| ||||| || | Sbjct: 646 gaactggacgatggagctgtagacgttgtcgggctgccagtctgccggaatgacctggtc 587 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccg 411 |||||||||||||||||||| ||| || || ||| ||||||||||| || |||||| | Sbjct: 586 cgccaccagcgtcttgccggactcgttggtgacgcgcagcgagaagggcccttgcagcgg 527 Query: 412 gcgcctggagtccatccgccagatggcgcccca 444 || | || |||||||| ||| |||| |||||| Sbjct: 526 ccggcgggtgtccatcctccatatggagcccca 494
>ref|NM_197700.1| Oryza sativa (japonica cultivar-group) beta-expansin EXPB3 (OSJNBb0014I11.1), mRNA Length = 904 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/139 (82%), Gaps = 2/139 (1%) Strand = Plus / Minus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| || |||| || ||| ||||||||| ||| || |||||| Sbjct: 859 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 800 Query: 388 gagcgagaaggg-gccctgcagccggcgcctggagtccatccgccagatggcgccccacg 446 |||||||||||| ||| || || ||| | ||||||| | || |||||||| |||||||| Sbjct: 799 gagcgagaagggcgccgtg-aggcggtggttggagtcgagcctccagatggagccccacg 741 Query: 447 aatggcgcatcgccgtcca 465 | | |||||||| |||||| Sbjct: 740 actcgcgcatcggcgtcca 722
>gb|AF261271.1| Oryza sativa beta-expansin (EXPB3) mRNA, complete cds Length = 1319 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/139 (82%), Gaps = 2/139 (1%) Strand = Plus / Minus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| || |||| || ||| ||||||||| ||| || |||||| Sbjct: 858 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 799 Query: 388 gagcgagaaggg-gccctgcagccggcgcctggagtccatccgccagatggcgccccacg 446 |||||||||||| ||| || || ||| | ||||||| | || |||||||| |||||||| Sbjct: 798 gagcgagaagggcgccgtg-aggcggtggttggagtcgagcctccagatggagccccacg 740 Query: 447 aatggcgcatcgccgtcca 465 | | |||||||| |||||| Sbjct: 739 actcgcgcatcggcgtcca 721
>dbj|AK105318.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-F11, full insert sequence Length = 1031 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/139 (82%), Gaps = 2/139 (1%) Strand = Plus / Minus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| || |||| || ||| ||||||||| ||| || |||||| Sbjct: 614 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 555 Query: 388 gagcgagaaggg-gccctgcagccggcgcctggagtccatccgccagatggcgccccacg 446 |||||||||||| ||| || || ||| | ||||||| | || |||||||| |||||||| Sbjct: 554 gagcgagaagggcgccgtg-aggcggtggttggagtcgagcctccagatggagccccacg 496 Query: 447 aatggcgcatcgccgtcca 465 | | |||||||| |||||| Sbjct: 495 actcgcgcatcggcgtcca 477
>dbj|AK100959.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023140O05, full insert sequence Length = 1313 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/139 (82%), Gaps = 2/139 (1%) Strand = Plus / Minus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| || |||| || ||| ||||||||| ||| || |||||| Sbjct: 870 ccagttggccgggatgacctggctggcgacgagctgcttgccggactcgttggtgatgcg 811 Query: 388 gagcgagaaggg-gccctgcagccggcgcctggagtccatccgccagatggcgccccacg 446 |||||||||||| ||| || || ||| | ||||||| | || |||||||| |||||||| Sbjct: 810 gagcgagaagggcgccgtg-aggcggtggttggagtcgagcctccagatggagccccacg 752 Query: 447 aatggcgcatcgccgtcca 465 | | |||||||| |||||| Sbjct: 751 actcgcgcatcggcgtcca 733
>gb|U91981.1|TAU91981 Triticum aestivum pollen allergen homolog mRNA, complete cds Length = 1232 Score = 61.9 bits (31), Expect = 2e-06 Identities = 88/107 (82%) Strand = Plus / Minus Query: 350 ttggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagc 409 ||||| ||||||||||| |||| |||||| |||||||| ||||| || ||||||| | Sbjct: 801 ttggcgaccagcgtctttccggtatcgctggtgatgcggatggagaatggcccctgcacc 742 Query: 410 cggcgcctggagtccatccgccagatggcgccccacgaatggcgcat 456 |||| ||| |||||||||||||| || ||||||||| ||||||| Sbjct: 741 gggcggttggtgtccatccgccagacggagccccacgagcggcgcat 695
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 60.0 bits (30), Expect = 7e-06 Identities = 96/118 (81%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| |||||| |||| |||| ||||| ||||| ||| |||||||| || | Sbjct: 169424 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 169365 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagc 409 ||| | || ||||||||||| ||| || ||||||||| |||||||| ||||||||| Sbjct: 169364 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagc 169307 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 353 gccaccagcgtcttgccggattcgctgcggatgcgga 389 ||||||| |||||||||||| ||||| |||||||||| Sbjct: 157727 gccaccaacgtcttgccggagtcgctccggatgcgga 157763
>gb|AC118673.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0080O10, from chromosome 3, complete sequence Length = 127917 Score = 60.0 bits (30), Expect = 7e-06 Identities = 96/118 (81%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| |||||| |||| |||| ||||| ||||| ||| |||||||| || | Sbjct: 6491 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 6432 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagc 409 ||| | || ||||||||||| ||| || ||||||||| |||||||| ||||||||| Sbjct: 6431 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagc 6374
>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNAb0079B22, from chromosome 3, complete sequence Length = 156933 Score = 60.0 bits (30), Expect = 7e-06 Identities = 96/118 (81%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| |||||| |||| |||| ||||| ||||| ||| |||||||| || | Sbjct: 103424 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 103365 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagc 409 ||| | || ||||||||||| ||| || ||||||||| |||||||| ||||||||| Sbjct: 103364 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagc 103307 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 353 gccaccagcgtcttgccggattcgctgcggatgcgga 389 ||||||| |||||||||||| ||||| |||||||||| Sbjct: 91727 gccaccaacgtcttgccggagtcgctccggatgcgga 91763
