>gb|AY377991.1| Triticum aestivum chloroplast-localized Ptr ToxA-binding protein1
            (TaThf1) mRNA, complete cds; nuclear gene for chloroplast
            product
          Length = 1130

 Score =  375 bits (189), Expect = e-101
 Identities = 265/288 (92%), Gaps = 8/288 (2%)
 Strand = Plus / Minus

                                                                        
Query: 17   ttcatatattgtcaacgaagtgaagaaaacggtacattcgaacacagagaaggagaaatt 76
            |||||||||||||||  |||||||||||||| | |||||||||||||| |||||||||||
Sbjct: 1099 ttcatatattgtcaaataagtgaagaaaacgatccattcgaacacagacaaggagaaatt 1040

                                                                        
Query: 77   acaaaataccaac-----tactgcgaataatctggatctttttgtaccgccgagtactac 131
            ||||||||||||      |||| |||||||||||||||||||||||| || |||||||||
Sbjct: 1039 acaaaataccaaactcaatactacgaataatctggatctttttgtacggcggagtactac 980

                                                                        
Query: 132  ac-cacgctaagagcagccaaagatgcccccgatagttctcaacgctatccagatgt--a 188
            || | ||| ||||||||||||||||||||||||||||||||||||||||||||||||  |
Sbjct: 979  actcgcgcgaagagcagccaaagatgcccccgatagttctcaacgctatccagatgtgta 920

                                                                        
Query: 189  taactgttaatatctgttatccggacaagctctcctctggggaaaggttgagttaatgct 248
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 919  taactgttaatatctgttatccggacaagctgtcctctggggaaaggttgagttaatgct 860

                                                            
Query: 249  tcaagggataagtgcttccatcgaattttgcaacagccccgttcggct 296
            |||||||||||| ||||||||||||||||||||||||| | |||||||
Sbjct: 859  tcaagggataagcgcttccatcgaattttgcaacagcctcattcggct 812

>gb|AY736122.1| Triticum aestivum chloroplast inositol phosphatase-like protein
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 909

 Score =  103 bits (52), Expect = 3e-19
 Identities = 61/64 (95%)
 Strand = Plus / Minus

                                                                       
Query: 233 aggttgagttaatgcttcaagggataagtgcttccatcgaattttgcaacagccccgttc 292
           |||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||
Sbjct: 909 aggttgagttaatgcttcaagggataagcgcttccatcgaattttgcaacagcctcattc 850

               
Query: 293 ggct 296
           ||||
Sbjct: 849 ggct 846

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 59/69 (85%), Gaps = 3/69 (4%)
 Strand = Plus / Plus

                                                                            
Query: 14       ctcttcatatattgtcaacgaagtgaagaaaacggtacattcgaacacagagaaggagaa 73
                |||||||||||||||||| |||   | ||||||| |||||| |||||| || |||||| |
Sbjct: 22265524 ctcttcatatattgtcaaagaa--aaggaaaacgatacatttgaacactgaaaaggag-a 22265580

                         
Query: 74       attacaaaa 82
                |||||||||
Sbjct: 22265581 attacaaaa 22265589

>dbj|AP005195.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0567H04
          Length = 181420

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 59/69 (85%), Gaps = 3/69 (4%)
 Strand = Plus / Plus

                                                                         
Query: 14    ctcttcatatattgtcaacgaagtgaagaaaacggtacattcgaacacagagaaggagaa 73
             |||||||||||||||||| |||   | ||||||| |||||| |||||| || |||||| |
Sbjct: 70770 ctcttcatatattgtcaaagaa--aaggaaaacgatacatttgaacactgaaaaggag-a 70826

                      
Query: 74    attacaaaa 82
             |||||||||
Sbjct: 70827 attacaaaa 70835

>dbj|AK059695.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-B12, full
            insert sequence
          Length = 1512

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 59/69 (85%), Gaps = 3/69 (4%)
 Strand = Plus / Minus

                                                                        
Query: 14   ctcttcatatattgtcaacgaagtgaagaaaacggtacattcgaacacagagaaggagaa 73
            |||||||||||||||||| |||   | ||||||| |||||| |||||| || |||||| |
Sbjct: 1448 ctcttcatatattgtcaaagaa--aaggaaaacgatacatttgaacactgaaaaggag-a 1392

                     
Query: 74   attacaaaa 82
            |||||||||
Sbjct: 1391 attacaaaa 1383

>gb|AE016826.1| Buchnera aphidicola str. Bp (Baizongia pistaciae), complete genome
          Length = 615980

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 5      accaaataactcttcatatat 25
              |||||||||||||||||||||
Sbjct: 446416 accaaataactcttcatatat 446436

>emb|AL161624.7| Human DNA sequence from clone RP11-487I9 on chromosome X Contains part
             of the DIAPH2 gene for Drosophila diaphanous homolog 2 and
             the 3' end of a novel gene (EPAG), complete sequence
          Length = 133021

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 184   atgtataactgttaatatct 203
             ||||||||||||||||||||
Sbjct: 49628 atgtataactgttaatatct 49609

>emb|BX842632.1| Neurospora crassa DNA linkage group I BAC contig B5K2
          Length = 86737

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 130   acaccacgctaagagcagcc 149
             ||||||||||||||||||||
Sbjct: 41587 acaccacgctaagagcagcc 41568

>gb|AC073531.22| Homo sapiens 12 BAC RP11-802J22 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 212172

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    gaacacagagaaggagaaat 75
             ||||||||||||||||||||
Sbjct: 65255 gaacacagagaaggagaaat 65236

>gb|AC099538.2| Homo sapiens chromosome 3 clone RP11-90I9, complete sequence
          Length = 170033

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 235  gttgagttaatgcttcaagg 254
            ||||||||||||||||||||
Sbjct: 6476 gttgagttaatgcttcaagg 6495

>gb|AC099053.2| Homo sapiens chromosome 3 clone RP11-464H2, complete sequence
          Length = 200069

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 235    gttgagttaatgcttcaagg 254
              ||||||||||||||||||||
Sbjct: 172320 gttgagttaatgcttcaagg 172339

>dbj|AK113914.1| Ciona intestinalis cDNA, clone:cicl016f10, full insert sequence
          Length = 2013

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 8    aaataactcttcatatattgtcaa 31
            |||||||||||||||| |||||||
Sbjct: 1687 aaataactcttcatattttgtcaa 1664


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,619,645
Number of Sequences: 3902068
Number of extensions: 2619645
Number of successful extensions: 50974
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 50944
Number of HSP's gapped (non-prelim): 31
length of query: 296
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 274
effective length of database: 17,147,199,772
effective search space: 4698332737528
effective search space used: 4698332737528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)