ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaet71b08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ496572.1|HVU496572 Hordeum vulgare partial mRNA for putati... 52 6e-04
2gb|CP000264.1| Jannaschia sp. CCS1, complete genome 46 0.035
3gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 44 0.14
4dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 42 0.54
5gb|AE011982.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 0.54
6emb|BX510908.8| Mouse DNA sequence from clone RP23-264F3 on chro... 42 0.54
7gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 42 0.54
8gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome 40 2.2
9gb|AC147068.3| Pan troglodytes BAC clone RP43-165E11 from 7, com... 40 2.2
10gb|DQ096557.1| Mesocestoides sp. C KP-2005 isolate KAP113 5.8S r... 40 2.2
11gb|AC009362.8|AC009362 Homo sapiens chromosome 7 clone RP11-256C... 40 2.2
12gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosom... 38 8.5
13gb|AC110521.14| Mus musculus chromosome 12, clone RP23-50H15, co... 38 8.5
14gb|AC046160.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 38 8.5
15gb|AC113970.8| Mus musculus chromosome 1, clone RP23-125E16, com... 38 8.5
16emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS... 38 8.5
17gb|AC025264.16| Homo sapiens 12 BAC RP11-704P17 (Roswell Park Ca... 38 8.5
18gb|AC024337.8| Homo sapiens chromosome 15, clone RP11-236L14, co... 38 8.5
19gb|AC018574.6| Homo sapiens chromosome , clone RP11-4G2, complet... 38 8.5
20emb|AL161711.4|CEY10G11A Caenorhabditis elegans YAC Y10G11A, com... 38 8.5
21emb|AL929119.19| Zebrafish DNA sequence from clone CH211-214G8 i... 38 8.5
22gb|AC167967.6| Culex pipiens quinquefasciatus, clone Culex pipie... 38 8.5

>emb|AJ496572.1|HVU496572 Hordeum vulgare partial mRNA for putative glycosyltransferase (sf2
           gene)
          Length = 863

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 70  ctagattccatggcgtcatggctgtcgtcg 99
           ||||||||||||||||||||||||| ||||
Sbjct: 863 ctagattccatggcgtcatggctgtggtcg 834



to top

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 46.1 bits (23), Expect = 0.035
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 76      tccatggcgtcatggctgtcgtc 98
               |||||||||||||||||||||||
Sbjct: 1808032 tccatggcgtcatggctgtcgtc 1808010



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 81      ggcgtcatggctgtcgtcgtagcaaagatc 110
               |||||||| ||||||||||| |||||||||
Sbjct: 2126954 ggcgtcatagctgtcgtcgtcgcaaagatc 2126925



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 42.1 bits (21), Expect = 0.54
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 79      atggcgtcatggctgtcgtcg 99
               |||||||||||||||||||||
Sbjct: 1189124 atggcgtcatggctgtcgtcg 1189144



to top

>gb|AE011982.1| Xanthomonas axonopodis pv. citri str. 306,  section 360 of 469 of the
            complete genome
          Length = 13732

 Score = 42.1 bits (21), Expect = 0.54
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 79   atggcgtcatggctgtcgtcg 99
            |||||||||||||||||||||
Sbjct: 3315 atggcgtcatggctgtcgtcg 3295



to top

>emb|BX510908.8| Mouse DNA sequence from clone RP23-264F3 on chromosome 2, complete
             sequence
          Length = 80804

 Score = 42.1 bits (21), Expect = 0.54
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 115   aaaaagaaagttcaaagctgc 135
             |||||||||||||||||||||
Sbjct: 66724 aaaaagaaagttcaaagctgc 66704



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 42.1 bits (21), Expect = 0.54
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 79      atggcgtcatggctgtcgtcg 99
               |||||||||||||||||||||
Sbjct: 1222669 atggcgtcatggctgtcgtcg 1222689



to top

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 79      atggcgtcatggctgtcgtc 98
               ||||||||||||||||||||
Sbjct: 1849290 atggcgtcatggctgtcgtc 1849271



to top

>gb|AC147068.3| Pan troglodytes BAC clone RP43-165E11 from 7, complete sequence
          Length = 177119