>gb|AF332178.1|AF332178 Zea mays beta-expansin 5 (expB5) mRNA, partial cds Length = 650 Score = 60.0 bits (30), Expect = 7e-06 Identities = 132/166 (79%) Strand = Plus / Minus Query: 303 tggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttggccaccagcg 362 |||||||||||| |||| |||| ||||||||| |||||||| | ||||||||||| Sbjct: 518 tggagcggtagtaggtgttgggcgcccagttggcagggatgacccgagtggccaccagct 459 Query: 363 tcttgccggattcgctgcggatgcggagcgagaaggggccctgcagccggcgcctggagt 422 || ||||||| ||| || || ||| ||||||||||| |||| |||| | | ||| || Sbjct: 458 tcctgccggactcgttggtgacgcgcagcgagaagggcgcctgtagcctgtggttggcgt 399 Query: 423 ccatccgccagatggcgccccacgaatggcgcatcgccgtccagta 468 ||| || |||||||| ||||| || | |||||||| ||||||||| Sbjct: 398 ccagcctccagatggacccccaggactcgcgcatcggcgtccagta 353
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 60.0 bits (30), Expect = 7e-06 Identities = 96/118 (81%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| |||||| |||| |||| ||||| ||||| ||| |||||||| || | Sbjct: 169424 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 169365 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagc 409 ||| | || ||||||||||| ||| || ||||||||| |||||||| ||||||||| Sbjct: 169364 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagc 169307 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 353 gccaccagcgtcttgccggattcgctgcggatgcgga 389 ||||||| |||||||||||| ||||| |||||||||| Sbjct: 157727 gccaccaacgtcttgccggagtcgctccggatgcgga 157763
>gb|AF485811.1| Oryza sativa BAC OSJNa0049F05, complete sequence Length = 162241 Score = 60.0 bits (30), Expect = 7e-06 Identities = 96/118 (81%) Strand = Plus / Plus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| |||||| |||| |||| ||||| ||||| ||| |||||||| || | Sbjct: 93242 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 93301 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagc 409 ||| | || ||||||||||| ||| || ||||||||| |||||||| ||||||||| Sbjct: 93302 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagc 93359 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 353 gccaccagcgtcttgccggattcgctgcggatgcgga 389 ||||||| |||||||||||| ||||| |||||||||| Sbjct: 104939 gccaccaacgtcttgccggagtcgctccggatgcgga 104903
>dbj|AK061423.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-G02, full insert sequence Length = 1027 Score = 60.0 bits (30), Expect = 7e-06 Identities = 96/118 (81%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| |||||| |||| |||| ||||| ||||| ||| |||||||| || | Sbjct: 836 gaactggacgatggagctgtagacggtgttgggctgccagtcggcggggatgacctgatc 777 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagc 409 ||| | || ||||||||||| ||| || ||||||||| |||||||| ||||||||| Sbjct: 776 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagc 719
>gb|AY543538.1| Triticum aestivum expansin EXPB3 mRNA, complete cds Length = 834 Score = 60.0 bits (30), Expect = 7e-06 Identities = 111/138 (80%) Strand = Plus / Minus Query: 328 ccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcg 387 |||||||||||||||||| | | ||||||||||| ||||||||| ||| || |||||| Sbjct: 769 ccagttggccgggatgaccttgtcggccaccagcgacttgccggactcgttggtgatgcg 710 Query: 388 gagcgagaaggggccctgcagccggcgcctggagtccatccgccagatggcgccccacga 447 | |||||||| |||| || ||| | | ||||| | ||||||||||| |||||| || Sbjct: 709 catggagaagggcgcctggaggcggtggccagagtcgagccgccagatggagccccatga 650 Query: 448 atggcgcatcgccgtcca 465 | |||||||| |||||| Sbjct: 649 ctcgcgcatcggcgtcca 632
>gb|AF261275.1| Oryza sativa beta-expansin (EXPB7) mRNA, complete cds Length = 1210 Score = 56.0 bits (28), Expect = 1e-04 Identities = 95/118 (80%) Strand = Plus / Minus Query: 292 gaactggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgttt 351 |||||||||| |||||| ||| |||| ||||| ||||| ||| |||||||| || | Sbjct: 1028 gaactggacgatggagctgtaracggtgttgggctgccagtcggcggggatgacctgatc 969 Query: 352 ggccaccagcgtcttgccggattcgctgcggatgcggagcgagaaggggccctgcagc 409 ||| | || ||||||||||| ||| || ||||||||| |||||||| ||||||||| Sbjct: 968 ggcgatgagggtcttgccggactcgttggtgatgcggagggagaagggcccctgcagc 911
>gb|AY533103.1| Triticum aestivum beta-expansin 1 (EXPB1) gene, complete cds Length = 1149 Score = 56.0 bits (28), Expect = 1e-04 Identities = 73/88 (82%) Strand = Plus / Minus Query: 317 gtgtcgggcttccagttggccgggatgacttgtttggccaccagcgtcttgccggattcg 376 ||||||| |||||||||||| |||||||| | ||||| | ||| |||||||||| ||| Sbjct: 1107 gtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgccggactcg 1048 Query: 377 ctgcggatgcggagcgagaaggggccct 404 ||| || ||||| ||||||||||||| Sbjct: 1047 ctggtgacgcggatggagaaggggccct 1020
>gb|AY533101.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, complete cds Length = 1111 Score = 56.0 bits (28), Expect = 1e-04 Identities = 73/88 (82%) Strand = Plus / Minus Query: 317 gtgtcgggcttccagttggccgggatgacttgtttggccaccagcgtcttgccggattcg 376 ||||||| |||||||||||| |||||||| | ||||| | ||| |||||||||| ||| Sbjct: 823 gtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgccggactcg 764 Query: 377 ctgcggatgcggagcgagaaggggccct 404 ||| || ||||| ||||||||||||| Sbjct: 763 ctggtgacgcggatggagaaggggccct 736
>gb|AY533100.1| Triticum aestivum beta-expansin 1 (EXPB1) mRNA, partial cds Length = 496 Score = 56.0 bits (28), Expect = 1e-04 Identities = 73/88 (82%) Strand = Plus / Minus Query: 317 gtgtcgggcttccagttggccgggatgacttgtttggccaccagcgtcttgccggattcg 376 ||||||| |||||||||||| |||||||| | ||||| | ||| |||||||||| ||| Sbjct: 283 gtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgccggactcg 224 Query: 377 ctgcggatgcggagcgagaaggggccct 404 ||| || ||||| ||||||||||||| Sbjct: 223 ctggtgacgcggatggagaaggggccct 196
>gb|AF332180.1|AF332180 Zea mays beta-expansin 7 (expB7) mRNA, complete cds Length = 1173 Score = 54.0 bits (27), Expect = 4e-04 Identities = 66/79 (83%) Strand = Plus / Minus Query: 294 actggacgttggagcggtagtttgtgtcgggcttccagttggccgggatgacttgtttgg 353 |||||||| | || ||||||| |||| |||| ||||||||| |||||||| || | | Sbjct: 866 actggacgatagaacggtagtaggtgttgggcacccagttggcggggatgacatggtcag 807 Query: 354 ccaccagcgtcttgccgga 372 ||||||||||||||||||| Sbjct: 806 ccaccagcgtcttgccgga 788
>gb|AF261276.2| Oryza sativa beta-expansin (EXPB8) mRNA, partial cds Length = 933 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 353 gccaccagcgtcttgccggattcgctgcggatgcgga 389 ||||||| |||||||||||| ||||| |||||||||| Sbjct: 746 gccaccaacgtcttgccggagtcgctccggatgcgga 710
>dbj|AK070972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023069H18, full insert sequence Length = 1019 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 353 gccaccagcgtcttgccggattcgctgcggatgcgga 389 ||||||| |||||||||||| ||||| |||||||||| Sbjct: 828 gccaccaacgtcttgccggagtcgctccggatgcgga 792
>gb|AY533104.1| Triticum aestivum beta-expansin 2 (EXPB2) gene, complete cds Length = 1216 Score = 48.1 bits (24), Expect = 0.026 Identities = 69/84 (82%) Strand = Plus / Minus Query: 317 gtgtcgggcttccagttggccgggatgacttgtttggccaccagcgtcttgccggattcg 376 ||||||| |||||||||||| |||||||| | ||||| | ||| |||||||||| ||| Sbjct: 1028 gtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgccggactcg 969 Query: 377 ctgcggatgcggagcgagaagggg 400 ||| || ||||| ||||||||| Sbjct: 968 ctggtgacgcggatggagaagggg 945
>gb|AY533102.1| Triticum aestivum beta-expansin 2 (EXPB2) mRNA, complete cds Length = 1068 Score = 48.1 bits (24), Expect = 0.026 Identities = 69/84 (82%) Strand = Plus / Minus Query: 317 gtgtcgggcttccagttggccgggatgacttgtttggccaccagcgtcttgccggattcg 376 ||||||| |||||||||||| |||||||| | ||||| | ||| |||||||||| ||| Sbjct: 793 gtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgccggactcg 734 Query: 377 ctgcggatgcggagcgagaagggg 400 ||| || ||||| ||||||||| Sbjct: 733 ctggtgacgcggatggagaagggg 710
>gb|AY543540.1| Triticum aestivum expansin EXPB5 mRNA, complete cds Length = 960 Score = 48.1 bits (24), Expect = 0.026 Identities = 72/88 (81%) Strand = Plus / Minus Query: 317 gtgtcgggcttccagttggccgggatgacttgtttggccaccagcgtcttgccggattcg 376 ||||||| |||||||||||| |||||||| | ||||| | ||| ||||||||| ||| Sbjct: 776 gtgtcggccttccagttggcggggatgacgtccttggcgatgagcttcttgccgggctcg 717 Query: 377 ctgcggatgcggagcgagaaggggccct 404 ||| || ||||| ||||||||||||| Sbjct: 716 ctggtgacgcggatggagaaggggccct 689
>gb|AF220610.1| Oryza sativa pollen allergen mRNA, complete cds Length = 1106 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgccccacga 447 |||||||| |||||||||||||||||| Sbjct: 711 gtccatcctccagatggcgccccacga 685
>ref|NM_197637.1| Oryza sativa (japonica cultivar-group) beta-expansin (OSJNBa0082M15.4), mRNA Length = 1148 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgccccacga 447 |||||||| |||||||||||||||||| Sbjct: 726 gtccatcctccagatggcgccccacga 700
>gb|AF261277.1| Oryza sativa beta-expansin (EXPB9) mRNA, complete cds Length = 1117 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgccccacga 447 |||||||| |||||||||||||||||| Sbjct: 726 gtccatcctccagatggcgccccacga 700
>gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 genomic sequence, complete sequence Length = 158550 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 421 gtccatccgccagatggcgccccacga 447 |||||||| |||||||||||||||||| Sbjct: 117157 gtccatcctccagatggcgccccacga 117183
>gb|AF332179.1|AF332179 Zea mays beta-expansin 6 (expB6) mRNA, complete cds Length = 1142 Score = 46.1 bits (23), Expect = 0.10 Identities = 92/115 (80%) Strand = Plus / Minus Query: 330 agttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcgga 389 |||||||||||||||| | |||||||||||| | ||||||| ||| || |||||| | Sbjct: 873 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgatgcgca 814 Query: 390 gcgagaaggggccctgcagccggcgcctggagtccatccgccagatggcgcccca 444 ||||||||||| | ||| |||| ||| ||| |||| |||||||| |||||| Sbjct: 813 tggagaaggggccacggagcgggcggttggggtcgatcctccagatggagcccca 759
>gb|AF159703.2| Cynodon dactylon clone 009 acidic Cyn d 1 isoallergen isoform 1 precursor, mRNA, partial cds Length = 735 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgccccacga 447 |||||||| |||||||||||||||||| Sbjct: 603 gtccatcctccagatggcgccccacga 577
>dbj|AK099112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023033P05, full insert sequence Length = 1071 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgccccacga 447 |||||||| |||||||||||||||||| Sbjct: 742 gtccatcctccagatggcgccccacga 716
>dbj|AK070187.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023043G12, full insert sequence Length = 1121 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgccccacga 447 |||||||| |||||||||||||||||| Sbjct: 742 gtccatcctccagatggcgccccacga 716