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   atccaaaaagaaagttcaaa 130
             ||||||||||||||||||||
Sbjct: 34418 atccaaaaagaaagttcaaa 34437



to top

>gb|DQ096557.1| Mesocestoides sp. C KP-2005 isolate KAP113 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, partial sequence
          Length = 519

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  tggctgtcgtcgtagcaaag 107
           ||||||||||||||||||||
Sbjct: 274 tggctgtcgtcgtagcaaag 293



to top

>gb|AC009362.8|AC009362 Homo sapiens chromosome 7 clone RP11-256C6, complete sequence
          Length = 160156

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   atccaaaaagaaagttcaaa 130
             ||||||||||||||||||||
Sbjct: 77816 atccaaaaagaaagttcaaa 77835



to top

>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence
          Length = 196951

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 110   catccaaaaagaaagttca 128
             |||||||||||||||||||
Sbjct: 60367 catccaaaaagaaagttca 60349



to top

>gb|AC110521.14| Mus musculus chromosome 12, clone RP23-50H15, complete sequence
          Length = 189474

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 104   aaagatcatccaaaaagaaagtt 126
             |||||||||| ||||||||||||
Sbjct: 94138 aaagatcatcaaaaaagaaagtt 94116



to top

>gb|AC046160.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-130F23, complete
              sequence
          Length = 214627

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 119    agaaagttcaaagctgccc 137
              |||||||||||||||||||
Sbjct: 154344 agaaagttcaaagctgccc 154326



to top

>gb|AC113970.8| Mus musculus chromosome 1, clone RP23-125E16, complete sequence
          Length = 235703

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 119    agaaagttcaaagctgccc 137
              |||||||||||||||||||
Sbjct: 165246 agaaagttcaaagctgccc 165228



to top

>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
             hansenii
          Length = 2051428

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 128   aaagctgcccaaacacaccgatc 150
             ||||||| |||||||||||||||
Sbjct: 29766 aaagctgaccaaacacaccgatc 29744



to top

>gb|AC025264.16| Homo sapiens 12 BAC RP11-704P17 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 193626

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 128    aaagctgcccaaacacacc 146
              |||||||||||||||||||
Sbjct: 184266 aaagctgcccaaacacacc 184284



to top

>gb|AC024337.8| Homo sapiens chromosome 15, clone RP11-236L14, complete sequence
          Length = 106945

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 156   gcctggatgtcttctccaa 174
             |||||||||||||||||||
Sbjct: 21013 gcctggatgtcttctccaa 20995



to top

>gb|AC018574.6| Homo sapiens chromosome , clone RP11-4G2, complete sequence
          Length = 171858

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 156   gcctggatgtcttctccaa 174
             |||||||||||||||||||
Sbjct: 37421 gcctggatgtcttctccaa 37439



to top

>emb|AL161711.4|CEY10G11A Caenorhabditis elegans YAC Y10G11A, complete sequence
          Length = 33670

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 115   aaaaagaaagttcaaagct 133
             |||||||||||||||||||
Sbjct: 16827 aaaaagaaagttcaaagct 16809



to top

>emb|AL929119.19| Zebrafish DNA sequence from clone CH211-214G8 in linkage group 20,
              complete sequence
          Length = 136176

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 110    catccaaaaagaaagttca 128
              |||||||||||||||||||
Sbjct: 118209 catccaaaaagaaagttca 118191



to top

>gb|AC167967.6| Culex pipiens quinquefasciatus, clone Culex pipiens
             quinquefasciatus-3940144D9, complete sequence
          Length = 114276

 Score = 38.2 bits (19), Expect = 8.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    ggcgtcatggctgtcgtcg 99
             |||||||||||||||||||
Sbjct: 70106 ggcgtcatggctgtcgtcg 70124


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,166,061
Number of Sequences: 3902068
Number of extensions: 1166061
Number of successful extensions: 145210
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 145040
Number of HSP's gapped (non-prelim): 170
length of query: 174
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 152
effective length of database: 17,147,199,772
effective search space: 2606374365344
effective search space used: 2606374365344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top