>gb|AY104151.1| Zea mays PCO112411 mRNA sequence Length = 1171 Score = 46.1 bits (23), Expect = 0.10 Identities = 92/115 (80%) Strand = Plus / Minus Query: 330 agttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgcgga 389 |||||||||||||||| | |||||||||||| | ||||||| ||| || |||||| | Sbjct: 882 agttggccgggatgacgttcttggccaccagctgcctgccggactcgttggtgatgcgca 823 Query: 390 gcgagaaggggccctgcagccggcgcctggagtccatccgccagatggcgcccca 444 ||||||||||| | ||| |||| ||| ||| |||| |||||||| |||||| Sbjct: 822 tggagaaggggccacggagcgggcggttggggtcgatcctccagatggagcccca 768
>gb|AY197353.1| Zea mays clone pJR9 beta-expansin 1 protein (EXPB1) mRNA, complete cds Length = 1066 Score = 44.1 bits (22), Expect = 0.41 Identities = 64/78 (82%) Strand = Plus / Minus Query: 327 tccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgc 386 ||||||| ||||||||||| | |||||| | | | |||||||||| |||||| || || Sbjct: 800 tccagttcgccgggatgacgtctttggcgatgaccttcttgccggactcgctggtgaggc 741 Query: 387 ggagcgagaaggggccct 404 ||| ||||||||||||| Sbjct: 740 ggatggagaaggggccct 723 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgcccca 444 |||||||| ||||||||||||||| Sbjct: 706 gtccatcctccagatggcgcccca 683
>gb|AF332174.1|AF332174 Zea mays beta-expansin 1 (expB1) mRNA, complete cds Length = 1080 Score = 44.1 bits (22), Expect = 0.41 Identities = 64/78 (82%) Strand = Plus / Minus Query: 327 tccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgc 386 ||||||| ||||||||||| | |||||| | | | |||||||||| |||||| || || Sbjct: 800 tccagttcgccgggatgacgtctttggcgatgaccttcttgccggactcgctggtgaggc 741 Query: 387 ggagcgagaaggggccct 404 ||| ||||||||||||| Sbjct: 740 ggatggagaaggggccct 723 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgcccca 444 |||||||| ||||||||||||||| Sbjct: 706 gtccatcctccagatggcgcccca 683
>gb|AY103636.1| Zea mays PCO124530 mRNA sequence Length = 1085 Score = 44.1 bits (22), Expect = 0.41 Identities = 64/78 (82%) Strand = Plus / Minus Query: 327 tccagttggccgggatgacttgtttggccaccagcgtcttgccggattcgctgcggatgc 386 ||||||| ||||||||||| | |||||| | | | |||||||||| |||||| || || Sbjct: 812 tccagttcgccgggatgacgtctttggcgatgaccttcttgccggactcgctggtgaggc 753 Query: 387 ggagcgagaaggggccct 404 ||| ||||||||||||| Sbjct: 752 ggatggagaaggggccct 735 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgcccca 444 |||||||| ||||||||||||||| Sbjct: 718 gtccatcctccagatggcgcccca 695
>gb|AC151465.2| Xenopus tropicalis BAC clone ISB1-248C16 containing genes for GCIP-interacting protein and wise-A, complete cds, complete sequence Length = 77008 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 210 ttcaacaatatactttggatt 230 ||||||||||||||||||||| Sbjct: 33873 ttcaacaatatactttggatt 33853
>emb|BX248585.1| Blochmannia floridanus complete genome; segment 2/3 Length = 267050 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 198 ttgtaaataaaattcaacaat 218 ||||||||||||||||||||| Sbjct: 61853 ttgtaaataaaattcaacaat 61873
>gb|AC108105.2| Homo sapiens chromosome 5 clone RP11-209B12, complete sequence Length = 162993 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 202 aaataaaattcaacaatatac 222 ||||||||||||||||||||| Sbjct: 112647 aaataaaattcaacaatatac 112627
>gb|AC113394.2| Homo sapiens chromosome 5 clone RP11-404J7, complete sequence Length = 117333 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 202 aaataaaattcaacaatatac 222 ||||||||||||||||||||| Sbjct: 51762 aaataaaattcaacaatatac 51782
>gb|S83343.1| Cyn d 1=major allergen {clone 14c1 and CD1} [Cynodon dactylon=Bermuda grass, pollen, mRNA Partial, 759 nt] Length = 759 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 317 gtgtcgggcttccagttggccgggatgac 345 ||||| |||||||||||||| |||||||| Sbjct: 707 gtgtctggcttccagttggctgggatgac 679
>gb|AY112069.1| Zea mays CL35761_1 mRNA sequence Length = 631 Score = 42.1 bits (21), Expect = 1.6 Identities = 36/41 (87%) Strand = Plus / Plus Query: 359 agcgtcttgccggattcgctgcggatgcggagcgagaaggg 399 |||||||||||||| ||| ||||| |||||| |||||||| Sbjct: 167 agcgtcttgccggagtcggtgcgggtgcggatggagaaggg 207
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 352 ggccaccagcgtcttgccgg 371 |||||||||||||||||||| Sbjct: 2016483 ggccaccagcgtcttgccgg 2016464
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 ggccaccagcgtcttgccgg 371 |||||||||||||||||||| Sbjct: 1260021 ggccaccagcgtcttgccgg 1260040
>gb|AC150548.2| Bos taurus BAC CH240-72J19 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 176133 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 aaataaaattcaacaatata 221 |||||||||||||||||||| Sbjct: 20524 aaataaaattcaacaatata 20505
>gb|AC092268.4| Homo sapiens chromosome X clone RP11-185O17 map p11.4, complete sequence Length = 183539 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 aaataaaattcaacaatata 221 |||||||||||||||||||| Sbjct: 46592 aaataaaattcaacaatata 46611
>gb|AC108882.4| Homo sapiens chromosome X clone RP11-77G22 map p11.4, complete sequence Length = 173352 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 aaataaaattcaacaatata 221 |||||||||||||||||||| Sbjct: 142339 aaataaaattcaacaatata 142358
>gb|AY172516.1| Rhizobium etli transcription repair coupling factor (mfd) gene, partial cds; recombination and repair protein (recG) gene, complete cds; and unknown gene Length = 6176 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 353 gccaccagcgtcttgccgga 372 |||||||||||||||||||| Sbjct: 4669 gccaccagcgtcttgccgga 4650
>gb|AC015968.4| Homo sapiens BAC clone RP11-133L20 from 7, complete sequence Length = 128638 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 aaataaaattcaacaatata 221 |||||||||||||||||||| Sbjct: 29550 aaataaaattcaacaatata 29569
>emb|X63202.1|BSEMSP B.secalinas embryo-specific mRNA Length = 816 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 488 cgggcttccagttggccggg 469
>emb|AL590395.4| Human DNA sequence from clone RP11-390H11 on chromosome 6, complete sequence Length = 154747 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 aaataaaattcaacaatata 221 |||||||||||||||||||| Sbjct: 117337 aaataaaattcaacaatata 117356
>emb|AL451123.12| Human DNA sequence from clone RP11-27J8 on chromosome 9 Contains the gene for interferon kappa precursor (IFNK), the 5' UTR of a novel gene (FLJ13204), a novel gene, includes FLJ25077 and FLJ11109 (MGC23980) and 2 CpG islands, complete sequence Length = 140827 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 141 tcattccattccccatatat 160 |||||||||||||||||||| Sbjct: 57294 tcattccattccccatatat 57313
>emb|AL390123.14| Human DNA sequence from clone RP11-566F5 on chromosome 10, complete sequence Length = 158093 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 aaataaaattcaacaatata 221 |||||||||||||||||||| Sbjct: 123388 aaataaaattcaacaatata 123369
>gb|AY197352.1| Zea mays clone pJR11 beta-expansin 9 protein (EXPB9) mRNA, complete cds Length = 1088 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgcccca 444 |||||||| ||||||||||||||| Sbjct: 680 gtccatcctccagatggcgcccca 657
>emb|BX053384.1|CNS09DCS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 289 cgggcttccagttggccggg 308
>emb|BX053383.1|CNS09DCR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 725 cgggcttccagttggccggg 706
>emb|BX070810.1|CNS09QSU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 764 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 576 cgggcttccagttggccggg 557
>emb|BX069290.1|CNS09PMM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1018 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 402 cgggcttccagttggccggg 421
>emb|BX069289.1|CNS09PML Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1036 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 734 cgggcttccagttggccggg 715
>emb|BX068000.1|CNS09OMS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 384 cgggcttccagttggccggg 403
>emb|BX067999.1|CNS09OMR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 720 cgggcttccagttggccggg 701
>emb|BX067924.1|CNS09OKO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51DD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 875 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 361 cgggcttccagttggccggg 380
>emb|BX067923.1|CNS09OKN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51DD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1004 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 709 cgggcttccagttggccggg 690
>emb|BX067642.1|CNS09OCU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 380 cgggcttccagttggccggg 399
>emb|BX067641.1|CNS09OCT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 712 cgggcttccagttggccggg 693
>emb|BX067553.1|CNS09OAD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 311 cgggcttccagttggccggg 330
>emb|BX067552.1|CNS09OAC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1009 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 707 cgggcttccagttggccggg 688
>emb|BX066871.1|CNS09NRF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 970 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 366 cgggcttccagttggccggg 385
>emb|BX066870.1|CNS09NRE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 720 cgggcttccagttggccggg 701
>emb|BX066317.1|CNS09NC1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 731 cgggcttccagttggccggg 712
>emb|BX066088.1|CNS09N5O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5BA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 664 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 182 cgggcttccagttggccggg 201
>emb|BX066087.1|CNS09N5N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 973 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 714 cgggcttccagttggccggg 695
>emb|BX064916.1|CNS09M94 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 355 cgggcttccagttggccggg 374
>emb|BX064915.1|CNS09M93 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 523 cgggcttccagttggccggg 504
>emb|BX064537.1|CNS09LYL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 391 cgggcttccagttggccggg 410
>emb|BX064536.1|CNS09LYK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 727 cgggcttccagttggccggg 708
>emb|BX064227.1|CNS09LPZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 897 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 366 cgggcttccagttggccggg 385
>emb|BX063236.1|CNS09KYG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 602 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 362 cgggcttccagttggccggg 381
>emb|BX063235.1|CNS09KYF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 530 cgggcttccagttggccggg 511
>emb|BX063000.1|CNS09KRW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 728 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 360 cgggcttccagttggccggg 379
>emb|BX062999.1|CNS09KRV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1023 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 711 cgggcttccagttggccggg 692
>emb|BX062727.1|CNS09KKB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 451 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 369 cgggcttccagttggccggg 388
>emb|BX062083.1|CNS09K2F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 852 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 369 cgggcttccagttggccggg 388
>emb|BX062082.1|CNS09K2E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 705 cgggcttccagttggccggg 686
>emb|BX061501.1|CNS09JM9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 363 cgggcttccagttggccggg 382
>emb|BX061473.1|CNS09JLH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 663 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 370 cgggcttccagttggccggg 389
>emb|BX060364.1|CNS09IQO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 887 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 387 cgggcttccagttggccggg 406
>emb|BX060363.1|CNS09IQN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 727 cgggcttccagttggccggg 708
>emb|BX059169.1|CNS09HTH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1023 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 364 cgggcttccagttggccggg 383
>emb|BX059168.1|CNS09HTG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1014 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 719 cgggcttccagttggccggg 700
>emb|BX057376.1|CNS09GFO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37BC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 385 cgggcttccagttggccggg 404
>emb|BX057375.1|CNS09GFN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37BC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 709 cgggcttccagttggccggg 690
>emb|BX056369.1|CNS09FNP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 736 cgggcttccagttggccggg 717
>emb|BX056328.1|CNS09FMK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 617 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 148 cgggcttccagttggccggg 167
>emb|BX056327.1|CNS09FMJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 568 cgggcttccagttggccggg 549
>emb|BX055202.1|CNS09ERA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33DA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 685 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 357 cgggcttccagttggccggg 376
>emb|BX055201.1|CNS09ER9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33DA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 601 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 526 cgggcttccagttggccggg 507
>emb|BX051413.1|CNS09BU1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC28DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 764 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 372 cgggcttccagttggccggg 391
>emb|BX051412.1|CNS09BU0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 746 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 712 cgggcttccagttggccggg 693
>emb|BX048982.1|CNS099YI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC24CC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 726 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 694 cgggcttccagttggccggg 675
>emb|BX048360.1|CNS099H8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC23BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 497 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 403 cgggcttccagttggccggg 422
>emb|BX044318.1|CNS096CY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC17DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 362 cgggcttccagttggccggg 381
>emb|BX044317.1|CNS096CX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC17DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 597 cgggcttccagttggccggg 578
>emb|BX042869.1|CNS0958P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC15AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 406 cgggcttccagttggccggg 425
>emb|BX042868.1|CNS0958O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 722 cgggcttccagttggccggg 703
>emb|BX041612.1|CNS0949S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 262 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 186 cgggcttccagttggccggg 205
>emb|BX041611.1|CNS0949R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC13AE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 836 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 705 cgggcttccagttggccggg 686
>emb|BX041334.1|CNS09422 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 269 cgggcttccagttggccggg 288
>emb|BX041333.1|CNS09421 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC12CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 883 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 617 cgggcttccagttggccggg 598
>emb|BX041214.1|CNS093YQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 386 cgggcttccagttggccggg 405
>emb|BX041213.1|CNS093YP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC12BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 710 cgggcttccagttggccggg 691
>emb|BX041188.1|CNS093Y0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 498 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 367 cgggcttccagttggccggg 386
>emb|BX041187.1|CNS093XZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC12BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 719 cgggcttccagttggccggg 700
>emb|BX039275.1|CNS092GV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC1AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 882 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 336 cgggcttccagttggccggg 355
>emb|BX039274.1|CNS092GU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC1AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 970 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 747 cgggcttccagttggccggg 728
>emb|BX037468.1|CNS0912O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 377 cgggcttccagttggccggg 396
>emb|BX037467.1|CNS0912N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1059 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 720 cgggcttccagttggccggg 701
>emb|BX036510.1|CNS090C2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 861 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 719 cgggcttccagttggccggg 700
>emb|BX035990.1|CNS08ZXM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 714 cgggcttccagttggccggg 695
>emb|BX034262.1|CNS08YLM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50AD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 926 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 704 cgggcttccagttggccggg 685
>emb|BX031811.1|CNS08WPJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 372 cgggcttccagttggccggg 391
>emb|BX031810.1|CNS08WPI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 708 cgggcttccagttggccggg 689
>emb|BX031320.1|CNS08WBW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA46CH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 792 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 374 cgggcttccagttggccggg 393
>emb|BX031319.1|CNS08WBV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46CH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 720 cgggcttccagttggccggg 701
>emb|BX031133.1|CNS08W6P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA46BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 373 cgggcttccagttggccggg 392
>emb|BX031132.1|CNS08W6O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 712 cgggcttccagttggccggg 693
>emb|BX028834.1|CNS08UEU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA43AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 788 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 371 cgggcttccagttggccggg 390
>emb|BX028833.1|CNS08UET Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA43AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 699 cgggcttccagttggccggg 680
>emb|BX027737.1|CNS08TKD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 629 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 445 cgggcttccagttggccggg 426
>emb|BX025425.1|CNS08RS5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA39AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 372 cgggcttccagttggccggg 391
>emb|BX025424.1|CNS08RS4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA39AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 704 cgggcttccagttggccggg 685
>emb|BX025171.1|CNS08RL3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 390 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 186 cgggcttccagttggccggg 205
>emb|BX025170.1|CNS08RL2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA38CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 924 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 709 cgggcttccagttggccggg 690
>emb|BX023597.1|CNS08QDD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA36AC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 442 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 387 cgggcttccagttggccggg 406
>emb|BX023566.1|CNS08QCI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA36AB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 821 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 721 cgggcttccagttggccggg 702
>emb|BX021889.1|CNS08P1X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA32CA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 866 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 354 cgggcttccagttggccggg 373
>emb|BX021888.1|CNS08P1W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32CA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 708 cgggcttccagttggccggg 689
>emb|BX020060.1|CNS08NN4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA3CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1039 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 378 cgggcttccagttggccggg 397
>emb|BX020059.1|CNS08NN3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA3CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1038 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 707 cgggcttccagttggccggg 688
>emb|BX019879.1|CNS08NI3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA3BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 387 cgggcttccagttggccggg 406
>emb|BX019878.1|CNS08NI2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA3BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 627 cgggcttccagttggccggg 608
>emb|BX016635.1|CNS08KZZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA25AB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 594 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 393 cgggcttccagttggccggg 412
>emb|BX016634.1|CNS08KZY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA25AB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 729 cgggcttccagttggccggg 710
>emb|BX015941.1|CNS08KGP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 702 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 397 cgggcttccagttggccggg 378
>emb|BX014548.1|CNS08JE0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA21DE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1054 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 379 cgggcttccagttggccggg 398
>emb|BX014547.1|CNS08JDZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA21DE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 725 cgggcttccagttggccggg 706
>emb|BX013680.1|CNS08IPW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA20CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 364 cgggcttccagttggccggg 383
>emb|BX013679.1|CNS08IPV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA20CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 709 cgggcttccagttggccggg 690
>emb|BX012100.1|CNS08HI0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA19BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 734 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 708 cgggcttccagttggccggg 689
>emb|BX012009.1|CNS08HFH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA19AF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 704 cgggcttccagttggccggg 685
>emb|BX011355.1|CNS08GXB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA18AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 370 cgggcttccagttggccggg 389
>emb|BX011354.1|CNS08GXA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA18AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1023 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 731 cgggcttccagttggccggg 712
>emb|BX009675.1|CNS08FMN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 495 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 380 cgggcttccagttggccggg 399
>emb|BX009674.1|CNS08FMM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA15CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 926 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 718 cgggcttccagttggccggg 699
>emb|BX009416.1|CNS08FFG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA15BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 720 cgggcttccagttggccggg 701
>emb|BX005616.1|CNS08CHW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA1AG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 376 cgggcttccagttggccggg 395
>emb|X96551.1|HVPER1 H.vulgare Per1 gene Length = 1994 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 1715 cgggcttccagttggccggg 1696
>emb|X76605.1|HVB15C H.vulgare (cv. Bomi) B15C mRNA Length = 864 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 585 cgggcttccagttggccggg 566
>emb|BX842575.1| Mycobacterium tuberculosis H37Rv complete genome; segment 4/13 Length = 349306 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 ggccaccagcgtcttgccgg 371 |||||||||||||||||||| Sbjct: 226687 ggccaccagcgtcttgccgg 226706
>emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 4/14 Length = 327650 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 ggccaccagcgtcttgccgg 371 |||||||||||||||||||| Sbjct: 274845 ggccaccagcgtcttgccgg 274864
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 353 gccaccagcgtcttgccgga 372 |||||||||||||||||||| Sbjct: 2190610 gccaccagcgtcttgccgga 2190629
>gb|AC093826.2| Homo sapiens chromosome 4 clone RP11-392L5, complete sequence Length = 174277 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 aaataaaattcaacaatata 221 |||||||||||||||||||| Sbjct: 107932 aaataaaattcaacaatata 107951
>gb|AC145937.2| Pan troglodytes BAC clone RP43-10P16 from chromosome 7, complete sequence Length = 182785 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 aaataaaattcaacaatata 221 |||||||||||||||||||| Sbjct: 119081 aaataaaattcaacaatata 119062
>gb|AC068546.6| Homo sapiens BAC clone RP11-406M18 from 2, complete sequence Length = 89493 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 198 ttgtaaataaaattcaacaatata 221 ||||||||||||| |||||||||| Sbjct: 64494 ttgtaaataaaatccaacaatata 64517
>gb|AF177379.1| Cynodon dactylon acidic Cyn d 1 isoallergen isoform 3 precursor, mRNA, complete cds Length = 789 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgcccca 444 |||||||| ||||||||||||||| Sbjct: 657 gtccatcctccagatggcgcccca 634
>ref|XM_308081.2| Anopheles gambiae str. PEST ENSANGP00000019782 (ENSANGG00000017293), mRNA Length = 1128 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgggcttccagttggccggg 340 |||||||||||||||||||| Sbjct: 742 cgggcttccagttggccggg 723
>gb|L14271.1|MZEPOLPI Zea mays Zea mI gene, complete cds Length = 827 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 421 gtccatccgccagatggcgcccca 444 |||||||| ||||||||||||||| Sbjct: 441 gtccatcctccagatggcgcccca 418
>dbj|AP001578.3| Homo sapiens genomic DNA, chromosome 6q25.2, clone:KB1954F7 Length = 239057 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 206 aaaattcaacaatatacttt 225 |||||||||||||||||||| Sbjct: 121086 aaaattcaacaatatacttt 121067 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,995,453 Number of Sequences: 3902068 Number of extensions: 2995453 Number of successful extensions: 67717 Number of sequences better than 10.0: 225 Number of HSP's better than 10.0 without gapping: 225 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 67234 Number of HSP's gapped (non-prelim): 467 length of query: 469 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 447 effective length of database: 17,147,199,772 effective search space: 7664798298084 effective search space used: 7664798298084 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
